Volume 35 Issue 11
Nov.  2022
Turn off MathJax
Article Contents

ZHU Rui Qing, SONG Le Quan, JIANG Lin, LIU Yu, ZHAO Li, WANG Hao Yu, ZHANG Jing, XU Xin Ping, DONG Ji, YAO Bin Wei, ZHAO Xue Long, WANG Hui, SHI Xu Liang, PENG Rui Yun. Transcriptome Sequencing of mRNA and lncRNA in Hippocampal Tissues of Rats under Microwave Exposure[J]. Biomedical and Environmental Sciences, 2022, 35(11): 1079-1084. doi: 10.3967/bes2022.137
Citation: ZHU Rui Qing, SONG Le Quan, JIANG Lin, LIU Yu, ZHAO Li, WANG Hao Yu, ZHANG Jing, XU Xin Ping, DONG Ji, YAO Bin Wei, ZHAO Xue Long, WANG Hui, SHI Xu Liang, PENG Rui Yun. Transcriptome Sequencing of mRNA and lncRNA in Hippocampal Tissues of Rats under Microwave Exposure[J]. Biomedical and Environmental Sciences, 2022, 35(11): 1079-1084. doi: 10.3967/bes2022.137

Transcriptome Sequencing of mRNA and lncRNA in Hippocampal Tissues of Rats under Microwave Exposure

doi: 10.3967/bes2022.137
More Information
  • Author Bio:

    ZHU Rui Qing, male, born in 1991, MA, majoring in neurobiological damage of electromagnetic radiation

    SONG Le Quan, male, born in 1997, PhD, majoring in neurobiological damage of electromagnetic radiation

    JIANG Lin, female, born in 1998, MA, majoring in electromagnetic radiation psychology and cognition

  • Corresponding author: WANG Hui, E-mail: wanghui597bj@163.com; SHI Xu Liang, E-mail: shixl163@163.com; PENG Rui Yun, E-mail: ruiyunpeng18@126.com Tel/Fax: 86-10-66931236
  • Received Date: 2022-06-16
  • Accepted Date: 2022-09-26
  • 加载中
  • [1] Wang H, Peng RY, Zhou HM, et al. Impairment of long-term potentiation induction is essential for the disruption of spatial memory after microwave exposure. Int J Radiat Biol, 2013; 89, 1100−7. doi:  10.3109/09553002.2013.817701
    [2] Zhu RQ, Wang H, Xu XP, et al. Effects of 1.5 and 4.3 GHz microwave radiation on cognitive function and hippocampal tissue structure in Wistar rats. Sci Rep, 2021; 11, 10061. doi:  10.1038/s41598-021-89348-4
    [3] Wang H, Tan SZ, Dong J, et al. iTRAQ quantitatively proteomic analysis of the hippocampus in a rat model of accumulative microwave-induced cognitive impairment. Environ Sci Pollut Res, 2019; 26, 17248−60. doi:  10.1007/s11356-019-04873-0
    [4] Wang H, Liu Y, Sun YB, et al. Changes in rat spatial learning and memory as well as serum exosome proteins after simultaneous exposure to 1.5 GHz and 4.3 GHz microwaves. Ecotoxicol Environ Saf, 2022; 243, 113983. doi:  10.1016/j.ecoenv.2022.113983
    [5] Ma NN, Tie C, Yu B, et al. Identifying lncRNA-miRNA-mRNA networks to investigate Alzheimer's disease pathogenesis and therapy strategy. Aging (Albany NY), 2020; 12, 2897−920.
    [6] Wang H, Peng RY, Zhao L, et al. The relationship between NMDA receptors and microwave-induced learning and memory impairment: a long-term observation on Wistar rats. Int J Radiat Biol, 2015; 91, 262−9. doi:  10.3109/09553002.2014.988893
    [7] Uehara A, Iwamoto T, Kita S, et al. Different cation sensitivities and binding site domains of Na+-Ca2+-K+ and Na+-Ca2+ exchangers. J Cell Physiol, 2005; 203, 420−8. doi:  10.1002/jcp.20231
    [8] Wang H, Zhang J, Hu SH, et al. Real-time microwave exposure induces calcium efflux in primary hippocampal neurons and primary cardiomyocytes. Biomed Environ Sci, 2018; 31, 561−71.
    [9] Belfort GM, Bakirtzi K, Kandror KV. Cellugyrin induces biogenesis of synaptic-like microvesicles in PC12 cells. J Biol Chem, 2005; 280, 7262−72. doi:  10.1074/jbc.M404851200
    [10] Wang H, Tan SZ, Xu XP, et al. Long term impairment of cognitive functions and alterations of NMDAR subunits after continuous microwave exposure. Physiol Behav, 2017; 181, 1−9. doi:  10.1016/j.physbeh.2017.08.022
  • 22212Supplementary Materials.pdf
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(6)  / Tables(6)

