-
Y. pestis biovar microtus strain 201, an avirulent strain to humans, was used as the derivative (wild type, WT)[31]. Nonpolar ryhB1, ryhB2, and fur single-gene deletion mutants derived from the WT strain, termed ΔryhB1, ΔryhB2, and Δfur, respectively, were constructed previously using the λ-Red homologous recombination method[21, 29, 32]. Briefly, the entire coding regions of fur, ryhB1, and ryhB2 were replaced with the kanamycin resistance cassette using the one-step inactivation method based on the lambda Red phage recombination system with the helper plasmid pKD46, which can express the highly efficient Red homologous recombination system. The polymerase chain reaction (PCR) fragment carrying the kanamycin resistance cassette flanked by regions homologous to the fur, ryhB1, or ryhB2 genes was introduced into the WT strain. The mutant strains were selected due to their kanamycin resistance and were verified by PCR and DNA sequencing.
For complementation of the mutants[21], a PCR-generated DNA fragment comprising the corresponding coding region and transcriptional terminator was cloned into the pBAD33 vector, harboring a chloramphenicol resistance gene. Each recombinant plasmid was introduced into the corresponding mutant, yielding the complementation strain (termed C-ΔryhB1, C-ΔryhB2, and C-Δfur, respectively). All the primers used in this study are listed in Table 1.
Target Primers (forward/reverse, 5’-3’) Construction of mutants fur CAGCCTTAATTTGAATCGATTGTAACAGGACTGAATCCGCTGTAACGCACTGAGAAGC/
GTGCTTAAAATCTTTATAAGAGTAATGCGATAAAACGATAAGATTGCAGCATTACACGryhB1 CATATTCCCCCTGAGTCAAAT/CGTGTAATGCTGCAATCTGGCAATGATAATCATTATCAC GCTTCTCAGTGCGTTACATTTGCCTTTTTCTCACCCCGTTC/GGTAAATCAACTTAATCCGAGAG ryhB2 GGCGTAAACCAGTCGGTAGTCT/CGTGTAATGCTGCAATCTAAAATGATAATACTTATCAATAT GCTTCTCAGTGCGTTACAGTGCCCAGAAAACCCCCAGC/TTCCGGTGAGTGAGTACAGC Complementation of the mutants ryhB1 CACGAATTCTGCTTTCAGATGAGCGCATCAAAAGTTTAGGTG/TTGAAGCTTAAAAAAGCCAGCACCCGGCTGGCTAAGTAAAC ryhB2 CACGAATLTCTGCGATTCAGAACAAGGCAGGCAGTCTTTGG/TTGAAGCTTAAAAAAGCCAGCACCCGAGCTGGCTTAAAATAC Protein expression fur GCGGGATCCATGACTGACAACAACAAAG/GCGAAGCTTTTATCTTTTACTGTGTGCAGA Primer extension fur /CCAAATGAAAACGGTGGTTG ryhB1 /CCGGCTGGCTAAGTAAACAC ryhB2 /GCTTTACTGAACCCCCAGCC hmsT /GGTATTTATTCCGACATCACGAC hmsH /TATTGTTGCAAAGTCATTATAGGAT EMSA ryhB1 ATCCCAGGACAGGTTCTCTC/CCGGCTGGCTAAGTAAACAC ryhB2 GCACCGCCTGATTATTCATCG/CACCCGAGCTGGCTTAAAATAC fur CTGAGTATTTCTGTGATGCGATG/CTGACGTGGTGACACGCAGG DNase I footprinting ryhB1 ATCCCAGGACAGGTTCTCTC/CCGGCTGGCTAAGTAAACAC ryhB2 GCACCGCCTGATTATTCATCG/CACCCGAGCTGGCTTAAAATAC Table 1. Oligonucleotide primers used in this study
Unless stated otherwise, Y. pestis was cultivated in Luria-Bertani (LB) broth (1% tryptone, 0.5% yeast extract, and 1% NaCl) or on LB agar plates[21]. Briefly, a single colony was inoculated on an LB agar plate an incubated for 1–2 d. The resultant bacterial cells were washed into LB broth to attain an OD620 of approximately 1.5, and the resulting broth culture was stored in the presence of 30% glycerol at −80 °C. Thereafter, 200 μL of bacterial glycerol stocks were inoculated into 18 mL of fresh LB broth and allowed to grow with shaking at 230 rpm to an OD620 of approximately 0.4 prior to bacterial collection. When appropriate, the culture medium was supplemented with 34 μg/mL chloramphenicol.
