Volume 33 Issue 8
Aug.  2020
Turn off MathJax
Article Contents

LI Dan, WANG Qian, SU Meng, WANG Ling Ling, ZHANG Qing, WANG Chun Yang, WANG Jiang Li, DU Luan Ying, LIU Jian Ying, XIE Guang Cheng. Molecular Epidemiology and Clinical Features of Haemophilus influenzae among Hospitalized Children with Community-acquired Pneumonia in Chengde, China[J]. Biomedical and Environmental Sciences, 2020, 33(8): 623-627. doi: 10.3967/bes2020.082
Citation: LI Dan, WANG Qian, SU Meng, WANG Ling Ling, ZHANG Qing, WANG Chun Yang, WANG Jiang Li, DU Luan Ying, LIU Jian Ying, XIE Guang Cheng. Molecular Epidemiology and Clinical Features of Haemophilus influenzae among Hospitalized Children with Community-acquired Pneumonia in Chengde, China[J]. Biomedical and Environmental Sciences, 2020, 33(8): 623-627. doi: 10.3967/bes2020.082

Molecular Epidemiology and Clinical Features of Haemophilus influenzae among Hospitalized Children with Community-acquired Pneumonia in Chengde, China

doi: 10.3967/bes2020.082
More Information
  • Author Bio:

    LI Dan, female, born in 1987, Masters, majoring in infectious diseases

    WANG Qian, female, born in 1990, Masters, majoring in pediatric infectious diseases

  • Corresponding author: XIE Guang Cheng, E-mail: xieguangcheng123@126.com; LIU Jian Ying, E-mail: liujianying1160@sina.com
  • Received Date: 2020-01-16
  • Accepted Date: 2020-07-07
  • 加载中
  • [1] He J, Gu D, Wu X, et al. Major causes of death among men and women in China. N Engl J Med, 2005; 353, 1124−34. doi:  10.1056/NEJMsa050467
    [2] Song JH, Huh K, Chung DR. Community-acquired pneumonia in the Asia-Pacific region. Semin Respir Crit Care Med, 2016; 37, 839−54. doi:  10.1055/s-0036-1592075
    [3] Slack M. The evidence for non-typeable Haemophilus influenzae as a causative agent of childhood pneumonia. Pneumonia (Nathan), 2017; 9, 9. doi:  10.1186/s41479-017-0033-2
    [4] Wang Y, Guo G, Wang H, et al. Comparative study of bacteriological culture and real-time fluorescence quantitative PCR (RT-PCR) and multiplex PCR-based reverse line blot (mPCR/RLB) hybridization assay in the diagnosis of bacterial neonatal meningitis. BMC Pediatr, 2014; 14, 224. doi:  10.1186/1471-2431-14-224
    [5] Giuca MC, Cilcic C, Mihaescu G, et al. Streptococcus pneumoniae and Haemophilus influenzae nasopharyngeal molecular detection in children with acute respiratory tract infection in SANADOR Hospital, Romania. J Med Microbiol, 2019; 68, 1466−70. doi:  10.1099/jmm.0.001038
    [6] Forstner C, Rohde G, Rupp J, et al. Community-acquired Haemophilus influenzae pneumonia--new insights from the CAPNETZ study. J Infect, 2016; 72, 554−63. doi:  10.1016/j.jinf.2016.02.010
    [7] Wootton DG, Cox MJ, Gloor GB, et al. A Haemophilus sp. dominates the microbiota of sputum from UK adults with non-severe community acquired pneumonia and chronic lung disease. Sci Rep, 2019; 9, 2388. doi:  10.1038/s41598-018-38090-5
    [8] Wang Q, Su M, Li D, Du L, Zhang Q. Molecular prevalence and clinical characteristics of human metapneumovirus and human bocavirus in 333 hospitalized children with community-acquired pneumonia. Chinese J Exp Clin Virol, 2019; 33, 261−6.
    [9] Collins S, Vickers A, Ladhani SN, et al. Clinical and molecular epidemiology of childhood invasive nontypeable Haemophilus influenzae disease in England and Wales. Pediatr Infect Dis J, 2016; 35, 76−84. doi:  10.1097/INF.0000000000000996
    [10] Naito S, Takeuchi N, Ohkusu M, et al. Clinical and bacteriologic analysis of nontypeable Haemophilus influenzae strains isolated from children with invasive diseases in Japan from 2008 to 2015. J Clin Microbiol, 2018; 56, e00141−18.
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(1)  / Tables(5)

