-
PCB2 [purity > 98.0% high-performance liquid chromatography (HPLC)] was purchased from Chengdu Biopurify Phytochemicals Ltd. (Chengdu, China). AFB1 (purity > 98.0% HPLC) was purchased from Sigma Aldrich (USA). Dimethyl sulfoxide (DMSO, purity ≥ 99.9%) was purchased from MP Biomedicals (USA). Superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), and malondialdehyde (MDA) assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Bicinchoninic acid (BCA) protein assay kit was purchased from MULTI SCIENCES (Hangzhou, China). Eastep® Super Total RNA Extraction Kit, GoScript™ Reverse Transcription Mix, and GoTaq® quantitative polymerase chain reaction (qPCR) Master Mix were purchased from Promega Corporation (USA). Interleukin-6 (IL-6) and 8-hydroxy-2′-deoxyguanosine (8-OHdG) enzyme-linked immunosorbent assay (ELISA) kits were purchased from Jiangsu Meimian Industrial Co., Ltd. (Jiangsu, China). Primary antibodies against bcl-2 and bax were purchased from Cell Santa Cruz Biotechnology (USA); the β-actin antibody was purchased from Cell Signaling Technology Inc. (USA). The secondary goat anti-rabbit and goat anti-mouse horseradish peroxidase-conjugated antibodies were purchased from Cell Signaling Technology Inc. Western Lightning Plus enhanced chemiluminescence (ECL) was purchased from PerkinElmer Inc. (USA).
-
Six week-aged male Sprague Dawley (SD) rats were purchased from Guangxi Medical University Laboratory Animal Center (Nanning, China). All rats were housed in standard animal cages with free access to food and water under a strict 12 h light-dark cycle. They were acclimated to the animal facility environment for 1 week before experiments. SD rats were randomly divided into four groups (n = 10 each). The control and AFB1 groups were given double distilled water by gavage for 5 d consecutively. The AFB1 + PCB2 and PCB2 groups were administered PBC2 by gavage for 5 consecutive days (30 mg/kg, dissolved in double distilled water). After 5 d of gavage, the AFB1 and AFB1 + PCB2 groups were given single intraperitoneal injections of AFB1 (2 mg/kg, dissolved in DMSO) on the sixth day, whereas the control and PCB2 groups intraperitoneally received equal volume of DMSO. The AFB1 + PCB2 and PCB2 groups received daily intragastric administration of PCB2, whereas the other two groups received daily intragastric administration of double distilled water continually until the end of experiment. On the eighth day, the animals were euthanized. Blood samples were collected, and the serum was separated immediately. The liver tissue was isolated from each rat, washed in ice-cold saline, and stored at −80 °C for further experimental analyses. The dose, administration way, and exposure time of AFB1 mentioned earlier were based on study of Cui et al.[21] and Wang[22]. All experimental procedures were approved by the Animal Ethics Committee of Guangxi Medical University (Nanning, China). The whole procedure of animal treatment can be seen in Figure 1.
-
The body mass of all rats were weighed at a fixed time every morning. The whole liver, spleen, and kidney were weighed after being isolated from body, rinsed by ice-cold saline, and dried by filter paper. Weight gain was calculated as body weight after experiment minus the body weight before experiment. Liver coefficient, spleen coefficient, and kidney coefficient were calculated as liver mass/body mass, spleen mass/body mass, and kidney mass/body mass, respectively. The calculation result was expressed as g/100 g.
-
The whole blood remained still for 1 h at 4 °C after collection, and then, the serum was separated by centrifugation at 3,000 rpm for 15 min at 4 °C. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), direct bilirubin (DBIL), and alkaline phosphatase (ALP) were detected by Hitachi 7600-020 automatic biochemical analyzer, following the manufacturer’s protocol.
-
The excised liver tissue was fully fixed in 4% paraformaldehyde and then dehydrated, paraffin-embedded, sectioned, and stained with hematoxylin and eosin. The sections of liver tissue were observed with EVOS FL Auto Cell Imaging System.
