About BES
Aims & Scope
SCI and IF
Editor in Chief
Editorial Board
Editorial Office
Articles
Advance Publication
Current Issues
Archive
Authors and Reviewer
Notice of Charge
Instruction for authors
Online Submission
Submission:FAQ
Revise:FAQ
Author Login
Reviewer Login
Editor-in-chief Login
Office Login
Subscribe
How to Subscribe
Links
NHFPC
China CDC
China doi
doi
PubMed
Elsevier
WANFANG data
CNKI
VIP data
Full-Text PDF: 517-525.pdf
TNF-α and IL-1RA Polymorphisms and Silicosis Susceptibility in Chinese Workers Exposed to Silica Particles: A Case-Control Study
 

Original Article

TNF-α and IL-1RA Polymorphisms and Silicosis Susceptibility in Chinese Workers Exposed to Silica Particles: A Case-Control Study

WANG Yong Wei1,2, LAN Ya Jia1,2,#, YANG Yue Lin1,2, WANG De Jun3, and KUANG Jie1

1. West China School of Public Health Sichuan University, Chendu 610041, Sichuan,China; 2. West China Fourth Hospital Sichuan UniversityOccupational Diseases Hospital, Chendu 610041, Sichuan, China; 3. Shandong Provincial Center for Disease Control and Prevention, Jinan 250014, Shandong, China

Abstract

Objective  To assess the association of TNF-a and IL-1RA SNPs with the risk of silicosis in Chinese workers exposed to silica particles.

Methods  Case-control study design was used to enroll 68 silicotic patients induced by silica particles and 68 healthy workers matched for length of silica particle exposure as controls. Both cases and controls were from the same company in southwest China, and each of them was requested to complete a questionnaire. Blood samples were drawn for genomic DNA extraction from each participant. The genotyping of TNF-a (-238 and -308) and IL-1RA (+2018) was performed using polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) and SYBR green-based quantitative polymerase chain reaction (qPCR), respectively. Unconditional logistic regression model was used to estimate odds ratios (ORs) and their 95% confidential intervals (CI) for SNPs.

Results  No significant differences were found between cases and controls in particles exposure length, body mass index (BMI), and status of smoking and alcohol consumption except for age (P=0.001) and blood type (P=0.042). The frequencies of TNF-a (-238) and IL-1RA (+2018) genotypes in cases were significantly different from those in controls, (P=0.001 and P=0.002, respectively), while a borderline significant difference was found in the frequencies of TNF-a (-308) between cases and controls (P=0.063). The variants of three SNPs increased the risk of silicosis in the Chinese workers exposed to silica particles. The adjusted ORs of TNF-a (-308), TNF-a (-238) and IL-1RA (+2018) were 2.8 (95% CI: 1.1-7.5), 20.9 (95% CI: 1.8-236.4) and 4.0 (95% CI: 1.6-10.1), respectively.

Conclusion  It is suggested that cytokine polymorphisms of TNF-a (-238, -308) and IL-1RA (+2018) are associated with the risk of silicosis in the Chinese workers exposed to silica particles. Further independent studies on the interaction between SNPs and exposure to silica particles with a larger sample size are therefore warranted.

Key words: TNF-a, IL-1RA; Polymorphism; Silicosis; Case-control study

Biomed Environ Sci, 2012; 25(5):517-525    doi: 10.3967/0895-3988.2012.05.004     ISSN:0895-3988

www.besjournal.com(full text)            CN: 11-2816/Q          Copyright ?2012 by China CDC

 


 

 

INTRODUCTION

S

ilicosis is pneumoconiosis of lung fibrosis caused by inhalation of silica particles usually at low levels but for long periods; and it is a common occupational disease among the workers who are exposed to silica particles. The underlying mechanisms of silicosis are still unclear. However, one principal hypothesis is that the inhalation of silica particles in lung are engulfed by macrophages, thereby activating inflammatory networks and leading to the release of inflammatory cytokines into the alveolar space. The consequence of these chronic inflammatory stimuli is the occurrence of silicosis[1]. As two of the major cells in immunity response, the differentiation of B and T cells are regulated by inflammatory cytokines such as tumor necrosis factor (TNF) cytokine and interleukin-1 (IL-1)[2]. TNF-a  and IL-1 have been shown to play important roles in the pathogenesis of silica particle-induced pulmonary inflammatory reactions and chronic inflammatory disease[3-5]. IL-1 receptor antagonist (IL-1RA), a naturally occurring anti-inflammatory protein that belongs to a member of the IL-1 family with a structure similar to IL-1, competitively inhibits the binding of IL-1 to IL-1 receptor, and is also involved in human inflammatory diseases[6].