Article Metrics

Article views(2096) PDF downloads(95) Cited by()

Proportional views
Related

Molecular Epidemiology and Clinical Features of Haemophilus influenzae among Hospitalized Children with Community-acquired Pneumonia in Chengde, China

doi: 10.3967/bes2020.082
These authors contributed equally to this work.
LI Dan, WANG Qian, SU Meng, WANG Ling Ling, ZHANG Qing, WANG Chun Yang, WANG Jiang Li, DU Luan Ying, LIU Jian Ying, XIE Guang Cheng. Molecular Epidemiology and Clinical Features of Haemophilus influenzae among Hospitalized Children with Community-acquired Pneumonia in Chengde, China[J]. Biomedical and Environmental Sciences, 2020, 33(8): 623-627. doi: 10.3967/bes2020.082
Citation: LI Dan, WANG Qian, SU Meng, WANG Ling Ling, ZHANG Qing, WANG Chun Yang, WANG Jiang Li, DU Luan Ying, LIU Jian Ying, XIE Guang Cheng. Molecular Epidemiology and Clinical Features of Haemophilus influenzae among Hospitalized Children with Community-acquired Pneumonia in Chengde, China[J]. Biomedical and Environmental Sciences, 2020, 33(8): 623-627. doi: 10.3967/bes2020.082
  • Community-acquired pneumonia (CAP) is an acute lung infection that is caused by several different pathogens and is associated with significant morbidity and mortality. The high global incidence of CAP poses a heavy disease and economic burden to patients, especially children. Respiratory illnesses such as pneumonia and influenza are the fourth leading cause of death in China[1]. The top 3 etiologic pathogens of CAP in the Asia-Pacific region are Streptococcus pneumoniae, Haemophilus influenzae (H. influenzae), and Mycoplasma pneumoniae (M. pneumoniae). A study of CAP-associated pathogens from 2001 to 2013 showed M. pneumoniae as the most commonly isolated pathogen, especially in children. H. influenzae infection was most common (20.6%) between 2001 and 2003, but data on H. influenzae were missing from 2010 because the focus of CAP etiology had turned to M. pneumoniae and respiratory viruses[2].

    H. influenzae is a Gram-negative bacterium that can be divided into typeable and non-typeable H. influenzae (NTHi) based on the presence or absence of a polysaccharide capsule. Typeable H. influenzae are further divided into 6 serotypes (a to f) based on the capsular polysaccharide antigen, with H. influenzae type b (Hib) representing the most common cause of bacterial pneumonia. While the incidence of Hib has declined dramatically since the widespread introduction of Hib-conjugate vaccines, the incidence of NTHi has increased significantly. Globally, NTHi are recognized as the most common causative pathogens in all ages, and they are confirmed pneumonia pathogens in children[3]. Therefore, the aim of this study was to investigate the molecular epidemiology and clinical features of CAP caused by H. influenzae among hospitalized children in Chengde, China.

    A total of 333 children aged 5 months to 14 years who were hospitalized with CAP in the Department of Pediatrics of a Clinical Teaching Hospital affiliated to Chengde Medical University were enrolled in this study from November 2017 to May 2018. We collected throat swabs from all patients and reviewed medical records for information on age, sex, residence, peak and duration of fever, as well as hospitalization length. Laboratory test data including white blood cell (WBC), neutrophil, and lymphocyte count as well as C-reactive protein (CRP) and lactate dehydrogenase (LDH) concentrations were also recorded. This study was approved by the Ethics Committee of Chengde Medical University with the reference number 2017020 and was performed in accordance with the principles set forth in the Declaration of Helsinki. The collection of samples used in this study was authorized by the guardians of the hospitalized children with prior informed consent.

