HTML
-
Two C. albicans strains resistant to FLU and ITRA (strain Nos. 99 and 108) were selected from 60 clinical C. albicans isolates[32]. The laboratory strains ATCC 22019 and ATCC 6258 were used in susceptibility tests (Clinical and Laboratory Standards Institute, 2008) as controls[33]. Isolates were stored in LB broth with 15% glycerol at -80 ℃. Each strain was inoculated and subcultured on Sabouraud dextrose agar (SDA)[10] at 35 ℃ for 24 h before testing.
-
FLU and ITRA were purchased from Sigma- Aldrich (St Louis, MO, USA), and BDSF was synthesized as described previously[30]. Stock solutions of the following were prepared for subsequent dilution: FLU prepared using sterile water at 5, 120 μg/mL, ITRA prepared using dimethylsulfoxide at 1, 600 μg/mL, and BDSF prepared in equal volumes of sterile water and methanol at 30, 000 μmol/L. All stock solutions were then stored at -20 ℃. Further dilutions of the drugs were prepared by the double-dilution method in liquid medium. Cisplatin and 3-(4, 5-dimethyl thiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT; Sigma-Aldrich) were used to estimate the relative cytotoxicity of BDSF.
-
The minimum inhibitory concentrations (MICs) of FLU, ITRA, and BDSF against C. albicans strain Nos. 99 and 108 were tested following the broth microdilution method in RPMI 1640 medium as specified in Clinical and Laboratory Standards Institute (CLSI, formerly NCCLS) method M27-A3 (Clinical and Laboratory Standards Institute, 2008)[33] and reported by Chen et al.[34]. The final drug concentrations of ITRA and FLU were 0.03-16 μg/mL and 0.12-64 μg/mL, respectively. MICs were defined as 90% inhibition of growth when compared with controls after 24 h of inoculation and determined by spectrophotometry at 530 nm.
-
The antifungal susceptibilities of C. albicans strain Nos. 99 and 108 were also measured by the E-test diffusion method using E-test strips (AB Biodisk, Sweden). Isolates were suspended in 0.85% sterile saline, diluted to an optical density of 0.1 at 530 nm, and then plated with a sterile swab onto RPMI-glucose agar plates containing RPMI 1640 medium, 2% glucose, and 0.165 mol/L 4-morpholinepropanesulfonic acid (MOPS) under pH 7.0 condition. After complete absorption of extra moisture, E-test strips were applied to the surface, then 0.03-16 μg/mL ITRA solutions and 0.12-64 μg/mL FLU solutions from the broth dilution method was added to E-test strips, respectively. After the plates were incubated at 37 ℃ for 24 h, the MICs of the strains were read.
-
C. albicans strain Nos. 99 and 108 were used to investigate the in vitro interaction between BDSF and FLU or ITRA via the microdilution checkerboard method in 96-well plates[21]. Each strain was inoculated in RPMI 1640 buffered with 0.165 mol/L MOPS to pH 7.0 with a starting inoculum density of 105 cfu/mL. Each drug was diluted to the desired final concentration, ensuring the final concentration to be at least 2-fold of the MIC of each strain against the respective drug. Plates were inoculated for 24 h at 35 ℃. Using a spectrophotometer at 530 nm, the MICs of the drug combinations were determined as the lowest concentration showing 90% inhibition compared with the growth control[35]. Each strain was evaluated in triplicate on different days.
To assess the relation between BDSF and FLU or ITRA, the fractional inhibitory concentration index (FICI) was used. The equations for the FICI are as follows:
$$ \text{FICI = FICA + FICB }\!\!~\!\!\text{ } $$ (1) $$ \begin{align} &\text{FICA = MIC of drug A in combination / MIC of } \\ &\text{drugA alone} \\ \end{align} $$ (2) $$ \begin{align} &\text{FICB = MIC of drug B in combination / MIC of } \\ &\text{drug B alone} \\ \end{align} $$ (3) When the FICI values are ≤ 0.5, the drug interactions are classified as synergistic; when the FICI values are ≥ 4, the drug interactions are considered antagonistic. FICI values between 1 and 4 are classified as indifferent[17].