Since silicosis is irreversible and incurable other than elimination and control of silica particles it is of practical significancefor the prevention of silicosis and for the reduction of related deaths and cost, to identify workers at high risk.. Occupational exposure to silica particles is a known risk factor. However, owing to the fact that not all the individuals who have a similar exposure history develop lung fibrosis[7-8] genetic factors may also contribute to the risk of the disease. Several studies have demonstrated that TNF-a  and IL-1RA gene polymorphisms are related to the occurrence and development of silicosis in Caucasian and African coal miners[7,9,11-14]. Both TNF-a (-308) variant and IL-1RA (+2018) raise the risk of silicosis[12,15]. However, there are few studies investigating the associations of polymorphisms in TNF-a and IL-1RA genes with silicosis in Chinese workers who are exposed to silica particles. Additionally, although in the promoter of TNF-a, four specific point mutations of G to A are identified at the -163, -238, -308, and -376 sites, respectively[16-18], which may affect TNF-a expression[11-12], the SNPs at -238 and -308 are two points examined and are associated with the risk of silicosis in most of the studies. Thus, we hypothesize that polymorphisms in the TNF-a (-308, -238) promoter region and IL-1RA (+2018) are associated with individual susceptibility to silicosis. The purpose of this study was to determine the associations of TNF-a and IL-1RA SNPs with the risk of silicosis in Chinese workers exposed to silica particles.

METHODS

Participants

This study was approved by the Ethical Committee of the West China School of Public Health, Sichuan University. In this study, 68 silicosis cases and 68 healthy controls who were matched for the length of exposure to silica particles were recruited after excluding those who had different dust exposure status or immune system diseases. All cases and controls were steel workers from the same plant of a steel-making company located in Southwest China. Each pair of them had the matched conditions including length of exposure to silica particles (±1 year), age (±5 old years) and similar proportions of education, smoking and alcohol consumption history. Since few women were among silica particle-exposed workers in the plant to match gender, we only included men workers in the study. All cases were diagnosed using the chest radiographs, which were reviewed by independent radiologists and occupational disease committee, based on the International Labor Organization Classification[19]. All controls had no history or symptoms of disease including pulmonary disease. All the participants were provided informed consent forms and completed a detailed questionnaire (covering demographic characteristics, and occupational history) which included age, length of exposure to silica particles, education, current smoking status and alcohol consumption. The physical examinations were performed by the West China Occupational Diseases Hospital and the Public Health Constitute of Sichuan University.

TNF-α and IL-1RA Genotyping

Genomic DNA was extracted using phenol/chloroform conventional method from blood samples collected from each study subject. The quality and quantity of genomic DNA samples were determined using spectrophotometer.

To determine TNF-a and IL-1RA genotypes, poly- merase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) assays were performed. The primer sequences for TNF-a polymorphisms are TNF-a (-308) sense 5’-GAGGCAATAGGTTTTGAGGGCCAT, TNF-a (-308) antisense 5’-CATCAAGGATACCCCTCACACT, TNF-a (-238) sense 5’-CCCCAAAAGAAATGGAGGCAAT, and TNF-a (-238) antisense 5’-CACTCCCCATCCTCCCG GATC (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd, China). Hot-start PCR reactions were carried out on a thermal cycler of PE9600 PCR (America Perkin Elmer Companies, USA) in a 20 μL reaction volume, which contained 5 μ Taq polymerase (MBI Fermentas, Vilnius, Lithuania), 10 mmol of each dNTP (MBI Fermentas), 10×PCR Buffer, 25 mmol MgCl2 (MBI Fermentas), the paired primers for either TNF-a (-308) or TNF-a (-238), and 5.0 μL genomic DNA. The PCR reaction conditions for TNF-a (-308) consisted of initial denaturing at 94 °C for 2 min, followed by adding the Taq enzyme and 35 cycles of denaturing at 94 °C for 10 s, annealing at 50 °C for 30 s and extensions at 72 °C for 40 s, with a final extension at 72 °C for 5 min. For TNF-a (-238), the PCR reaction conditions were the same as for TNF-a (-308) except annealing temperature at 47 °C for 30 s. PCR products were digested with either NcoI for TNF-a (-308) or BamHI for TNF-a (-238) at 37 °C for 5 h, and 3% agarose gel electrophoresis (Tito Enterprise CO., Ltd, USA) was run to check the status of the digested fragments. For TNF-a (–308), homozygous G/G had one band sizing 114 bp of restriction digested fragment of PCR products on gel, heterozygous G/A had two bands sizing 114 bp and 135 bp, respectively, and homozygous A/A had one band sizing 135bp; for TNF-a (-238), homozygous G/G had one band sizing 114 bp, heterozygous G/A had two bands sizing 114 bp and 131 bp, respectively, and homozygous A/A had one band sizing 131 bp.

