Volume 35 Issue 12
Dec.  2022
Turn off MathJax
Article Contents

LIAO Lei, SHI Wen, MA Chao, TANG Wen Lian, QIAN Qi Lan, WANG Yu, LI Jiao Jiao, SHEN Jin Yang, JI Jing, MA Jin Ming, GAO Song. Duplex Detection of Vibrio Cholerae and Vibrio Parahaemolyticus by Real-time Recombinase Polymerase Amplification[J]. Biomedical and Environmental Sciences, 2022, 35(12): 1161-1165. doi: 10.3967/bes2022.148
Citation: LIAO Lei, SHI Wen, MA Chao, TANG Wen Lian, QIAN Qi Lan, WANG Yu, LI Jiao Jiao, SHEN Jin Yang, JI Jing, MA Jin Ming, GAO Song. Duplex Detection of Vibrio Cholerae and Vibrio Parahaemolyticus by Real-time Recombinase Polymerase Amplification[J]. Biomedical and Environmental Sciences, 2022, 35(12): 1161-1165. doi: 10.3967/bes2022.148

Duplex Detection of Vibrio Cholerae and Vibrio Parahaemolyticus by Real-time Recombinase Polymerase Amplification

doi: 10.3967/bes2022.148
More Information
  • Author Bio:

    LIAO Lei, male, born in 1995, Master Degree, majoring in Pharmacy

    SHI Wen, female, born in 1997, Graduate Student, majoring in Pharmacy

    MA Chao, male, born in 1996, Master Degree, majoring in Pharmacy

  • Corresponding author: JI Jing, E-mail: jijing@jou.edu.cn; MA Jin Ming, E-mail: majinming@outlook.com; GAO Song, E-mail: gaos@jou.edu.cn Tel/Fax: 86-518-85895781.
  • Received Date: 2022-09-14
  • Accepted Date: 2022-10-08
  • 加载中
  • [1] Bonnin-Jusserand M, Copin S, Le Bris C, et al. Vibrio species involved in seafood-borne outbreaks (Vibrio cholerae, V. parahaemolyticus and V. vulnificus): review of microbiological versus recent molecular detection methods in seafood products. Crit Rev Food Sci Nutr, 2019; 59, 597−610. doi:  10.1080/10408398.2017.1384715
    [2] Lee JH, Park SK, Khan F, et al. Simultaneous isolation and enumeration of virulent Vibrio cholerae and Vibrio vulnificus using an advanced MPN-PCR method. Arch Microbiol, 2022; 204, 5. doi:  10.1007/s00203-021-02613-y
    [3] Barrera-Escorcia G, Wong-Chang I, Fernández-Rendón CL, et al. Quantification of Vibrio species in oysters from the Gulf of Mexico with two procedures based on MPN and PCR. Environ Monit Assess, 2016; 188, 602. doi:  10.1007/s10661-016-5620-9
    [4] Geng YY, Tan K, Liu LB, et al. Development and evaluation of a rapid and sensitive RPA assay for specific detection of Vibrio parahaemolyticus in seafood. BMC Microbiol, 2019; 19, 186. doi:  10.1186/s12866-019-1562-z
    [5] Tang YY, Cao YQ, Yu YX, et al. Real-time recombinase polymerase amplification assay for the detection of Vibrio cholerae in seafood. Food Anal Method, 2017; 10, 2657−66. doi:  10.1007/s12161-017-0820-7
    [6] Yang XH, Zhao PP, Dong Y, et al. An improved recombinase polymerase amplification assay for visual detection of Vibrio parahaemolyticus with lateral flow strips. J Food Sci, 2020; 85, 1834−44. doi:  10.1111/1750-3841.15105
    [7] Wang P, Liao L, Ma C, et al. Duplex on-site detection of Vibrio cholerae and Vibrio vulnificus by recombinase polymerase amplification and three-segment lateral flow strips. Biosensors, 2021; 11, 151. doi:  10.3390/bios11050151
    [8] Geng YY, Liu GH, Liu LB, et al. Real-time recombinase polymerase amplification assay for the rapid and sensitive detection of Campylobacter jejuni in food samples. J Microbiol Methods, 2019; 157, 31−6. doi:  10.1016/j.mimet.2018.12.017
    [9] Cho MS, Ahn TY, Joh K, et al. A novel marker for the species-specific detection and quantitation of Vibrio cholerae by targeting an outer membrane lipoprotein lolB gene. J Microbiol Biotechnol, 2013; 23, 555−9. doi:  10.4014/jmb.1208.08029
    [10] Lobato IM, O'Sullivan CK. Recombinase polymerase amplification: basics, applications and recent advances. TrAC Trends Anal Chem, 2018; 98, 19−35. doi:  10.1016/j.trac.2017.10.015
  • 22308Supplementary Materials.pdf
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(2)  / Tables(2)