Heat maps were created using Excel 2007 (Microsoft, USA) to illustrate the inhibition percentages of C. albicans growth compared with those of the controls[14].
-
Clinical multi-azole-resistant C. albicans strains (Nos. 99 and 108) were prepared in triplicate for experiments as described previously (RPMI 1640 medium with 0.165 mol/L MOPS to pH 7.0, 1 × 105 cfu/mL starting density). Each inoculum was incubated with antifungal drugs alone (at $ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC), BDSF alone (at $ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC), or the combination of each antifungal drug (at $ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC) with BDSF (at $ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC) at 35 ℃. At 0, 2, 6, 12, 24, 36, or 48 h, an aliquot of 100 μL was extracted from each tube, serially diluted in sterile water, and then streaked and subcultured on SDA plates. The colony number was counted after incubation at 35 ℃ for 24 h to estimate log10 values. Any increase or decrease in 2log10 value after 24 h was defined respectively as synergism or antagonism compared with FLU, ITRA, or BDSF treatment alone. A change in value < 2log10 was defined as indifferent.
-
The multi-azole-resistant C. albicans strains were cultured in YPD broth (1% yeast extract, 2% peptone, 1% dextrose) at 35 ℃. After overnight culture, the cells were obtained and diluted in PBS solution (1 × 106 cfu/mL). A mouse candidiasis model was constructed via lateral tail vein injection of C. albicans (dose: 1 × 105 cells) for 4 h. Subsequently, infected female BALB/c mice were randomly divided into four groups (five mice per group) and individually treated with PBS, FLU [1 mg/(kg·day)], BDSF [10 mg/(kg·day)], or FLU [0.5 mg/(kg·day)] + BDSF [10 mg/(kg·day)] for 4 days. The mice were sacrificed, and their kidneys were harvested aseptically and weighed after the end of treatment. To measure the organ fungal burden, kidneys were homogenized in 5 mL of sterile PBS solution, and the homogenates were 10-fold serially diluted and inoculated on SDA plates at 35 ℃ for 24 h for further colony counting. All animal experiments were performed in accordance with the guidelines of the National Institutes of Health on animal care, and the protocol was approved by the School of Pharmaceutical Science, Nanjing Tech University.
-
Primers for the genes DDR48, ERG1, ERG11, UPC2, CDR1, MDR1, TAC1, and MRR1, as well as those for the housekeeping gene ACT1, are listed in Table 1. The azole-resistant C. albicans isolates were subcultured on SDA at 35 ℃ for 24 h and then inoculated into YPD broth with OD = 0.1 (read at 530 nm). The inocula were diluted in YPD broth and cultured with FLU or ITRA ($ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC), BDSF ($ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC), or their combinations ($ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC of the antifungal drug and $ {}^{1}\!\!\diagup\!\!{}_{2}\;$ MIC of BDSF) at 35 ℃ for 12 h with shaking at 220 rpm. Total RNA was extracted using the EASYspin Yeast RNA Fast Extraction Kit (Qiagen Co.). After treatment with DNase, the total RNA was reversed-transcribed with the RevertAid First Strand cDNA Synthesis Kit (Roche) according to the manufacturer's instruction. SYBR Green-based qRT-PCR was performed with a Stratagene Mx3000p system using the following temperature parameters: 95 ℃ for 10 min, followed by 40 cycles of 95 ℃ for 15 s, 57 ℃ for 25 s, and 72 ℃ for 25 s. ACT1 was used as the internal control gene to normalize the qRT-PCR results and measure changes in expression of the chosen gene. Experiments were performed thrice with different extractions of total RNA samples. Data are presented as fold-changes in mRNA expression level normalized against the housekeeping gene ACT1.