SYBR green-based quantitative PCR (qPCR) was performed on FTC2000 system (FungLyn Biotech Co., Ltd, Shanghai city, China) to determine the IL-1RA(+2018) genotypes. The sequences for the primers are a pair of outer primers, IL1RAEF: 5’-GAGGAACAACCAACTAGTAG and IL1RAER: 5’-AAAGTGACGTGATGCCTA, and 3 inter primers, IL1RAT: 5’-CTGAGGAACAACCAACTAGTTGCT, IL1RAC: 5’-CTGAGGAACAACCAACTAGTTGCC’ and IL1RAIR:5’- CGTGATGCCTACATACATTGACT (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd). Pre-amplification of genomic DNA was performed with outer primers in a 20 μL reaction volume and under the PCR reaction conditions of initial denaturing at 94 °C for 2 min, followed by 15 cycles of denaturing at 94 °C for 10 s, annealing at 50 °C for 30 s, and extension at 72 °C for 40 s. Then qPCR was performed in a 50 μL reaction volume, which contained 5 μ Taq polymerase (BioDev Company, China), 10 mmol dNTP (Promega Corporation), 10×PCR Buffer, 25 mmol MgCl2 (TakaRa Company, Japan), 1 μL SYBR green I(Roche Company, Germany ), either IL1RAT and IL1RAIR or IL1RAC and ILRAIR, and pre-amplified genomic DNA. qPCR reaction conditions consisted of initial denaturing at 94 °C for 3 min, followed by 35 cycles of denaturing at 94 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 1 min.

Genotypes of TNF-a (-308) and TNF-a (-238) and IL-1RA (+2018) for selected samples were confirmed by sequencing method on ABI PRISMTM 377 DNA SEQUENCER (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd, China). Figure 1-3 showed the representative sequencing results of ABI sequencer for the selected samples from each genotype of the SNPs. The genotyping results of both PCR-RFLP and qPCR were consistent with direct sequencing.

Statistical Analysis

Continuous variables were expressed as the mean±standard deviation (SD) and the differences were tested by generalized linear model (GLM) or wilcoxon rank sum test if appropriate. Chi-square test was used to analyze Hardy-Weinberg Equilibrium (HWE) for genotype distribution in controls and other categorical variables. Both univariate and multivariate unconditional logistic regression were conducted to estimate odds ratios (ORs) and their 95% confidence intervals (95% CI) for each polymorphism and to adjust potential confounding factors such as  age, body mass index (BMI), smoking status and alcohol consumption, length of exposure to silica particles education, and blood type. All P values ≤0.05 were considered as statistical significance. Statistical analyses were performed using the SPSS 16.0 statistical software package.

RESULTS

Demographic Characteristics of Participants

The demographic characteristics of all partici- pants enrolled in this study are shown in Table     1. The average age of the 136 subjects was 43.1 years

 

 


Adobe Systems

Figure 1. The representative sequences of TNF-a (-308) genotypes. G/G, (B) G/A, (C) A/A.

 

Adobe Systems

Figure 2. The representative sequences of TNF-a (-238) genotypes. (A) G/A, (B) G/G.

 

Adobe Systems

Figure 3. The representative sequences of IL-1RA (+2018) genotype. (A) C/C, (B) T/C, (C) T/T.

 


with the variation of 8.6 years. There were no significant differences in the length of exposure to silica particles, BMI, alcohol consumption, and current smoking status between cases and controls. But there was a highly significant difference in age. The distributions of blood type showed statistically significant differences between cases and controls (P=0.042).

Association of TNF-a (-308), TNF-a (-238), and IL-1RA (+2018) Genotypes with Silicosis

The distributions of TNF-a (-308), TNF-a (-238), and IL-1RA (+2018) genotypes were shown in Table 2. For TNF-a (-308) genotypes in all participants, homozygous G/G accounted for 69.12%, hetero- zygous G/A were 27.94% and homozygous A/A were 2.94%. For TNF-a (-238) genotypes, G/G accounted for 89.71%, G/A were 9.56%, and A/A were 0.73%. For IL-1RA (+2018) genotypes, homozygous T/T accounted for 63.97%, T/C were 32.35% and homozygous C/C were 3.68%.