    Bacterial DNA and viral nucleic acids (DNA or RNA) were extracted from throat swabs using QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) or Viral Nucleic Acid Extraction Kit II (Geneaid, New Taipei City, Taiwan, China) according to manufacturer instructions. The bexA gene of H. influenzae was selected as the target gene and the prevalence of H. influenzae was detected using real-time PCR. The forward and reverse primers (TGCGGTAGTGTTAGAAAATGGTATTATG and GGACAAACATCACAAGCGGTTA, respectively) used in this study were described previously[4]. Real-time PCR was prepared using 2 × TansStart® Top Green qPCR SuperMix (TRANS, Beijing, China) in a final volume of 20 μL containing 5 μL of template DNA and conducted via the MyiQ2 real-time PCR detection system (Bio-Rad, California, USA). Real-time PCR detection was conducted according to the following protocol: initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation for 30 seconds at 95 °C and annealing for 30 seconds at 55 °C. In order to assess co-infection, atypical pathogens such as M. pneumoniae, Chlamydophila pneumoniae (C. pneumoniae), and Legionella pneumophila (L. pneumophila); bacterial pathogens including group A Streptococcus (GAS), Klebsiella pneumoniae (K. pneumoniae), Staphylococcus aureus (S. aureus), and Pseudomonas aeruginosa (P. aeruginosa); and viral pathogens including Influenza A/B/C viruses, parainfluenza virus (PIV) 1, 2, and 3, Adenovirus (AdV), human bocavirus (HBoV), human rhinovirus (HRV), human metapneumovirus (hMPV), respiratory syncytial virus (RSV), and human coronavirus (HCoV) were also detected. Co-infection was defined as testing positive for H. influenzae and presenting with at least one bacterial or viral pathogen.

    Categorical and continuous variables were described as counts (percentages) or median (interquartile range, IQR). Categorical variables were compared using the Chi-squared or Fisher′s exact test, and continuous variables were compared using the Mann-Whitney U-test. All statistical analyses were performed using SPSS v.19.0 (IBM Corp., Armonk, NY). Results were considered statistically significant if P < 0.05.

    Among the 333 children hospitalized with CAP, 209 were positive for H. influenzae. Of these, 86 (41.1%) were singly infected with H. influenzae and 123 (58.9%) were co-infected (98, 22, and 3 children had double, triple, and quadruple bacterial infections, respectively). A total of 125 children were infected with GAS, 32 of whom were singly infected, and 64 of whom were co-infected with GAS and H. influenzae. Of 66 children infected with K. pneumoniae, only 10 were singly infected, 30 were co-infected with K. pneumoniae and H. influenzae, and 4 were co-infected with K. pneumoniae and GAS. Finally, of 20 children infected with S. aureus, only 1 child was singly infected, and 4 were co-infected with both S. aureus and H. influenzae. Our results show that co-infections—especially double and triple bacterial infections—were common events in hospitalized children with CAP (Table 1).