-
Liver tissue was homogenized in ice-cold saline at a ratio of 1:9 (g:mL) and centrifuged at 2,500 rpm for 10 min at 4 °C. The supernatant was used for hepatic CAT, GSH, and SOD detection. The serum was used to measure MDA concentration. The measurements were performed according to the manufacturer’s instructions.
-
The serum level of interleukin-6 (IL-6) and hepatic level of 8-OHdG were measured by ELISA kits. Samples were prepared before performing ELISA test. For 8-OHdG determination, the required supernatant was obtained by homogenizing liver tissue in phosphate-buffered saline at a ratio of 1:9 (g:mL) and centrifuging at 5,000 rpm for 15 min. The serum was directly used to detect IL-6 concentration. The operation steps of ELISA include as follows: preparing standard solution for standard curve establishment, loading samples, washing plate, rendering color, terminating reaction, and determining the optical density value. All procedures were performed following the manufacturer’s instructions of ELISA kits.
-
Total RNA was extracted from the liver tissue by Eastep® Super Total RNA Extraction Kit. RNA reverse transcription was conducted by GoScript™ Reverse Transcription Mix, and qPCR was performed using GoTaq® qPCR Master Mix. The primers used in this study are listed in Table 1. PCR amplification was carried out by StepOne™ Real-Time PCR System for 40 cycles; the procedures included prevariation at 95 °C for 10 min, denaturation at 95 °C for 15 s, annealiation at 55 °C for 30 s, and extension at 72 °C for 30 s.
Gene Primer sequences (5′-3′) Product length (bp) IL-6 Forward: AGTTGCCTTCTTGGGACTGA 126 Reverse: CCTCCGACTTGTGAAGTGGT bcl-2 Forward: GACTGAGTACCTGAACCGGCATC 135 Reverse: CTGAGCAGCGTCTTCAGAGACA bax Forward: AGACACCTGAGCTGACCTTGGA 196 Reverse: TTGAAGTTGCCATCAGCAAACA β-actin Forward: GGAGATTACTGCCCTGGCTCCTA 150 Reverse: GACTCATCGTACTCCTGCTTGCTG Table 1. Polymerase chain reaction primers and the amplified product length
-
The excised liver tissue was homogenized in RIPA lysis buffer [1% Triton X-100, 1% deoxycholate, 0.1% sodium dodecylsulphate (SDS), and 1 mmol/L phenylmethylsulfonyl fluoride]. The lysate was centrifuged at 14,000 g for 10 min. The supernatant was used for protein quantification by BCA protein assay kit to ensure equal loading of total protein of each sample on a 12% SDS-polyacrylamide gel electrophoresis gel. The proteins were transferred to polyvinylidene fluoride membranes. Membranes were incubated with blocking buffer (20% skim milk) for 30 min at room temperature and then incubated with primary antibodies for bcl-2, bax, and β-actin overnight at 4 °C. Subsequently, the membranes were washed three times using 1× Tris-buffered saline with Tween buffer and incubated with secondary antibodies for 1 h at room temperature. The proteins on membrane were visualized by Western Lightning Plus ECL. The intensity of each protein band was quantified by densitometry using Image J software[23].
-
All data were expressed as mean ± standard deviation. Data were analyzed by one-way analysis of variance and followed by a least significant difference test. Statistical analysis was performed using SPSS 20.0 software. P < 0.05 was identified as statistically different.
Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats
doi: 10.3967/bes2020.033
- Received Date: 2019-10-24
- Accepted Date: 2020-02-05
-
Key words:
- Procyanidin B2 /
- Aflatoxin B1 /
- Acute liver injury /
- Oxidative stress /
- Inflammation
Abstract:
Citation: | DENG Zhi Jie, ZHAO Jing Fang, HUANG Feng, SUN Gui Li, GAO Wei, LU Li, XIAO De Qiang. Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033 |