The distributions of TNF-a (-308), TNF-a (-238), and IL-1RA (+2018) genotypes in controls had no deviation from Hardy-Weinberg equilibrium, and P values were 0.996, 0.380, and 0.944, respectively (data not shown). In additive model, we found different distributions of three SNPs between cases and controls; more cases carried mutants than controls. For


Table 1. Demographic Characteristics of the Participants

Variables

Total

(n=136)

Groups [mean±SD/n(%)]

P-value

Case (n=68)

Control (n=68)

Age(years)

43.1± 8.6

45.5±8.5

40.6±8.1

0.001

Silica particle exposure length (years)

19.3 ± 7.5

19.6±6.6

18.9±8.3

0.600

BMI (kg/m2)

22.2 ± 3.3

22.3±3.4

22.1±3.1

0.804

Education

 

 

 

 

Illiteracy

4

3 (4.4)

1 (1.5 )

0.843

Elementary School

49

24 (35.3 )

25 (36.8 )

Middle School

71

35 (51.5)

36 ( 52.9)

High School

10

6 (8.8 )

4 ( 5.9)

College and Above

2

1 (1.5 )

1 (1.5)

Blood Type

 

 

 

 

A

48

28 (41.2)

20 (29.4)

0.042

B

37

12 (17.6)

25 (36.8)

AB

35

17 (25)

18 (26.5)

O

16

11 (16.2)

5 (7.4)

Current Smoking

 

 

 

 

Yes

94

47 (69.1)

47(69.1)

1.000

No

42

21 (30.9)

21(30.9)

Alcohol Consumption

 

 

 

 

Yes

89

41 (60.3)

48(70.6)

0.207

No

47

27 (39.7)

20(29.4)

Note. BMI was calculated as weight (kg)/height(m2).

Table 2. Genotype of TNF-a (-308), TNF-a (-238) and IL-1RA (+2018) in Cases and Controls

Genotype

n (%)

n (%)

P-value

Case (n=68)

Control (n=68)

TNF-a(-308)

 

 

 

 

G/G

94 (69.12)

42 (61.8)

52 (76.5)

0.063

G/A

38 (27.94)

23 (33.8)

15 (22.1)

A/A

4 (2.94)

3 (4.4)

1 (1.5)

G/A or A/A

42 (30.88)

26 (38.2)

16 (23.5)

0.052

TNF-a (-238)

 

 

 

 

G/G

122 (89.71)

55 (80.9)

67 (98.5)

0.001

G/A

13 (9.56)

12 (17.6)

1 (1.5)

A/A

1 (0.73)

1 (1.5)

0 (0.0)

G/A or A/A

14 (10.29)

13 (19.1)

1 (1.5)

<0.001

IL-1RA (+2018)

 

 

 

 

T/T

87 (63.97)

35 (51.5)

52 (76.5)

0.002

T/C

44 (32.35)

29 (42.6)

15 (22.1)

C/C

5 (3.68)

4 (5.9)

1 (1.5)

T/C or C/C

49 (36.03)

33 (48.5)

16 (23.5)

0.002


 


TNF-a (-308), 61.8%, 33.8%, and 4.4 % of cases were found to carry G/G, G/A, and A/A genotype, respectively, while in controls, the percentage of the genotypes were 76.5%, 22.1%, and 1.5%, respectively. For TNF-a (-238), 80.9%, 17.6%, and 1.5% of cases carried G/G, G/A, and A/A genotype, respectively, while in controls the percentage of the genotypes were 98.5%, 1.5%, and 0, respectively. For IL-1RA (+2018), 51.5%, 42.6%, and 5.9% of cases had T/T, T/C, and C/C genotype, respectively, while in controls the percentage of the genotypes were 76.5%, 22.1%, and 1.5%, respectively. P values for the differences in the distribution of TNF-a (-308), TNF-a (-238) and IL-1RA(+2018) between cases and controls were 0.063, 0.001, and 0.002, respectively. Similar results were obtained in dominant model, in which heterozygous and homozygous mutants were combined. The associations of TNF-a (-238) and IL-1RA(+2018) genotypes with the disease were statistically significant, and their P values were <0.001 and 0.002, respectively, whereas the association of TNF-a (-308) genotype with the disease was borderline significant (P=0.052).