Article Metrics

Article views(821) PDF downloads(74) Cited by()

Proportional views
Related

Transcriptome Sequencing of mRNA and lncRNA in Hippocampal Tissues of Rats under Microwave Exposure

doi: 10.3967/bes2022.137
&These authors contributed equally to this work.
ZHU Rui Qing, SONG Le Quan, JIANG Lin, LIU Yu, ZHAO Li, WANG Hao Yu, ZHANG Jing, XU Xin Ping, DONG Ji, YAO Bin Wei, ZHAO Xue Long, WANG Hui, SHI Xu Liang, PENG Rui Yun. Transcriptome Sequencing of mRNA and lncRNA in Hippocampal Tissues of Rats under Microwave Exposure[J]. Biomedical and Environmental Sciences, 2022, 35(11): 1079-1084. doi: 10.3967/bes2022.137
Citation: ZHU Rui Qing, SONG Le Quan, JIANG Lin, LIU Yu, ZHAO Li, WANG Hao Yu, ZHANG Jing, XU Xin Ping, DONG Ji, YAO Bin Wei, ZHAO Xue Long, WANG Hui, SHI Xu Liang, PENG Rui Yun. Transcriptome Sequencing of mRNA and lncRNA in Hippocampal Tissues of Rats under Microwave Exposure[J]. Biomedical and Environmental Sciences, 2022, 35(11): 1079-1084. doi: 10.3967/bes2022.137
  • Microwave-related devices are commonly used. A certain dose of microwave might induce cognitive injuries[1]. The frequency of mobile 4G communication and wireless networks is located in the L-band and C-band range, respectively. We found that the accumulative exposure group, exposed to 1.5 GHz and 4.3 GHz microwaves, was more severely damaged than the single exposure group, indicated by prolonged average escape latency and structural damage to the hippocampus[2].

    The proteomic analysis of the hippocampus in the accumulative microwave exposure was discussed in our previous work[3]. However, whole-transcriptome sequencing, especially of messenger RNAs (mRNAs) and long non-coding RNAs (lncRNAs), for identifying sensitive markers of microwave-induced brain changes has not been reported.

    Sixteen male Wistar rats 200 ± 20 g were divided into four groups. The groups, microwave exposure methods, and specific absorption rate (SAR) values are shown in Supplementary Table S1 (available in www.besjournal.com). All experiments were designed and reported according to the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. Details of microwave exposure systems have been given in previous studies [4].

    GroupAverage power density of
    L-band microwaves
    Average power density of
    C-band microwaves
    SAR (W/kg)
    S*0 mW/cm20 mW/cm20
    L1010 mW/cm2 for 6 min0 mW/cm23.7
    C100 mW/cm210 mW/cm2 for 6 min3.3
    LC10#10 mW/cm2 for 6 min10 mW/cm2 for 6 min3.7 for 6 min + 3.3 for 6 min
      Note. *The rats in the sham radiation group were placed in polypropylene cages and placed on the radiation table for 6 min without microwave exposure. #The rats in the LC10 groups were first radiated with L-band microwave radiation for 6 min and then immediately radiated with C-band microwave radiation for 6 min. The sham group and exposure group. The sham group and exposure groups adopt the same settings, and the sham group did not give microwave exposure. The experiment of the sham group and exposure groups were not conducted in parallel.