    BacteriaH. inluenzaeGASK. pneumoniaS. aureus
     H. inluenzae (n) 86 6430 4
     GAS (n) 32 4 1
     K. pneumonia (n)10 2
     S. aureus (n) 1
    Total2091256620
     Single bacteria, n (%)86 (41.1)32 (25.6)10 (15.2)1 (5.0)
     Co-infections, n (%)123 (58.9)93 (74.4)56 (84.8)19 (95.0)
     Double bacteria, n (%)98 (46.9)69 (55.2)36 (54.5)7 (35.0)
     Triple bacteria, n (%)22 (10.5)21 (16.8)17 (25.8)9 (45.0)
     Quadruple bacteria, n (%)3 (1.4)3 (2.4)3 (4.5)3 (15.0)

    Table 1.  Detection and co-infections of H. influenzae, GAS, K. pneumoniae and S. aureus among hospitalized children with CAP

    Although H. influenzae was detected throughout the study period of November 2017 to May 2018, the months of December 2017 and January 2018 had the highest detection rates, with 57 and 40 children diagnosed, respectively (Figure 1A). The prevalence of K. pneumoniae, GAS, and S. aureus was concentrated from November 2017 to January 2018 (Figure 1A), and 107 males and 102 females were infected with H. influenzae between November 2017 and May 2018 (Figure 1B). These children mainly resided in urban regions (n = 175) (Figure 1C).

    Figure 1.  Prevalence of H. influenzae among hospitalized children with CAP.

    We divided the 333 hospitalized children into two groups according to age: < 5 years old (n = 168) and ≥ 5 years old (n = 165). Results showed that 109 children infected with H. influenzae were aged < 5 years and 100 were ≥ 5 years (P = 0.821). Out of 125 children infected with GAS, 71 were < 5 years old and 54 were ≥ 5 years old, and children < 5 years old were the main target for infection with GAS (P < 0.0001). Out of 66 children infected with K. pneumoniae, 32 were < 5 years old and 34 were ≥ 5 years old, with children ≥ 5 years old acting as the main targets for K. pneumoniae infection (P = 0.039). There was no difference in the distribution of S. aureus between two the groups (P = 0.400) (Supplementary Table S1 available in www.besjournal.com).

    Bacteria< 5 years (n = 168)≥ 5 years (n = 165)P
    TotalCo-infectionsTotalCo-infections
    H.inluenzae, n (%)109 (64.9)65 (59.6)100 (60.6)58 (58.0)0.821
    GAS, n (%)71 (42.3)52 (73.2)54 (32.7)41 (75.9)< 0.001
    K. pneumoniae, n (%)32 (19.0)27 (84.4)34 (20.6)29 (85.3)0.039
    S. aureus, n (%)12 (7.1)12 (100.0)8 (4.8)7 (87.5)0.400

    Table S1.  Age distribution of H. influenzae, GAS, K. pneumoniae and S. aureus among hospitalized children with CAP

    We further divided the 333 children into 2 groups according to disease severity. Overall, there were 293 mild cases and 40 severe cases. Further stratification showed that 229 (78.2%) mild cases and 31 (77.5%) severe cases were positive for at least one of the following pathogens: H. influenzae, GAS, K. pneumoniae and S. aureus. We found 78 children in the ‘mild case’ group and 8 in the ‘severe case’ group who were singly infected with H. influenzae. Co-infection was also common in mild and severe case groups, with 115 and 16 children affected, respectively (Supplementary Table S2 available in www.besjournal.com).

    BacteriaMild cases (N = 293)
    n (%)
    Severe cases (N = 40)
    n (%)
    POR (95% CI)
    Negative64 (21.8)9 (22.5)0.9250.963 (0.436–2.126)
    Positive229 (78.2)31 (77.5)0.9251.039 (0.470–2.294)
     H.inluenzae78 (26.6)8 (20.0)0.3701.451 (0.641–3.285)
     GAS27 (9.2)5 (12.5)0.5650.711 (0.257–1.965)
     K. pneumoniae8 (2.7)2 (5.0)0.3430.533 (0.109–2.605)
     S. aureu1 (0.3)0 (0.0)1.000
     Co-infection115 (39.2)16 (40.0)0.9270.969 (0.494–1.903)

    Table S2.  Distribution of H. influenzae, GAS, K. pneumoniae and S. aureus according to disease severity

