-
2BS cells were purchased from the National Infrastructure of Cell Line Resource (Beijing, China), and authenticated and tested for mycoplasma contamination at the time of purchase. 2BS cells were cultured in minimum essential medium (MEM, Gibco, New York, USA) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin–streptomycin (Gibco). The cells were cultured in a humidified incubator with 5% CO2 at 37 °C.
-
Human serum specimens from young donors (aged 18–30 years, n = 30) and old donors (aged 70 years and older, n = 30) with no history of disease at the time of blood collection were obtained from hospital staff, medical students, and healthy individuals visiting the health screening center of Xuanwu Hospital (Beijing, China). Subsequently, the serum specimens were sterilized by filtration and stored at −80 °C. The use of human specimens was approved by the institutional review board. Table 1 provides the information on the donors.
Characteristic 20–29 years (n = 35) 40–49 years (n = 33) 60–69 years (n = 30) 80–89 years (n = 24) Gender Male (n) 11 15 16 11 Female (n) 24 18 14 13 Age Mean ± SEM 24.76 ± 1.72 45.04 ± 1.41 64.54 ± 1.53 86.44 ± 3.34 Min-Max 21–29 43–47 62–68 81–89 Table 1. Characteristics of donors in different ages
-
2BS cells were seeded. Two days after incubation, the medium was replaced with medium containing 10% human serum, and the cells were cultured for 4 days to assess the effects of human serum from donors of different ages. Before replacing the culture medium, the cells were washed three times with phosphate-buffered saline. To evaluate the effects of IGF-1 on human aging, the 2BS cells cultured with old-age serum (O-Serum, 70 years of age and older) were treated with the inhibitor of the IGF-1 receptor (IGF-1R) or 50 μmol/L linsitinib (MCE, New Jersey, USA) for 24 h. To examine the effects of IGF-1 on aging, the 2BS cells were treated with 50 μmol/L linsitinib for 24 h, followed by 50 ng/mL IGF-1 (Cell Signaling, Danvers, USA) for 30 min. To detect the expression levels of IGF-1 and POLD1 during the kinetics of DNA repair, the 2BS cells were pre-treated with 50 μmol/L cisplatin (MCE) for 24 h to induce DNA damage, followed by incubation with old-age serum for 4 days or 50 μmol/L linsitinib for 24 h.
-
Six male SAMP8 mice were purchased from the First Affiliated Hospital of Tianjin University of Traditional Chinese Medicine (Tianjin, China). They were divided into two groups according to age as follows: young group (2 months of age, n = 6) and old group (8 months of age, n = 6). All animal experiments were approved by the bioethics committee of Xuanwu Hospital of Capital Medical University and compiled with the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
-
Western blotting analysis was performed as described previously[18]. In brief, the proteins were extracted, and equal concentrations of protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Next, the proteins were transferred onto polyvinylidene membranes. The primary antibodies against POLD1 and IGF-1 were purchased from Abcam (Cambridge, UK), and the primary antibody against β-actin was purchased from Zhongshan Boil Tech Co. (Beijing, China). After washing, the membranes were incubated with horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG secondary antibodies. The Chemi-Doc XRS+ imaging system was used for the chemiluminescent detection of target proteins. Table 2 provides the information on the antibodies.
Protein Manufacturer Cat no. Primary antibodies IGF-1 Abclonal Technology
Co. /ChinaA0830 POLD1 Abcam/UK Ab186407 β-actin Zhongshan Boil Tech
Co. /ChinaTA-09 Secondary antibodies HRP-conjugated
anti-mouse IgGZhongshan Boil Tech
Co. /ChinaZB2305 HRP-conjugated
anti-rabbit IgGZhongshan Boil Tech
Co. /ChinaZB5301 Table 2. Antibodies used for Western blotting
-
Total RNA was extracted using TRIzol reagent and reverse-transcribed according to the manufacturer’s instructions[18]. Target genes were amplified using a SYBR green fluorescence kit (Thermo Scientific, New York, USA) and a Roche 480 cycler (Roche, Basel, Switzerland). Quantification was performed by the 2−ΔΔCt method[18]. Table 3 provides the information on the primers for the amplification of POLD1, IGF-1, and β-actin genes.
