-
The study was approved by the Ethics Committee of Chinese PLA General Hospital. hUCMSCs were purchased from ScienCell Company (San Diego, CA, USA) and expanded in α-MEM (Hyclone, USA) containing 10% fetal bovine serum (FBS, Gibco, USA) and 10% penicillin/streptomycin (Invitrogen, USA) at 37 °C with 5% CO2. The hPDLSCs were cultured as previously described[7]. Periodontal ligaments were obtained from healthy premolars extracted due to orthodontics placement. Periodontal ligament tissues in the middle of the root were cut into 1 mm3 pieces, treated with type І collagenase (Sigma, USA) for 1 h, and then cultured in α-MEM containing 10% FBS and 1% penicillin/streptomycin. In osteogenic differentiation assays, the cells were cultured in osteogenic medium (α-MEM containing 10% FBS, 10 nmol/L dexamethasone, 50 μg/mL vitamin C, and 10 mmol/L β-glycerophosphate). According to previous studies, a 30 mmol/L D-glucose concentration was used to simulate HG conditions in vitro, and a 5.6 mmol/L D-glucose concentration was used as a control[23, 24].
-
The surface markers of hPDLSCs were detected using flow cytometry (BD Biosciences, USA). Antibodies against CD105-FITC, CD90-PE, CD73-FITC, CD44-PE, CD45-PE, CD34-FITC, CD31-FITC, and CD11b-PE were used in the analysis.
-
Exosomes were extracted using ultracentrifugation as described in our previous study[22]. Briefly, the culture medium was replaced with exosome-free FBS medium when the hUCMSCs reached 80%−90% confluence. After culturing for 48 h, the culture supernatant was harvested and centrifuged to remove dead cells. Subsequently, the supernatant was filtered through a 0.22 µm pore membrane and ultracentrifuged at 100,000 ×g for 90 min to obtain exosomes. Exosomes were identified using transmission electron microscopy (TEM, JEOL, Japan), Nanosight (Malvern, UK), and Western blot.
-
The exosomes were labeled with the red red fluorescent dye Dil (Beyotime, China) as described in our previous study and then cocultured with PDLSCs for 24 h. Subsequently, the cells were washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde and stained with DAPI (Solarbio, China). The uptake of exosomes by hPDLSCs was observed using laser scanning confocal microscopy.
-
The cells were divided into four groups for cell proliferation and differentiation assays: (i) control group, cells treated with 5.6 mmol/L D-glucose; (ii) HG group, cells treated with 30 mmol/L D-glucose; (iii) HG + 25 µg/mL exo group, cells treated with 30 mmol/L D-glucose and 25 µg/mL exosomes; (iiii) HG + 50 µg/mL exo group, cells treated with 30 mmol/L D-glucose and 50 µg/mL exosomes. The Cell Counting Kit-8 (CCK-8) assay was conducted to detect the proliferation of hPDLSCs on Days 1, 3, and 5 following the manufacturer’s instructions.
-
ALP staining and ALP activity were assessed as reported previously[22]. Briefly, after osteoinduction for 14 days, hPDLSCs were fixed with paraformaldehyde and stained with an ALP staining kit (Solarbio, China) for 30 min. ALP activity was detected with an ALP kit (Nanjing Jiancheng Biotech, Nanjing, China) following the manufacturer’s instructions.
-
ARS staining was conducted to assess mineral deposition in hPDLSCs after osteoinduction for 14 days. Cells were washed with PBS, fixed with paraformaldehyde and stained with an ARS solution (Solarbio, China) for 20 min following the manufacturer’s instructions.
-
qRT-PCR was performed as reported in our previous study[22]. Briefly, total RNA was extracted using TRIzol (Invitrogen, USA), and cDNAs were synthesized using a cDNA synthesis kit (Takara, Japan). Then, qRT-PCR was performed using an ABI Prism 7900 system with SYBR Master Mix (Takara, Japan). The primers used for qRT-PCR were referred to previous studies[6, 7, 25], and the sequences are shown in Table 1. β-actin was used as a reference gene for internal normalization.
Gene Forward (5’–3’) Reverse (5’–3’) ALP GTGAACCGCAACTGGTACTC GAGCTGCGTAGCGATGTCC OCN AGCAAAGGTGCAGCCTTTGT GCGCCTGGGTCTCTTCACT Runx2 CACTGGCGCTGCAACAAGA CATTCCGGAGCTCA
GCAGAATAβ-actin ATGCCAACACAGTGTTGTCTGG TACTCCTGCTTGCT
GATCCACATTable 1. Primers used for qRT-PCR
-
Western blot analyses were performed as reported in our previous study[22]. Antibodies used were: CD9 (Affinity, USA), CD63 (NOVUS, USA), TSG101 (Affinity, USA), ALP (Affinity, USA), Runx2 (Affinity, USA), OCN (Affinity, USA), OPN (Proteintech Group, USA), p-AKT (Cell Signaling Technology, USA), AKT (Affinity, USA), p-PI3K (Cell Signaling Technology, USA), PI3K (Cell Signaling Technology, USA), and β-actin (Boster Bioengineering Co., Wuhan, China). The results were normalized to β-actin.
-
The PI3K/AKT signaling inhibitor LY294002 and AKT inhibitor MK2206 was were used to investigate the role of the PI3K/AKT signaling pathway in the exosome-mediated osteogenic differentiation of hPDLSCs. The cells were divided into 5 groups: the control group (cells treated with 5.6 mmol/L D-glucose), HG group (cells treated with 30 mmol/L D-glucose), HG + exo group (cells treated with 30 mmol/L D-glucose and 50 µg/mL exosomes), and HG + exo + LY294002 group (cells treated with 30 mmol/L D-glucose, 50 µg/mL exosomes, and 10 µmol/L LY294002), and HG + exo + MK2206 group (cells treated with 30 mmol/L D-glucose, 50 µg/mL exosomes, and 1 µmol/L MK2206). CCK-8 assay, ALP staining, ARS staining, and Western blot analysis were conducted as described above.
-
All data are presented as the means ± standard deviations of at least 3 experiments per group. SPSS 19.0 software (Chicago, IL, USA) was used to analyze the data. One-way ANOVA, followed by Tukey’s multiple comparison test was used to analyze differences between groups, and P < 0.05 was considered statistically significant.
Exosomes Derived from Human Umbilical Cord Mesenchymal Stem Cells Enhance the Osteoblastic Differentiation of Periodontal Ligament Stem Cells Under High Glucose Conditions Through the PI3K/AKT Signaling Pathway
doi: 10.3967/bes2022.105
- Received Date: 2021-10-08
- Accepted Date: 2022-04-04
-
Key words:
- Exosomes /
- Human umbilical cord mesenchymal stem cell /
- Periodontal ligament stem cell /
- Osteogenic differentiation /
- High glucose /
- PI3K/AKT
Abstract:
Citation: | YANG Shuo, ZHU Biao, TIAN Xiao Yu, YU Han Ying, QIAO Bo, ZHAO Li Sheng, ZHANG Bin. Exosomes Derived from Human Umbilical Cord Mesenchymal Stem Cells Enhance the Osteoblastic Differentiation of Periodontal Ligament Stem Cells Under High Glucose Conditions Through the PI3K/AKT Signaling Pathway[J]. Biomedical and Environmental Sciences, 2022, 35(9): 811-820. doi: 10.3967/bes2022.105 |