    We compared co-infection with H. influenzae and atypical pathogens (M. pneumoniae and C. pneumoniae), bacterial pathogens (H. influenzae, GAS, K. pneumoniae, and S. aureus), and viruses (RSV, hMPV, HBoV, HCoV, and AdV) across age groups. Our results show that 15 (13.8%) children < 5 years old and 11 (11.0%) children ≥ 5 years old were singly infected with H. influenzae, 39 (18.7%) were co-infected with atypical pathogens (22 children with a percentage of 20.2 were < 5 years old), 83 (39.7%) were co-infected with at least one bacterial pathogen (44 children with percentage of 44.0 were ≥ 5 years old), 16 (7.7%) were co-infected with at least one viral pathogen, and a total of 45 (21.5%) children were co-infected with at least one bacterial and one viral pathogen (26 children with percentage of 23.9 were < 5 years old) (Supplementary Table S3 available in www.besjournal.com).

    Bacteria< 5 years (N = 109)
    n (%)
    ≥ 5 years (N = 100)
    n (%)
    Total (N = 209)
    n (%)
    POR (95% CI)
    H. influenzae15 (13.8)11 (11.0)26 (12.4)0.5461.291 (0.563–2.962)
    H. influenzae + M. pneumoniae/C. pneumoniae22 (20.2)17 (17.0)39 (18.7)0.5551.235 (0.613–2.488)
    H. influenzae + bacteria*39 (35.8)44 (44.0)83 (39.7)0.2250.709 (0.407–1.237)
    H. influenzae + viruses#7 (6.4)9 (9.0)16 (7.7)0.4840.694 (0.248–1.939)
    H. influenzae + bacteria + viruses26 (23.9)19 (19.0)45 (21.5)0.3941.335 (0.686–2.600)
      Note. *Bacteria including H.inluenzae, GAS, K.pneumonia and S.aureus.
    #Viruses including RSV, hMPV, HBoV, HCoV and AdV.

    Table S3.  Co-infections of bacterial and viral pathogens with H. influenzae according to age group

    There were no differences across sex between severe and mild case groups (11 vs. 96; P = 0.576). Children with severe cases infected with H. influenzae tended to be older than mild cases [median, 7 (IQR, 6–8) years vs. 4 (IQR, 3–6) years; P < 0.0001]. There was no difference in the peak of fever between the two groups [39.5 (IQR, 39.0–40.0) °C vs. 39.3 (IQR, 38.8–39.7) °C; P = 0.159]; however, the duration of fever in the severe case group was longer than that of the mild case group [7 (IQR, 4.5–10.0) d; P = 0.029]. There was no difference in the number of days of cough (P = 0.116) and rales (P = 0.912) between the two groups. The patients in the severe case group had a longer duration of hospitalization [9 (IQR, 7.5–12.0) d; P < 0.0001], a higher ratio of neutrophils [65.1 (IQR, 60.4%–70.4%); P = 0.005] and concentration of CRP [2.1 (IQR, 1.3–14.8) mg/L; P = 0.041], and lower ratio of lymphocytes [24.0 (IQR, 20.6%–30.3%); P = 0.010] than the mild case group. There was no difference in WBC count [7.6 (IQR, 6.4–8.8) ×109 cells/L vs. 7.8 (IQR, 5.7–11.5) × 109 cells/L; P = 0.360] or LDH concentration [249 (IQR, 218–304) U/L vs. 264 (IQR, 228–320) U/L; P = 0.505] between the two groups (Table 2).