Gene Sequences β-actin Forward ACAGAGCCTCGCCTTTGC Reverse CCACCATCACGCCCTGG IGF-1 Forward TGCTTCCGGAGCTGTGATCT Reverse TCTGGGTCTTGGGCATGTC POLD1 Forward GCTCCGCTCCTACACGCTCAA Reverse GGTCTGGTCGTTCCCATTCTGC Table 3. Sequences used for quantitative real-time polymerase chain reaction
-
SA-β-Gal staining was performed using a senescence β-galactosidase staining kit (Beyotime, Beijing, China) according to the manufacturer’s instructions. Positive staining was evaluated after 12–16 h of incubation at 37 °C in a CO2-free atmosphere. The positively-stained cells from three different fields were counted, and the results were presented as the percentage of positive cells.
-
Blood specimens were collected from healthy individuals of different ages. The serum concentrations of IGF-1 and POLD1 were measured using the human IGF-1 ELISA (Mlbio, Shanghai, China) and human POLD1 ELISA (Mlbio), respectively.
-
The proliferative ability of 2BS cells was detected using the CCK-8 assay (Beyotime). 2BS cells were seeded in 96-well plates at a density of 3 × 103 cells/well in 100 μL of medium per well. After adhesion, the cells underwent different treatments. The medium was replaced with 100 μL of fresh medium containing 10 μL of CCK-8, and the plates were incubated for 1 h. The absorbance was measured at a wavelength of 450 nm using a microplate reader.
-
The DNA synthesis rate of 2BS cells was assessed using the EdU kit (Beyotime). The cells were seeded in 96-well plates. After adhesion, the cells underwent different treatments. Next, the cells were incubated with 10 mmol/L EdU for 2 h, followed by staining according to the manufacturer’s instructions[18]. The absorbance was measured at a wavelength of 370 nm using an enzyme immunoassay analyzer.
-
The pLenti-CMV-POLD1 virus, which overexpressed POLD1, and shRNA-POLD1 virus, which silenced POLD1, were transfected into 2BS cells. The pLenti-CMV-POLD1 and shRNA-POLD1 virus were purchased from GeneChem (Shanghai, China). The supernatant was removed after 16 h of incubation and replaced with fresh medium.
-
The comet assay (Trevigen, Gaithersburg, MD, USA) was performed to evaluate DNA damage as previously described[18]. In brief, the cells were treated with 50 μmol/L cisplatin for 24 h to induce DNA damage, followed by incubation with old-age serum or normal serum for 4 days to repair DNA. Next, 50 μmol/L linsitinib was added for 24 h to the cells cultured with old-age serum. The cells were digested into a single-cell suspension, and the cell suspension was combined with the low melting point agarose gel and loaded onto the slides. The slides were immersed in lysis solution for 1 h, followed by unwinding for 1 h at 4 °C. Electrophoresis was performed at 21 volts for 30 min in alkaline electrophoresis solution. After electrophoresis, the slides were washed with deionized water and then stained with SYBR gold reagent (1:10,000 dilution) for 30 min. The state of the cells was observed with a fluorescence microscope (OLYMPUS, Tokyo Japan).
-
Data were analyzed using GraphPad Prism 8.0 software (San Diego, USA). The Student’s t-test analyzed the difference between the two groups, and one-way analysis of variance analyzed the difference among three or more groups. Pearson’s chi squared test calculated the relationship between IGF-1 and POLD1. P < 0.05 was considered to indicate a statistically significant result.
HTML
Cell Lines and Cell Culture Conditions
Human Serum
Cell Culture Treatments
Animals
Western Blotting Analysis
RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)
Senescence-associated β-galactosidase (SA-β-Gal) Staining
Enzyme-linked Immunosorbent Assay (ELISA)
Cell Counting kit-8 (CCK-8) Assay
5-Ethynyl-2’-deoxyuridine. (EdU) Incorporation Assay
Lentivirus Transfection
Comet Assay
Statistical Analysis
22145Supplementary Materials.pdf |