Article Metrics

Article views(1674) PDF downloads(153) Cited by()

Proportional views
Related

Duplex Detection of Vibrio Cholerae and Vibrio Parahaemolyticus by Real-time Recombinase Polymerase Amplification

doi: 10.3967/bes2022.148
&These authors contributed equally to this work.
LIAO Lei, SHI Wen, MA Chao, TANG Wen Lian, QIAN Qi Lan, WANG Yu, LI Jiao Jiao, SHEN Jin Yang, JI Jing, MA Jin Ming, GAO Song. Duplex Detection of Vibrio Cholerae and Vibrio Parahaemolyticus by Real-time Recombinase Polymerase Amplification[J]. Biomedical and Environmental Sciences, 2022, 35(12): 1161-1165. doi: 10.3967/bes2022.148
Citation: LIAO Lei, SHI Wen, MA Chao, TANG Wen Lian, QIAN Qi Lan, WANG Yu, LI Jiao Jiao, SHEN Jin Yang, JI Jing, MA Jin Ming, GAO Song. Duplex Detection of Vibrio Cholerae and Vibrio Parahaemolyticus by Real-time Recombinase Polymerase Amplification[J]. Biomedical and Environmental Sciences, 2022, 35(12): 1161-1165. doi: 10.3967/bes2022.148
  • Vibrio cholerae and Vibrio parahaemolyticus are the two most commonly reported pathogens in seafood [1]. Consuming raw or undercooked seafood contaminated with these two Vibrio species can cause food poisoning, posing the risk of severe gastrointestinal illness and death [2-3]. Therefore, precise and reliable methods for detecting V. cholerae and V. parahaemolyticus contamination in seafood are essential for controlling food safety.

    Many molecular detection methods have been developed for V. parahaemolyticus and V. cholerae, including polymerase chain reaction (PCR)-based methods, such as PCR and qPCR, and isothermal amplification methods, such as loop-mediated isothermal amplification and recombinase polymerase amplification (RPA) [1,4,5]. Among them, RPA-based methods are more suitable for on-site applications due to the short detection time and less instrument dependence. An RPA assay coupled with lateral flow dipsticks (RPA-LFD) targeting the tlh gene of V. parahaemolyticus has been established [6], and gyrB of V. parahaemolyticus and lolB of V. cholerae have been selected as targets for detection by real-time RPA assays [4,5]. The real-time RPA assay reads fluorescence signals along with amplification, which avoids opening the reaction containers as in the RPA-LFD assay; thus, there is less risk of carry-over contamination in the assay operating environment.

    However, previous studies focused on detecting one pathogen at a time. However, multiplex assays to simultaneously detect V. cholerae and V. parahaemolyticus are needed for complex food samples. Current multiplex detection assays available for Vibrio species have used PCR, qPCR, and RPA-LFD technologies [1,7], but a real-time RPA assay for duplex detection of V. cholerae and V. parahaemolyticus has not been developed. In this study, we describe a duplex real-time RPA assay to simultaneously detect V. cholerae and V. parahaemolyticus. This assay will provide added convenience for on-site detection of these two Vibrio species in food supply chains, and the principle can be applied to multiplex detection of other foodborne pathogens.