    CharacteristicsSevere cases (n = 24)Mild cases (n = 185)P
    Demographic and clinical presentation
     Males, n (%)11 (45.8)96 (51.9)0.576
     Age (years), median (IQR)7 (6–8)4 (3–6) < 0.001
     Peak of fever (°C), median (IQR)39.5 (39.0–40.0)39.3 (38.8–39.7)0.159
     Duration of fever (d), median (IQR)7 (4.5–10.0)5 (3.5–7.0)0.029
     Cough (d), median (IQR)13 (6–20)10 (8–13)0.116
     Rales, n (%)13 (54.2)98 (53.0)0.912
    Clinical outcome
     Duration of hospitalization (d),
     median (IQR)
    9 (7.5–12.0)6 (5–7)< 0.001
    Laboratory data
     WBC (× 109cells/L), median (IQR)7.6 (6.4–8.8)7.8 (5.7–11.5)0.360
     Neutrophils (%), median (IQR)65.1 (60.4–70.4)59.2 (46.8–67.8)0.005
     Lymphocytes (%), median (IQR)24.0 (20.6–30.3)29.8 (21.6–41.9)0.010
     CRP (mg/L), median (IQR)2.1 (1.3–14.8)1.7 (0.5–7.0)0.041
     LDH (U/L), median (IQR)249 (218–304)264 (228–320)0.505

    Table 2.  Clinical features of hospitalized children infected with H. influenzae according to disease severity

    In a previous study of 156 children, 107 were positive for at least one pathogen, and 64 (41%) were infected with H. influenzae in Romania from June 2016 to May 2017[5]. Another study of 2,970 patients found 176 cases of H. influenzae and 49 H. influenzae co-infections in the German prospective cohort study CAPNETZ from October 2002 to July 2013[6]. H. influenzae is the dominant pathogen in UK adults with non-severe CAP and chronic lung disease[7]. In our study, 209 hospitalized children were infected with H. influenzae, but only 86 (41.1%) of those were singly infected with H. influenzae. We also examined 3 atypical pathogens, 5 bacterial pathogens, and 8 viral pathogens in these specimens, and our results show that M. pneumoniae (n = 221) and H. influenzae were the dominant pathogens. Regarding viral pathogens, 80 children were positive for hMPV and 22 children were positive for HBoV[8], with co-infection accounting for a higher proportion among these detected pathogens. This result indicates that co-infection is a common cause of pneumonia.

    A total of 8,571 invasive H. influenzae cases were reported in England and Wales during 2000–2013, but only 1,585 cases were aged between 1 month and 10 years old. Among 362 H. influenzae invasive isolates during 2009–2013, there were 214 NTHi, 25 Hib, and 52 non-type b H. influenzae (36 Hif, 14 Hie, 1 Hia, and 1 Hic) cases[9]. This result indicated that while NTHi was the dominant pathogen, other non-type b H. influenzae were also present, warranting surveillance in clinical cases. The bexA gene was used to determine the presence of a polysaccharide capsule, and the type of H. influenzae (a–f) was confirmed via PCR and slide agglutination test using capsule-specific primers and monovalent a–f antisera, respectively. NTHi should be PCR-negative for bexA and Hib-specific targets without a detectable capsule[9]. The previous study also confirmed that NTHi isolates lacked both bexA and capsule-specific genes[10]. In our study, we used the bexA gene as a target to screen for the prevalence of H. influenzae and confirmed positivity in 209 children. However, one limitation of our study is that we could not determine the serotypes of H. influenzae. Therefore, further studies are needed to determine the exact bacteriologic characteristics of these H. influenzae strains.

    Our results showed the prevalence of H. influenzae and M. pneumoniae is higher in hospitalized children with CAP in Chengde between 2017 and 2018, and these results indicate current pneumonia surveillance should focus not only on viral pathogens but should also establish a bacterial pathogen profile. Additionally, strengthening the surveillance of non-type b H. influenzae and NTHi in CAP would provide important information in controlling and preventing H. influenzae-associated CAP.

    The authors declare that they have no competing interests.

Funds:  This work was supported by National Natural Science Foundation of China [No. 81702008, 81702010]; Natural Science Foundation of Hebei Province [No.H2018406024]; Foundation for High-level Talents of Chengde Medical University [No. 201702]; Program of Shannxi Respiratory Project Center [No. 2017GCKF04]
These authors contributed equally to this work.
Reference (10)

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return