HTML
-
Total RNA was extracted from the brain vesicle tissues or NSCs of mouse embryos using TRIzol method (Ambion, USA). cDNA was synthesized using Oligo (dT) primers and RevertAid First Strand cDNA Synthesis Kit (Thermo, USA). PCR was performed using PCR Master Mix (2×) (Thermo, USA); primers used for the amplification are shown in Table 1. Expression of genes was normalized to that of the Actb gene.
Symbol Forward primer (5'-3') Reverse primer (5'-3') Nr2e1 GCACAAAGTCACAGGGTAATGA AGATGGAGACACGGAAATGG RARα CGACGAAGCATCCAGAAGAAC CGCAGAATCAGGATATCCAGG[18] Shh TGCTTTGTAACCGCCACTTT CTACAGGCTCCATCCTCGTG Ptch1 GACTGGGAAACTGGGAGGAT CCAAGCGGTCAGGTAGATGT Gli1 GCCACCAAGCCAACTTTATG ATTACGGTTTGCAGGTCGAG Actb GTCCCTCACCCTCCCAAAAG GCTGCCTCAACACCTCAACCC Table 1. Primer sequences used for RT-PCR analysis
[1] | Duester G. Retinoic acid synthesis and signaling during early organogenesis[J]. Cell, 2008, 134(): 921-31. doi: 10.1016/j.cell.2008.09.002 |
[2] | Halilagic A, Ribes V, Ghyselinck NB. Retinoids control anterior and dorsal properties in the developing forebrain[J]. Dev Biol, 2007, 303(): 362-75. doi: 10.1016/j.ydbio.2006.11.021 |
[3] | Gupta S, Sen J. Retinoic acid signaling regulates development of the dorsal forebrain midline and the choroid plexus in the chick[J]. Development, 2015, 142(): 1293-98. doi: 10.1242/dev.122390 |
[4] | Chambon P. A decade of molecular biology of retinoic acid receptors[J]. FASEB J, 1996, 10(): 940-54. |
[5] | Gofflot F, Chartoire N, Vasseur L. Systematic gene expression mapping clusters nuclear receptors according to their function in the brain[J]. Cell, 2007, 131(): 405-18. doi: 10.1016/j.cell.2007.09.012 |
[6] | Mangelsdorf DJ, Thummel C, Beato M. The nuclear receptor superfamily:the second decade[J]. Cell, 1995, 83(): 835-39. doi: 10.1016/0092-8674(95)90199-X |
[7] | Yu RT, McKeown M, Evans RM. Relationship between Drosophila gap gene tailless and a vertebrate nuclear receptor Tlx[J]. Nature, 1994, 370(): 375-9. doi: 10.1038/370375a0 |
[8] | Monaghan AP, Grau E, Bock D. The mouse homolog of the orphan nuclear receptor tailless is expressed in the developing forebrain[J]. Development, 1995, 121(): 839-53. |
[9] | Kitambi SS, Hauptmann G. The zebrafish orphan nuclear receptor genes nr2e1 and nr2e3 are expressed in developing eye and forebrain[J]. Gene Expr Patterns:GEP, 2007, 7(): 521-8. doi: 10.1016/j.modgep.2006.10.006 |
[10] | Yu RT, Chiang MY, Tanabe T. The orphan nuclear receptor Tlx regulates Pax2 and is essential for vision[J]. Proc Nat Acad Sci US A, 2000, 97(): 2621-5. doi: 10.1073/pnas.050566897 |
[11] | Monaghan AP, Bock D, Gass P. Defective limbic system in mice lacking the tailless gene[J]. Nature, 1997, 390(): 515-7. doi: 10.1038/37364 |
[12] | Roy K, Thiels E, Monaghan AP. Loss of the tailless gene affects forebrain development and emotional behavior[J]. Physiol Behav, 2002, 77(): 595-600. doi: 10.1016/S0031-9384(02)00902-2 |
[13] | Murai K, Qu Q, Sun G. Nuclear receptor TLX stimulates hippocampal neurogenesis and enhances learning and memory in a transgenic mouse model[J]. Proc Nat Acad Sci USA, 2014, 111(): 9115-20. doi: 10.1073/pnas.1406779111 |
[14] | Schmouth JF, Banks KG, Mathelier A. Retina restored and brain abnormalities ameliorated by single-copy knock-in of human NR2E1 in null mice[J]. Mol Cell Biol, 2012, 32(): 1296-311. doi: 10.1128/MCB.06016-11 |
[15] | Kumar RA, Leach S, Bonaguro R. Mutation and evolutionary analyses identify NR2E1-candidate-regulatory mutations in humans with severe cortical malformations[J]. Genes Brain Behavior, 2007, 6(): 503-16. doi: 10.1111/gbb.2007.6.issue-6 |