To further examine the associations of the SNPs

with the disease, we performed unconditional logistical regression models. Due to the small sample size and small frequencies of variants in both case and control groups, we combined the heterozygous and homozygous mutants into a group in comparison to homozygous wild type (aka dominant model) (Table 3). Univariate analyses showed that the mutants of TNF-a (-238) and IL-1RA (+2018) significantly increased the risk on silicosis; the ORs for both SNPs were 15.8 (95% CI: 2.0-124.9) and 3.1 (95% CI: 1.5-6.4), respectively. However, a borderline significant increase was observed in the risk of the disease for TNF-a (-308); the OR was 2.0 (95% CI: 1.0-4.2). To adjust the potential confounding factors, we also performed multivariate unconditional logistic regression model with the adjustment for age, BMI, smoking, alcohol consumption, length of silica particle exposure, blood type, and education background, and found that the associations of three SNPs with the disease were statistically significant. The adjusted ORs for TNF-a (-308), TNF-a (-238) and IL-1RA (+2018) were 2.8 (95% CI: 1.1-7.5), 20.9  (95% CI: 1.8-236.4), and 4.0 (95% CI: 1.6-10.1), respectively.


Table 3. Associations of TNF-a (-308), TNF-a (-238), and IL-1RA (+2018) Genotypes with Silicosis

Variables

Univariate Analysis

 

Multivariate Analysis

OR

95% CI

P value

 

Adj-OR

95% CI

P value

TNF-a(-308)

 

 

 

 

 

 

 

G/G

1

 

 

 

1

 

 

G/A or A/A

2

1.04.2

0.065

 

2.8

1.17.5

0.038

TNF-a(-238)

 

 

 

 

 

 

 

G/G

1

 

 

 

1

 

 

G/A or A/A

15.8

2.0124.9

0.009

 

20.9

1.8236.4

0.014

IL-1RA(+2018)

 

 

 

 

 

 

 

T/T

1

 

 

 

1

 

 

T/C or C/C

3.1

1.56.4

0.003

 

4

1.610.1

0.004

 


DISCUSSION

In this case-control study we genotyped three SNPs in inflammatory cytokine genes of TNF-a and IL-1RA, and demonstrated the associations of these SNPs with the risk of silicosis in Chinese workers who were exposed to silica particles. We found that TNF-a (-238) and IL-1RA(+2018) were significantly associated with the increased risk of silicosis; approximately 14- and 2-fold elevated risks were observed, respectively. A borderline significantly increased risk was found for TNF-a (-308) mutants. However, the associations remained or turned statistically significant after the adjustment for the potential confounding factors including age, BMI, the status of smoking and alcohol drinking, length of silica particle exposure  blood type and education background. Findings suggest that the Chinese workers exposed to silica particles who carry mutants of either TNF-a or IL-1RA, particularly TNF-a (-238) mutants, will have approximately 14- or 2-fold increased risk of silicosis in comparison to those with the wild type. Our study further supports the notion that the mutants of TNF-a  and IL-1RA can increase the risk of silicosis in the workers exposed to silica particles as well. If our results can be validated in independent studies with a larger sample size, it will be helpful to screen genotypes in recruiting the study subjects for identifying who might be at a risk to silicosis if they are exposed to silica particles.

TNF-a and IL-1 are two inflammatory cytokines that play important roles in the pathogenesis of pulmonary inflammatory diseases[20-23]. Animal models have shown that TNF-a and IL-1 are associated with silica-induced lung damage[24-26]. Population-based studies showed that patients with pneumoconiosis among coal workers had significantly increased TNF-a and IL-1[1,4,7,10]. Previous studies have shown that the human IL-1 gene cluster polymorphisms have been associated with several chronic inflammatory diseases[5-6,12,25]. Through competitively blocking the binding of IL-1 to IL-1 receptor, IL-1RA is involved in inflammatory response. Thus, the balance between IL-1 and IL-1RA plays an important role in the regulation of inflammatory processes[27]. Increased IL-1RA has been shown to protect cytokine-induced lung damage[28]. It also has been reported to be associated with systemic lupus erythematosus, ulcerative colitis, lichen sclerosis and alopecia areata[29-30], as well as fibrosing alveolitis and silicosis in coal miners[12,31]. The variant (T/C) of IL-1RA (+2018) is a synonymous SNP located in exon 2 of the IL-1RA gene. It has been reported that the genotype CC has significantly higher IL-1RA expression with the stimulation of LPS or endotoxin-stripped particles[41]. However, the results from another study showed that the variant might not have direct effect on the mRNA expression, but indirectly effect through its linkage with a variable-number tandem repeat (VNTR) in intron 2 of the IL-1RA gene[42]. Tarlow and his colleagues[43] demonstrated that there were three putative protein binding sites (an IFN-a silencer, an IFN-b silencer and an acute-phase response element) in the region surrounding the VNTR of IL-1RA. The presence of the variant may interfere with the binding of transcription factors to these regulatory elements, or influence the stability of RNA. Yucesoy and his colleagues[11-12] demonstrated that IL-1RA(+2018) raised the risk of silicosis in coal miners. In agreement with these reports, we found that IL-1RA(+2018) polymorphism was associated with silicosis in Chinese workers; more cases carried the IL-RA variant than controls (allele frequency was 27.21% in cases vs 12.50% in controls).