Gene Name PCR Product (bps) Forward Reverse DDR48 108 TTCGGTAAAGACGACGACAAAGA GCCAAATGAAGAGGATCCATAAGA ERG1 70 AGAATGTGTTAACGGGCCAATT ATGGTTGAATAACAACATTGGGAAT ERG11 131 GAATCCCTGAAACCAAT AGCAGCAGTATCCCATC UPC2 71 ATTATGGATTCGTTAGCCAATGC CATGCAGAAGCTGGCAAAGA CDR1 179 GCATTGATGGGAGCATCTGG GTAGTGGTTTCCAAATGAACGTCTT MDR1 280 GGAGTTAAACATTTCACCCTCGTT ATGCACCAGAAGCAGTAGTAGCAG MRR1 230 AACGCTGGTTATGGGTGA TTTGCTGTTGGGCTTCTT TAC1 71 TGGCAATGTATTTAGCAGATGAGG TGCTTGAACTGAGGTGAATTTTG ACT1 152 TTGACCAAACCACTTTCAACTC AGAAGATGGAGCCAAAGCAG Table 1. Primers Used in This Study
-
MTT assay was employed using the normal foreskin fibroblast cell line to estimate the cytotoxicity of BDSF[31]. Cisplatin, a cytotoxic drug, was used as the positive control for these tests. Cells (5 × 103) prepared in 0.2 mL of Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum were seeded onto a 96-well plate and treated with BDSF or cisplatin at 37 ℃ for 72 h. Next, the medium was removed from the wells, and 25 μL of MTT solution (5 mg/mL in PBS) and 75 μL of DMEM were added to each well. The plate was then incubated at 37 ℃ for another 2 h. Following the second incubation, an aliquot of 0.1 mL of MTT lysis buffer was added to each well, and the plate was incubated once more at 37 ℃ for 4 h. Finally, optical densities (A570) were determined on a BioRad plate reader at 570 nm. This experiment was replicated thrice, and the percentage of cell relative viability was estimated as: (A570 of the treated sample) / (A570 of the untreated sample) × 100. Statistical methods were carried out using SPSS (version 17.0; SPSS Inc., USA) and statistical significance was defined as P < 0.05.
Candida Strains and Growth Conditions
Antifungal Preparation
Minimum Inhibitory Concentration (MIC) Determination by Broth Dilution
MIC Determination by E-test
Checkerboard Testing and Heat Map Plotting
Time-kill Curves
In vivo Antifungal Synergy
Quantitative Reverse-transcription Polymerase Chain Reaction (qRT-PCR)
Cytotoxicity Testing
-
The drug susceptibility of two selected clinical strains, Nos. 99 and 108, toward the drugs FLU and ITRA was measured using the broth dilution method and E-test. According to the recommendations of the NCCLS[33], the two strains were cultured with the antifungal agents at 35 ℃ for 24 h. Strain No. 99 showed resistance to FLU (MIC ≥ 64 μg/mL) and ITRA (MIC = 8 μg/mL). Strain No. 108 also showed resistance to FLU (MIC ≥ 64 μg/mL) and ITRA (MIC = 16 μg/mL). To verify these results, we tested these antifungal-resistant strains with E-test strips and confirmed the strong resistance of both strains to FLU and ITRA (Table 2). Because these two strains had a high level of azole resistance to both FLU and ITRA, we chose them as representative strains for further experimental studies.