[16] | Kumar RA, McGhee KA, Leach S. Initial association of NR2E1 with bipolar disorder and identification of candidate mutations in bipolar disorder, schizophrenia, and aggression through resequencing[J]. Am J Med Genet B Neurops Psychiatr Genet, 2008, 147B(): 880-9. doi: 10.1002/ajmg.b.30696 |
[17] | Nakayama T, Momoki-Soga T, Yamaguchi K. Efficient production of neural stem cells and neurons from embryonic stem cells[J]. Neuroreport, 2004, 15(): 487-91. doi: 10.1097/00001756-200403010-00021 |
[18] | Kobayashi T, Komori R, Ishida K. Tal2 expression is induced by all-trans retinoic acid in P19 cells prior to acquisition of neural fate[J]. Sci Rep, 2014, 4(): 4935-. |
[19] | Tay Y, Zhang J, Thomson AM. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation[J]. Nature, 2008, 455(): 1124-8. doi: 10.1038/nature07299 |
[20] | Molyneaux BJ, Arlotta P, Menezes JR. Neuronal subtype specification in the cerebral cortex[J]. Nat Rev Neurosci, 2007, 8(): 427-37. doi: 10.1038/nrn2151 |
[21] | Zaki PA, Quinn JC, Price DJ. Mouse models of telencephalic development[J]. Current opinion in genetics & development, 2003, 13(): 423-37. |
[22] | Shimozono S, Iimura T, Kitaguchi T. Visualization of an endogenous retinoic acid gradient across embryonic development[J]. Nature, 2013, 496(): 363-6. doi: 10.1038/nature12037 |
[23] | Ross SA, McCaffery PJ, Drager UC. Retinoids in embryonal development[J]. Physiological reviews, 2000, 80(): 1021-54. |
[24] | Temple S. The development of neural stem cells[J]. Nature, 2001, 414(): 112-7. doi: 10.1038/35102174 |
[25] | Stenman JM, Wang B, Campbell K. Tlx controls proliferation and patterning of lateral telencephalic progenitor domains[J]. J Neurosci, 2003, 23(): 10568-76. |
[26] | Islam MM, Zhang CL. TLX:A master regulator for neural stem cell maintenance and neurogenesis[J]. Biochim Biophys Acta, 2015, 1849(): 210-6. doi: 10.1016/j.bbagrm.2014.06.001 |
[27] | Klein C, Fishell G. Neural stem cells:progenitors or panacea?[J]. Dev Neurosci, 2004, 26(): 82-92. |
[28] | Shi Y, Chichung Lie D, Taupin P. Expression and function of orphan nuclear receptor TLX in adult neural stem cells[J]. Nature, 2004, 427(): 78-83. doi: 10.1038/nature02211 |
[29] | Li W, Sun G, Yang S. Nuclear receptor TLX regulates cell cycle progression in neural stem cells of the developing brain[J]. Mol Endocrinol, 2008, 22(): 56-64. doi: 10.1210/me.2007-0290 |
[30] | Cheng W, Yu P, Wang L. Sonic hedgehog signaling mediates resveratrol to increase proliferation of neural stem cells after oxygen-glucose deprivation/reoxygenation injury in vitro[J]. Cell Physiol Biochem, 2015, 35(): 2019-32. doi: 10.1159/000374009 |
[31] | Wang X, Zhao Y. Umbilical cord blood cells regulate the differentiation of endogenous neural stem cells in hypoxic ischemic neonatal rats via the hedgehog signaling pathway[J]. Brain Res, 2014, 1560(): 18-26. doi: 10.1016/j.brainres.2014.02.019 |
[32] | Sehgal R, Sheibani N, Rhodes SJ. BMP7 and SHH regulate Pax2 in mouse retinal astrocytes by relieving TLX repression[J]. Dev Biol, 2009, 332(): 429-43. doi: 10.1016/j.ydbio.2009.05.579 |
[33] | Niu W, Zou Y, Shen C. Activation of postnatal neural stem cells requires nuclear receptor TLX[J]. J Neurosci, 2011, 31(): 13816-28. doi: 10.1523/JNEUROSCI.1038-11.2011 |
[34] | Qu Q, Sun G, Li W. Orphan nuclear receptor TLX activates Wnt/beta-catenin signalling to stimulate neural stem cell proliferation and self-renewal[J]. Nature Cell Biol, 2010, 12(): 31-40. doi: 10.1038/ncb2001 |
[35] | Qin S, Niu W, Iqbal N. Orphan nuclear receptor TLX regulates astrogenesis by modulating BMP signaling[J]. Front Neurosci, 2014, 8(): 74-. |