At the positions of both -238 and -308 in the promoter region of TNF-a  gene, a G/A substitution occurs. D’Alfonso and Richiardi[17] showed that the allele A at -238 and -308 of TNF-a was associated with TNF-a expression. The allele A at -308 of TNF-a was found to increase the mRNA levels of TNF-a  by affecting the binding of a transcription factor[32]. Elevated TNF-a  can induce the proliferation and differentiation of fibroblast and transcription of collagen[38]. Animal models showed that anti-TNF-a could significantly ameliorate the development of silica-induced pulmonary fibrosis[39-40]. In our study, we found that more cases carried the variants of TNF-a than controls; for TNF-a (-308), the variant allele frequency was 21.32% in cases while 12.50% in controls; For TNF-a (-238), the variant allele frequency was 19.0% in cases while 2.4% in controls. Our finding suggest that TNF-a polymorphisms, particularly at -238, predisposed individuals to silicosis in Chinese workers is consistent with the previous reports in Caucasian. Yucesoy and his colleagues[12] reported that TNF-a (-308) and TNF-a (-238) all increased the risk of silicosis in coal miners. Whyte and his colleagues[33] also showed that the SNPs in TNF-a were associated with the increased risks of fibrosing alveolitis in Italians. The South African miners, who carried TNF-a SNPs, were found to be at a risk to silicosis[9]. Other studies demonstrated that TNF-a and IL-1RA gene polymorphisms were associated with the occurrence and development of silicosis in Caucasian and African coal miners[7,9,11-14]. Interestingly, a borderline significant association of TNF-a (-308) with the disease was found in our study, however, it turned statistically significant after adjustment for the potential confounding factors. This may be caused by the difference in physiological function between cases and controls which may lead to underscoring the effect of TNF-a (-308), given that young people usually have much stronger immunity response than the older. Additionally, other studies have shown that TNF-a (-308) is clearly linked to the risk of silicosis[1,7,32]. One possibility for this discrepancy is most likely due to ethnicity difference between ours and others. We also can not rule out the potential effect of sample size.

Although TNF release was shown to be stable over time[34-36], the phenotype may change after an absence of the stimulating effect of dust exposure. The underlying mechanisms are still unknown. Recently, Suzanne et al.[37] have shown that TNF-a might not directly induce but indirectly induced by silica’s action on macrophage; the increase of TNF-a after silica exposure is likely a consequence of the release of IL-1b production induced by silica. This suggests that IL-1 and TNF-a may interplay in the development of silicosis. However, since the relatively small sample size, we could not examine the interaction between IL-1RA and TNF-a polymorphisms to the susceptibility of silicosis. Additionally, due to the lack of the detailed information on exposure dose of silica particles, we were unable to evaluate the interaction between gene and the exposure dose. 

CONCLUSION

In this study, we have confirmed that TNF-a (-238) and IL-1RA (+2018) variants significantly increase the risk of silicosis in silica-exposed Chinese workers , and that the increased risk associated with TNF-a (-308) is borderline significant. After adjustment for the potential confounding factors, all the three tested SNPs are statistically significantly associated with the risk of silicosis, suggesting that among silica-exposed Chinese workers, those carrying the variants have higher risk of silicosis than those carrying the wild type. These findings may be useful in making strategies to prevent workers occupationally exposed to silica particle from developing silicosis. If our observations can be validated in independent studies with a larger sample size, screening genetic backgrounds, although it is controversial in ethics concerns, may be useful in protecting human health in the future.

ACKNOWLEDEGEMENTS

We cordially thank the Panzhihua Iron and Steel Group Corporation for their support.

REFERENCES

1. Kim KA, Lim Y, Kim JH, et al. Potential biomarker of coal workers’ pneumoconiosis. Toxicol Lett, 1999; 108, 297-302.

2. Kaech, SM, Wherry EJ, Ahmed R. Effector and memory T-cell differentiation: implications for vaccine development. Nat. Rev. Immunol, 2002; 2, 251-62.