    Twenty bacterial strains were used in this study. The reference strains, including V. cholerae (ATCC 14100), V. parahaemolyticus (ATCC 17802), Vibrio vulnificus (ATCC 27562), Vibrio alginolyticus (ATCC 17749), Vibrio harveyi (ATCC 43516), Vibrio mimicus (MCCC 1A02602), Vibrio splendidus (MCCC 1A04096), Vibrio ichthyoenteri (MCCC 1A00057), Aeromonas caviae (ATCC 15468), Aeromonas hydrophila (ATCC 43414), Aeromonas veronii (ATCC 35622), Bacillus cereus (ATCC 14579), Staphylococcus aureus (ATCC 6538), Salmonella enteritidis (ATCC 14028), and Yersinia enterocolitica (ATCC 9610) were purchased from the American Type Culture Collection (Manassas, VA, USA) or the Marine Culture Collection of China (Xiamen, China). Two environmental strains of V. cholerae and three environmental strains of V. parahaemolyticus were provided by the Jiangsu Institute of Oceanology and Marine Fisheries (Nantong, China). All strains were confirmed by 16S rRNA sequencing and grown in an Alkaline Peptone Water medium at 37 °C when activated. Genomic DNAs were released by boiling the bacterial cultures at 100 °C for 10 min and used directly as reaction templates.

    The primer and probe sequences used in the real-time RPA reactions were derived from previously reported individual real-time RPA assays for V. cholerae and V. parahaemolyticus [4,5]. The probes for the real-time RPA reaction were modified as described by the manufacturer’s instructions in the TwistAmp DNA Amplification Exo kit (TwistDx Inc, Maidenhead, UK). A base at the middle of the probe was substituted with a tetrahydrofuran (THF) group, and two T bases adjacent to THF were labeled with a fluorophore and a quencher (BHQ1 in this study), respectively. The fluorophore probes for V. cholerae and V. parahaemolyticus were FAM (detection wavelength 465–510 nm) and HEX (detection wavelength 533–580 nm), respectively. The sequences of the primers and probes are listed in Table 1. The primers and probes were synthesized by General Biology Co. Ltd. (Anhui, China). The target genes, gyrB and lolB, if present, were amplified by RPA with their corresponding forward and reverse primers in the duplex real-time RPA assay. For each target, the respective probe pairs for the amplified strand and the exonuclease III were cut at THF to release the fluorophore for signaling; therefore, the DNA template from either bacterium would be specifically amplified. SpC3 was used to block unnecessary extension of the strand at the 3′ end of the probe (Figure 1).

    AssayPathogenNameSequence (5′–3′)Amplicon size (bp)
    Real-time RPAV. choleraeForward primerATCTTCAAGCTGTTCAACGGGAATATCTAA218
    Reverse primerATCAGCGACAATCGTTCAACTTTCAATGGC
    ProbeATCAGGCTTTGTGCATCTTGGTCGCGGTAGA[FAM-dT] [THF] [BHQ1-dT]GATCATCATAAGTTTCG-SpC3
    V. parahaemolyticusForward primerCGAAGAAAGCGAAAACGGCAACGTCAGGCGA168
    Reverse primerCAGATAATTTCTCACCCATCGCCGATTCAACC
    ProbeGGTTTGACAGCCGTTGTTTCAGTAAAAGTGCC[HEX-dT] [THF] [BHQ1-dT]TCCAAAATTCTCGAGCC-SpC3
    qPCRV. choleraeForward primerCCGTTGAGGCGAGTTTGGTGAGA195
    Reverse primerGTGCGCGGGTCGAAACTTATGAT
    V. parahaemolyticusForward primerCGGTAGTAAACGCACTGTCAGAA77
    Reverse primerACGGTAAGTTTGCGTGTGGAT

    Table 1.  Primer and probe sequences

    The real-time RPA reactions followed the manufacturer’s instructions for the TwistAmp DNA Amplification Exo kit. A 15-μL real-time RPA reaction mixture was prepared as follows. To the lyophilized enzyme pellet, 35.4 μL of rehydration buffer, 11.9 μL of nuclease-free water, 2.5 μL of primer (s), and 0.7 μL of the probe (s) were added and mixed uniformly to prepare the premix. Then, 13.25 μL of the premix was removed, and 1 μL of the template and 0.75 μL of MgOAc (280 mmol/L) were added. After brief centrifugation, the reaction mixture was incubated at 39 °C for 4 min, gently mixed, and the fluorescence signal was recorded on the Roche LightCycler 480 II qPCR machine (Basel, Switzerland) with the FAM and HEX channels at 39 °C. The signal was read at 1-min intervals for 26 min.