Drugs aMIC (μg/mL) of Each Strain No. 99 Strain No. 108 Alone* Combination FIC FICI (Outcome) Alone* Combination FIC FICI (Outcome) BDSF ≥ 256 64 ≤ 0.25 ≤ 0.28 ≥ 256 16 ≤ 0.06 ≤ 0.08 FLU ≥ 256 8 ≤ 0.03 (SYN) ≥ 256 4 0.02 (SYN) BDSF ≥ 256 8 ≤ 0.03 ≤ 0.09 ≥ 256 64 ≤ 0.25 ≤ 0.28 ITRA 4 0.25 0.06 (SYN) 8 0.25 0.03 (SYN) Note. Indices were calculated as described in the text. Experiments were carried out thrice. aThe MICs (μg/mL) of BDSF and selected azole drugs were determined using the microdilution checkerboard technique and revealed synergistic activity against azole-resistant C. albicans. *Agreement of E-test MICs with broth dilution MICs. For strain No. 99, the FICIs were ≤ 0.28 for the combination of BDSF and FLU and ≤ 0.09 for the combination BDSF and ITRA. For strain No. 108, the FICIs were ≤ 0.08 for the combination of BDSF and FLU and ≤ 0.28 for the combination BDSF and ITRA. All FICIs ≤ 0.5 show synergy. Table 2. Minimum Inhibitory Concentration (MIC) Indices
-
Table 2 shows the susceptibility of the chosen strains (Nos. 99 and 108) to BDSF in combination with FLU and ITRA using the checkerboard technique. Based on the FICI method, both strains showed synergistic interactions between BDSF and FLU/ITRA. The MICs of FLU, ITRA, and BDSF against strain No. 99 were 256, 4, and ≥ 256 μg/mL, respectively. When BDSF was combined with FLU, the MIC of the former decreased 4-fold to 64 μg/mL, while the MIC of the latter decreased 32-fold to 8 μg/mL. The FICI of this combination was ≤ 0.28. When BDSF was combined with ITRA, the MIC of the former decreased 32-fold to 8 μg/mL, while that of the latter decreased 16-fold to 0.25 μg/mL. The FICI of this combination was ≤ 0.09. As both FICI values obtained are ≤ 0.5, the drug interactions observed are synergistic (Table 2).
For strain No. 108, when BDSF was combined with FLU, the MIC of the former decreased 16-fold from ≥ 256 μg/mL to 16 μg/mL, while that of the latter dropped 64-fold from ≥ 256 μg/mL to 4 μg/mL. When BDSF was combined with ITRA, the MIC of the former decreased 4-fold from ≥ 256 μg/mL to 64 μg/mL, while that of the latter decreased 32-fold from 8 μg/mL to 0.25 μg/mL. These checkerboard results demonstrate that the MICs of the two tested antifungals alone against C. albicans are significantly higher than their MICs when combined with BDSF. The FICIs of the combination of FLU and ITRA with BDSF were ≤ 0.08 and ≤ 0.28, respectively, indicating synergistic interactions (≤ 0.5) (Table 2). The heat map in Figure 1 shows the synergistic interactions of BDSF in combination with FLU or ITRA. In addition, BDSF in combination with the azoles decreased the amounts of these drugs required to inhibit C. albicans (Table 2).
-
Time-kill studies were performed using BDSF and FLU/ITRA against strain Nos. 99 and 108 (Figure 2). BDSF alone at 256 μg/mL minimally affected yeast cell growth after 48 h; however, growth was significantly reduced in the multi-azole-resistant strains when BDSF in combination with antifungal azoles was added. The combination of FLU and BDSF showed potent fungicidal activity, resulting in a 4.4-log cfu/mL decrease in growth levels of strain No. 99 and a 6.4-log cfu/mL decrease in growth of strain Nos. 108 compared with that induced by 256 μg/mL FLU alone after incubation for 48 h. The combination of ITRA and BDSF yielded 3.4- and 6.9-log cfu/mL decreases in the strain Nos. 99 and 108, respectively. Thus, the proposed BDSF–azole synergy is consistent with the data obtained from the checkerboard technique (Figure 2).