3. Borm PJ, Palmen N, Engelen JJ, et al. Spontaneous and stimulated release of tumor necrosis factor-a (TNF) from blood monocytes of miners with coal workers’ pneumoconiosis. Am Rev Respir Dis, 1988; 138, 1589-94.

4. Lassalle P, Gosset P, Aerts C, et al. Abnormal secretion of interleukin-1and tumor necrosis factor-α by alveolar macrophages in coal workers’ pneumoconiosis: Comparison between simple pneumoconiosis and progressive massive fibrosis. Exp Lung Res, 1990; 16, 73-80.

5. Roux-Lombard P. The interleukin-1 family. Eur Cytokine Netw, 1998; 9, 565-76.

6. Arend WP. The role of interleukin-1 receptor antagonist in the prevention and treatment of disease. Mod Rheumatol, 2003; 13, 1-6.

7. Wang XT, Ohtsuka Y, Kimura K, et al. Antithetical effect of tumor necrosis factor-a  gene polymorphism on coal workers’ pneumoconiosis (CWP). Am J Ind Med 2005; 48, 24-9.

8. Kim KA, Cho YY, Cho JS, et al.Tumor necrosis factor-alpha gene promoter polymorphism in coal workers' pneumoconiosis. Mol Cell Biochem, 2002; 234-235(1-2), 205-9.

9. Corbett EL, Mozzato-Chamay N, Butterworth AE, et al. Polymorphisms in the tumor necrosis factor-alpha gene promoter may predispose to severe silicosis in black South African miners. Am J Respir Crit Care Med, 2002; 165, 690-3.

10.Schins, RPF and Borm PJA. Plasma levels of soluble tumor necrosis factor receptor are increased in coal miners with pneumoconiosis. Eur. Resp. J, 1995; 8, 1658-63.

11.Yucesoy B, Vallyathan V, Landsittel DP, et al. Association of TNF-a and IL-1 gene polymorphisms with silicosis. Toxicol Appl Pharmacol, 2001; 172, 75-82.

12.Yucesoy B, Vallyathan V, Landsittel DP, et al. Polymorphisms of the IL-1 gene complex in coal miners with silicosis. Am J Ind Med, 2001; 39, 286-91.

13.Yucesoy B, Johnson VJ, Kissling GE, et al. Genetic susceptibility to progressive massive fibrosis in coal miners. Eur Respir J, 2008; 31, 1177-82.

14.Ates I, Yucesoy B, Yucel A, et al. Possible effect of gene polymorphism on the release of TNF-a and IL1 cytokines in coal workers' pneumoconiosis. Exp. Toxicol. Pathol, 2011; 63, 175-9.

15.Gossart S, Cambon C, Orfila C, et al. Reactive oxygen intermediates as regulators of TNF-a production in rat lung inflammation induced by silica. J Immunol, 1996; 156, 1540-8.

16.Wilson AG, de Vries N, Pociot F, et al. An allelic polymorphism within the human tumor necrosis factor alpha promoter region is strongly associated with HLA A1, B8, and D3 alleles. J Exp Med, 1993; 177, 557-60.

17.D’Alfonso S, Richiardi PM. A polymorphic variation in a putative regulation box of the TNF-a promoter region. Immunogenetics, 1994; 3, 150-4.

18.Hamann A, Mantzoros C, Vidal-Puig A, et al. Genetic variability in the TNF-a promoter is not associated with type II diabetes mellitus (NIDDM). Biochem. Biophys. Res. Commun, 1995; 211, 833-9.

19.International labour office. GENEVA. Guidelines for the Use of the Ilo International Classification of Radiographs of Pneumoconioses. Occupational safety and health series, Rev. 2000; No.22.

20.Yucesoy B, Vallyathan V, Landsittel DP, et al. Cytokine polymorphisms in silicosis and other pneumoconioses. Mol Cell Biochem, 2002; 234-235, 219-24.

21.Yucesoy B, Luster MI. Genetic susceptibility in pneumoconiosis. Toxicol Lett, 2007; 168, 249-54.

22.Honda K, Kimura A, Dong RP, et al. Immunogenetic analysis of silicosis in Japan. Am J respire Cell Mol Biol, 1993; 8, 106-11.

23.Vanhee D, Gosset P, Boitelle A, et al. Cytokines and cytokine network in silicosis and coal workers' pneumoconiosis. Eur Respir J, 1995; 8, 834-42.

24.Driscoll KE, Lindenschmidt RC, Maurer JK, et al. Pulmonary response to silica or titanium dioxide: inflammatory cells, alveolar macrophage-derived cytokines, and histopathology. Am J Respir Cell Mol Biol, 1990; 2, 381-90.