    Figure 1.  Schematic diagram of the duplex real-time RPA assay.

    The optimal concentration ranges of the primers and the probe for V. cholerae in the single reaction were examined to determine the primer and probe concentrations in the duplex real-time RPA reaction. Using a ten-fold serially diluted template from 1.0 × 100 to 1.0 × 104 colony forming units (CFU)/μL, the detection limit for V. cholerae in the single real-time RPA reaction was 1.0 × 101 CFU/μL (Figure 2A). Using this amount of the template, the concentrations of the primers and probe were decreased proportionally, and the fluorescence signal diminished with the decrease in concentration (Figure 2B). Once the concentration was reduced to 25% of the original, a significant drop in the fluorescence signal was observed. Thus, the primer and probe concentrations were used at 50% of their original concentrations (208 nmol/L final for each primer and 58 nmol/L final for the probe) for detecting V. cholerae in the real-time RPA reaction.

    Figure 2.  (A–D) Optimizing the primer and probe concentrations. (E–H) Optimizing the duplex real-time RPA reaction. (I–J) Specificity of the duplex real-time RPA assay.

    Similarly, the optimal concentration ranges of the primers and probe for V. parahaemolyticus were examined in a single reaction. The detection limit of the single reaction was 1.0 × 102 CFU/μL (Figure 2C). As the maximum fluorescence value was moderate at the detection limit, 1.0 × 103 CFU/μL was used to test the primer and probe concentration ranges. A significant decrease in the signal at a concentration of 25% of the original was observed (Figure 2D), suggesting that the primer and probe concentrations at 50% of the original were acceptable for detecting V. parahaemolyticus.

    As the single reactions of the primer and probe concentrations could be reduced to 50% for both pathogens, the primers and probes at concentrations of 50% of the original (208 nmol/L final for each primer and 58 nmol/L final for each probe) were assembled into the duplex real-time RPA reaction to reach the total concentration of 100%. The sensitivity of the duplex assay for each pathogen was determined. The sensitivity for V. cholerae was 1.0 × 101 CFU/μL (Figure 2E). A probit regression analysis (SPSS software; IBM Corp., Armonk, NY, USA) of the results of eight independent repeats showed that the detection limit was 37 CFU/μL in 95% of the cases (Figure 2F). The sensitivity for V. parahaemolyticus was 1.0 × 102 CFU/μL, and the limit of detection was 99 CFU/μL in 95% of the cases (Figure 2G–H).

    The specificity of the duplex assay was confirmed with a series of Vibrio species and other commonly seen zoonotic and foodborne pathogens, including the 15 reference strains and 5 environmental strains described above. In the specificity test, bacterial DNA was extracted using the TIANamp Bacterial DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China). DNA templates were quantified by Qubit 4 (ThermoFisher Scientific Inc., Wilmington, MA, USA) and normalized to 25 ng/μL. Only the reference and environmental strains of V. cholerae and V. parahaemolyticus produced positive signals on the respective fluorescence channels (Figure 2I–J), suggesting good specificity. The specificity of the primers and probes used in this study was established previously [4,5]. Here we further confirmed no cross-reaction between the 2 primer-probe sets in the duplex system.

    The duplex real-time RPA assay was validated with 40 clinical samples, including 20 shrimp samples (Litopenaeus vannamei), 15 fish samples (Trichiurus lepturus), and 5 shellfish samples (Pectinidae). The detection results were compared to the qPCR results (Supplementary Table S1 available in www.besjournal.com). The qPCR primer sequences were obtained from previous reports and are listed in Table 1 [8,9]. Among the 40 samples, 5 were positive for V. cholerae, 7 were positive for V. parahaemolyticus, and 1 was positive for both bacteria. The results were 100% consistent with the qPCR. The duplex real-time RPA assay was accurate and reliable for simultaneously detecting V. cholerae and V. parahaemolyticus. This assay is ready for on-site detection, as the qPCR instrument used in this study can be replaced by a portable fluorescence detector, e.g., the Genie III Scanner from Suntrap Science & Technology Co. Ltd. (Beijing, China).