-
In vitro experimental results confirmed the synergistic effects between BDSF and FLU against multi-azole-resistant C. albicans, further indicating that the combination can be used for clinical application. The effect of this combination on candidiasis in BALB/c mice was estimated by infecting individual mice with strain Nos. 99 and 108, treating them with PBS, FLU, BDSF, or FLU + BDSF, and assessing their kidney fungal burden. Figure 3 shows that the combination of FLU [0.5 mg/(kg·day)] + BDSF [10 mg/(kg·day)] could effectively eliminate the fungal burden in the kidney when compared with FLU [1 mg/(kg·day)] or BDSF [10 mg/(kg·day)] alone. This result indicates that the synergistic effects of BDSF and azole can strongly reduce the dosage of azole required to treat candidiasis in mice.
-
To investigate the synergistic mechanism of FLU/ITRA and BDSF against multi-azole-resistant C. albicans, qRT-PCR was conducted (Figure 4). The mRNA expression of ERG1, ERG11, UPC2, CDR1, MDR1, TAC1, and MRR1 in BDSF-only treated strains consistently showed a decrease in expression compared with that of the standard ACT1; by comparison, the mRNA expression of DDR48 was upregulated or invariable when compared with that of the standard ACT1. The mRNA levels of DDR48, ERG1, ERG11, UPC2, CDR1, MDR1, TAC1, and MRR1 in multi-azole-resistant strains were upregulated by 1.5–5.1-fold in strains treated with FLU (Figure 4A, 4C) or ITRA (Figure 4B, 4D) alone. In strain No. 99, the combination of BDSF and FLU inhibited the expression of CDR1 and MDR1 by 10-fold, respectively, when compared with FLU alone (Figure 4A), while the combination of BDSF with ITRA inhibited the expression of CDR1 and MDR1 by 8- and 11-fold, respectively, when compared with ITRA alone (Figure 4B). In strain No. 108, the combination of BDSF with FLU inhibited the expression of CDR1 and MDR1 by 7.5- and 5-fold, respectively, compared with FLU alone (Figure 4C). The combination of BDSF with ITRA inhibited the expression of CDR1 and MDR1 by 6.3- and 4-fold, respectively, compared with ITRA alone (Figure 4D).
Figure 4. mRNA expression levels of DDR48, ERG1, ERG11, UPC2, CDR1, MDR1, TAC1, and MRR1 determined by qRT-PCR experiments after C. albicans (strain Nos. 99 and 108) were treated with BDSF alone, FLU or ITRA alone, or BDSF + azole.
The expressions of CDR1 and MDR1 in the combination group decreased obviously when compared with those in the BDSF-alone group. By contrast, the mRNA expression of DDR48, ERG1, ERG11, and UPC2 in the combination group, except for DDR48 in the group in which strain No. 99 was with FLU + BDSF, was upregulated or invariable when compared with that in the BDSF-alone group (Figure 4). These results indicate that the combination of BDSF with azole does not affect the ergosterol synthesis pathway and the expression of DDR48. Previous studies indicate that the expressions of CDR1 and MDR1 are modulated by the transcription factors TAC1 and MRR1, respectively[8]. As shown in Figure 4, the expressions of TAC1 and MRR1 were 1.9-2.8 fold upregulated, as expected, in azole-resistant strains under the condition of drug induction. Interestingly, addition of BDSF (256 μg/mL) to samples with FLU (32 μg/mL) or ITRA (4 μg/mL) downregulated the mRNA expression levels of the TAC1 and MRR1 genes. Based on the above results, the combination of BDSF and FLU or ITRA strongly represses CDR1 and MDR1 gene expression via suppression of the expression levels of TAC1 and MRR1, respectively, in the multi-azole-resistant strains when compared with FLU/ITRA treatment alone.
-
BDSF could potentially be used against infection for its ability to inhibit some virulence factors in C. albicans[31, 36]. The cytotoxicity of BDSF was estimated against a normal human fibroblast (foreskin) cell line by MTT assay. The cell line showed no significant cytotoxicity at BDSF testing levels of up to 300 μg/mL (Figure 5). By comparison, cisplatin was more toxic to fibroblast cells, resulting in only 40% viability at 300 μg/mL (Figure 5). This result indicates that BDSF may be safe for human use at low doses.