25.Davis GS, Pfeiffer LM, Hemenway D. Persistent over expression of interleukin-1 beta and tumor necrosis factor-alpha in murine silicosis. J Environ Pathol Toxicol Oncol, 1998; 17, 99-114.

26.Orfila C, Lepert JC, Gossart S, et al.Immunocytochemica1 characterization of lung macrophage surface phenotypes and expression of cytokines in acute experimental silicosis in mice. Histochem J, 1998; 30, 857-67.

27.Fan XY, Yan ZF, Yan JD, et al. Relationship between polymorphism of interleukin-1 and pneumoconiosis susceptibility. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi 2006; 24, 526-30. (In Cinese)

28.Josyula, AB, Kurzius-Spencer M, Littau SR, et al. Cytokine genotype and phenotype effects on lung function decline in firefighters. J Occup Environ Med , 2007;49, 282-8.

29.Blakemore AIF, Tarlow JK, Cork MJ, et al. Interleukin-1 receptor antagonist gene polymorphism as a disease severity factor in systemic lupus erythematosus. Arth Rheum, 1994; 37, 1380-5.

30.Mansfield JC, Holden H, Tarlow JK, et al. Novel genetic association between ulcerative colitis and the anti-inflammmatory cytokine interleukin-1 receptor antagonist.Gastroenterology, 1994; 106, 637-42.

31.Whyte JJ, Junguarded RE, Schmitt CJ, et al. Ethoxyresorufin- O-deethylase (EROD) activity in fish as a biomarker of chemical exposure. Crit Rev Toxicol, 2000; 30, 347-570.

32.Kroeger KM, Carville KS, Abraham LJ. The -308 tumor necrosis factor-a promoter polymorphism effects transcription. Mol Immunol, 1997; 34, 391-9.

33.Whyte M, Hubbard R, Meliconi R, et al. Increased risk of fibrosing alveolitis associated with interleukin-1 receptor antagonist and tumor necrosis factor-gene polymorphisms. Am  J Respir Crit Care Med, 2000; 162, 755-8.

34.Schins RP, Borm PJ. Epidemiological evaluation release of monocyte TNF-a as an exposure and effect marker in pneumo-

 

coniosis: A five year follow up study among coal workers. Occup Environ Med, 1995; 52, 441-50. 

35.Mycko M, Kowalski W, Kwinkowski M, et al. Multiple sclerosis: The frequency of allelic forms of tumor necrosis factor and lymphotoxin alpha. J Neuroimmunol, 1998; 84, 198-206.

36.Jacob CO, Fronek Z, Lewis GD, et al. Heritable major histocompatibility complex class II-associated differences in production of tumor necrosis factor-a: Relevance to genetic predisposition to systemic lupus erythematosus. Proc Natl Acad Sci USA, 1990; 87, 1233-7.

37.Suzanne L. Cassela, Stephanie C, et al. The Nalp3 inflammasome is essential for the development of silicosis. Proc Natl Acad Sci USA, 2008; 105, 9035-40.

38.Allen JT, Spiteri MA. Growth factors in idiopathic pulmonary fibrosis: relative roles. Respir Res 2002, 3, 13

39.Piguet PF, Collart MA, Grau GE, et al. Requirement of tumour necrosis factor for development of silica-induced pulmonary fibrosis. Nature, 1990;344, 245-7.

40.Piguet, PF, Collart, MA, Grau, GE, et al. Tumor necrosis factor/cachectin plays a key role in bleomycin-induced pneumopathy and fibrosis. J. Exp. Med, 1989; 170, 655-63.

41.Gordon A, Kiss-Toth E, Stockley I, et al. Polymorphisms in the interleukin-1 receptor antagonist and interleukin-6 genes affect risk of osteolysis in patients with total hip arthroplasty. Arthritis Rheum, 2008; 58(10), 3157-65.

42.Clay FE, Tarlow JK, Cork MJ, et al. Novel interleukin-1 receptor antagonist exon polymorphisms and their use in allele-specific mRNA assessment. Hum Genet, 1996; 97, 723-6.

43.Tarlow JK, Blakemore AI, Lennard A, et al. Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum Genet, 1993; 91, 403-4.

 
Full-Text PDF: 517-525.pdf
Biomedical and Environmental Sciences ISSN 0895-3988 CN 11-2816/Q
Publish Under the Auspices of Chinese Center for Disease Control and Prevention
Distributed by Chinese Center for Disease Control and Prevention
All Rights Reserved by Chinese Center for Disease Control and Prevention
京ICP备11024750