    No.Food typeSample sourceDetection results for Vibrio choleraeDetection results for Vibrio parahaemolyticus
    Real-time RPAqPCRReal-time RPAqPCR
    1ShrimpLianyungang, China
    2ShrimpLianyungang, China
    3ShrimpLianyungang, China++
    4ShrimpLianyungang, China++
    5ShrimpLianyungang, China
    6ShrimpLianyungang, China++
    7ShrimpLianyungang, China
    8ShrimpLianyungang, China
    9ShrimpLianyungang, China
    10ShrimpLianyungang, China
    11ShrimpQingdao, China
    12ShrimpQingdao, China
    13ShrimpQingdao, China
    14ShrimpQingdao, China++++
    15ShrimpQingdao, China
    16ShrimpQingdao, China
    17ShrimpQingdao, China
    18ShrimpQingdao, China++
    19ShrimpQingdao, China
    20ShrimpQingdao, China++
    21FishYancheng, China
    22FishYancheng, China++
    23FishYancheng, China
    24FishYancheng, China
    25FishYancheng, China
    26FishYancheng, China
    27FishQingdao, China
    28FishQingdao, China
    29FishQingdao, China
    30FishQingdao, China++
    31FishQingdao, China++
    32FishQingdao, China
    33FishQingdao, China++
    34FishQingdao, China
    35FishQingdao, China
    36ShellfishQingdao, China
    37ShellfishQingdao, China++
    38ShellfishQingdao, China
    39ShellfishQingdao, China
    40ShellfishQingdao, China
      Note. +: positive result; −: negative result.

    Table S1.  Detection results of clinical samples by real-time RPA and qPCR

    Amplification was an important issue to solve when establishing the duplex RPA reaction, as biased amplification of one target would consume more reaction resources and affect the other [10]. Here, we designed the reaction so that the amplicon sizes of the two targets were similar (218 bp vs. 168 bp) and carefully optimized the primer and probe concentrations. We first determined that the concentrations of the primers and probes could be decreased to 50% of the initial for both V. cholerae and V. parahaemolyticus. Based on this result, a molar ratio of 1:1 of the V. cholerae primer-probe set to the V. parahaemolyticus primer-probe set was selected to compensate for the potential biased amplification. The duplex real-time RPA assay had the same sensitivity as the single reactions for both pathogens, suggesting that the issue of amplification preference was overcome.

    In conclusion, a duplex real-time RPA assay to simultaneously detect V. cholerae and V. parahaemolyticus was established in this study. The assay exhibited good specificity and sensitivity that reached 37 CFU/μL for V. cholerae and 99 CFU/μL for V. parahaemolyticus. These results were comparable to the sensitivity reported for previous singleplex real-time RPA assays [4,5] (V. cholerae: 5 copies/μL standard plasmid; V. parahaemolyticus: 1.0 × 102 copies/μL genomic DNA). Validation with clinical samples was accurate and reliable. Importantly, the duplex assay improved detection efficiency. This is the first real-time RPA-based multiplex detection assay available for Vibrio species. This assay provides a convenient choice for on-site detection of V. cholerae and V. parahaemolyticus, and will guide the development of multiplex detection assays for other foodborne pathogens.

    No potential conflicts of interest are disclosed.

    We thank Dr. HUI Shen of the Jiangsu Institute of Oceanology and Marine Fisheries (Nantong, China) for providing the bacterial strains and clinical samples.

Funds:  This study was supported by grants from the National Natural Science Foundation of China [No. 82104174]; the Key Natural Science Research Project of the Jiangsu Higher Education Institutions of China [No. 20KJA416002]; the Natural Science Foundation of Jiangsu Higher Education Institutions of China [No. 20KJB350008]; the Research Program of the “521 Project” of Lianyungang City of China [No. LYG06521202133]; the Open-end Funds of the Jiangsu Key Laboratory of Marine Pharmaceutical Compound Screening [Nos. HY202004 and HY202103]; the Lianyungang Key Laboratory of Marine Biomedicine and Products [5507018035]; the Postgraduate Research & Practice Innovation Program of Jiangsu Province [SJCX22_1649 and SJCX22_1650]; the “Blue Project” of Jiangsu Higher Education Institutions of China, and the Priority Academic Program Development of Jiangsu Higher Education Institutions of China
&These authors contributed equally to this work.
Reference (10)
Supplements:
22308Supplementary Materials.pdf

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return