-
The colony morphology assay was performed as previously described[21]. Briefly, aliquots of 5 μL of bacterial glycerol stocks were spotted on an LB plate, followed by incubation for approximately 7 days. Thereafter, the surface morphology of each colony was recorded photographically.
-
The primer extension assay was performed essentially as previously described[21]. Briefly, total bacterial RNAs were extracted using TRIzol Reagent (Invitrogen), and then approximately 8 µg of total RNA was annealed with 1 pmol of 5′-32P-labeled reverse primer to generate cDNAs using the Primer Extension System (Promega) according to the manufacturer's instructions. The same labeled primer was used for sequencing with the AccuPower & Top DNA Sequencing Kit (Bioneer, Korea). The products of primer extension and sequencing were then analyzed by 6% polyacrylamide gel electrophoresis/8 M urea, and the results were detected by autoradiography using a Fuji Medical X-ray film.
-
The entire coding region of fur was amplified, purified, and cloned into the pET28a vector (Novagen, USA), which was then verified by DNA sequencing. Escherichia coli BL21λDE3 were transformed with the recombinant plasmid encoding the His-Fur protein. Expression and purification of His-Fur protein was carried out as previously described[21]. The purified His-Fur protein was concentrated to a final concentration of approximately 0.2 mg/mL in storage buffer (phosphate-buffered saline, pH 7.5, 20% glycerol). The purity of the His-Fur protein was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The purified protein was stored at −80 °C.
-
For the EMSA[21, 33], the 5′-ends of the regulatory DNA regions of each target gene were labeled with [γ-32P]-ATP. EMSA was performed in a 10 μL reaction volume containing binding buffer [100 mmol/L MnCl2, 1 mmol/L MgCl2, 0.5 mmol/L DTT, 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 7.5), 0.05 mg/mL sheared salmon sperm DNA, 0.05 mg/mL BSA, and 4% glycerol], labeled DNA probe (1,000–2,000 CPM/μL), and increasing quantities of His-Fur. Three controls were included: (1) cold probe as a specific DNA competitor (corresponding regulatory DNA region unlabeled), (2) negative probe as a nonspecific DNA competitor (the unlabeled coding region of 16S rRNA), and (3) nonspecific protein competitor (rabbit anti-F1-protein polyclonal antibodies). The binding products were analyzed in a native 4% (w/v) polyacrylamide gel, and the results were detected by autoradiography after exposure to Fuji Medical X-ray film.
-
For the DNase I footprinting assay[21, 33], the promoter-proximal DNA regions of each target gene with a single 32P-labeled end were generated by PCR and purified using QiaQuick columns (Qiagen, Germany). DNA binding was performed in a 10 μL reaction volume containing the same binding buffer as for EMSA, labeled DNA fragment (2–5 pmol), and increasing quantities of His-Fur and incubated at room temperature for 30 min. Prior to digestion, 10 μL of Ca2+/Mg2+ solution (5 mmol/L CaCl2 and 10 mmol/L MgCl2) was added to each reaction and incubated for 1 min at room temperature. Then, the optimized RQ1 RNase-Free DNase I (Promega) was added to each reaction mixture and then incubated at room temperature for 30–90 s. The cleavage reaction was quenched by adding 9 μL of stop solution (200 mmol/L NaCl, 30 mmol/L EDTA, and 1% SDS), followed by incubation for 1 min at room temperature. The partially digested DNA samples were extracted with phenol/chloroform, precipitated with ethanol, and analyzed on a 6% polyacrylamide/8 mol/L urea gel. Protected regions were identified by comparison with DNA sequencing size markers. The results were detected by autoradiography after exposure to Fuji Medical X-ray film.
Reciprocal Regulation between Fur and Two RyhB Homologs in Yersinia pestis, and Roles of RyhBs in Biofilm Formation
doi: 10.3967/bes2021.039
- Received Date: 2020-08-07
- Accepted Date: 2020-12-04
-
Key words:
- Yersinia pestis /
- RyhB /
- Fur /
- Biofilm
Abstract:
Citation: | NI Bin, WU Hai Sheng, XIN You Quan, ZHANG Qing Wen, ZHANG Yi Quan. Reciprocal Regulation between Fur and Two RyhB Homologs in Yersinia pestis, and Roles of RyhBs in Biofilm Formation[J]. Biomedical and Environmental Sciences, 2021, 34(4): 299-308. doi: 10.3967/bes2021.039 |