    Table S1.  Experimental groups and exposure to microwave radiation

    At 6 h after accumulative exposure, hippocampal samples were extracted, and transcriptome sequencing was performed following the recommended protocol. The remaining RNA of each sample after sequencing was used for qRT-PCR. Supplementary Table S2 (available in www.besjournal.com) shows the primer sequences used in the qRT-PCR.

    Transcripts and gene namesPrimer sequences
    MSTRG.1068.1 (NA)Forward (F)CTCGGGAGAAAGGGTATGTGAG
    Reverse (R)TGGTGAGCGGGCATTTTAG
    ENSRNOT00000002044 (Napa)Forward (F)TGAAGGAGTGGGTGCAATGT
    Reverse (R)ATAAATGGCGGGGTGAAGG
    MSTRG.27033.1 (Slc24a2)Forward (F)GTGTGTGTGTGTGTTCAAGGAATAA
    Reverse (R)AGCAAGCCAGTCCCTATTAAGAAA
    ENSRNOT00000083373 (Slc24a2)Forward (F)GTCCACACCCAGTCCACCTT
    Reverse (R)GGCATCAAACCCTATCAAATCTTC
    MSTRG.31953.1 (Pdgfb)Forward (F)AGACGCTTGGAGTAGAGACAGGA
    Reverse (R)TACGTGAGTCTGGGAGGGGTAG
    ENSRNOT00000023196 (Pdgfb)Forward (F)GAATACTTTCAGGCAGGCTAGGG
    Reverse (R)AAGGGACAGGGAGAGATGAGTG
    ENSRNOT00000023066 (Syngr1)Forward (F)TGTCAAGGACCGCAAGAAAG
    Reverse (R)CAGAAACCCACGAACCAGAAG
    MSTRG.35922.1 (Dlgap1)Forward (F)GCACCATCGCTCACAGACA
    Reverse (R)CCTTGTAAACCCCTCCTCCAC
    ENSRNOT00000022351 (Dlgap1)Forward (F)TCACCAAAGTTCCGCTCCA
    Reverse (R)CTGTCCGTTCACCTCCATCTC

    Table S2.  Primer sequences of differentially expressed lncRNAs and mRNAs

    Data were presented as mean and standard deviation. The data were subjected to two-way analysis variance using the software SPSS version 19. Differences at P < 0.05 were considered to be significant.

    The mRNAs exhibiting significant differences in expression between the two groups were counted and are shown in Supplementary Figure S1 (available in www.besjournal.com). Compared to the S group, 714 mRNAs were upregulated, and 1,069 mRNAs were downregulated in the L10 group. In the C10 group, 1,119 mRNAs were upregulated, and 2,076 were downregulated. In the LC10 group, 923 mRNAs were upregulated, and 2,129 were downregulated.

    Figure S1.  Differentially expressed mRNAs in the sham and microwave exposure groups.

    Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyzes were performed to search for possible biological processes related to cognitive changes. Following the GO functional enrichment analysis, the distribution of differentially expressed mRNAs in various biological processes, cellular components, and molecular functions was determined in the exposure groups relative to the S group. For the biological processes, differentially expressed mRNAs in the three exposure groups were mainly associated with positive regulation of transcription by RNA polymerase II, negative regulation of transcription by RNA polymerase II, transmembrane transport, ion transport, and brain development (Figure 1A, 1B, and 1C). Differential expression of mRNAs induced by microwave exposure was mainly located in the membrane, nucleus, cytoplasm, and mitochondrion (Figure 1A, 1B, and 1C). The molecular functions of differentially expressed mRNAs included nucleic acid binding, protein binding, and ion channel activity (Figure 1A, 1B, and 1C). KEGG pathway analysis suggested that glutamatergic synapse, mitogen-activated protein kinase signaling pathway, cAMP signaling pathway, and RNA degradation were involved in the differential expression of mRNAs in the S group and exposure groups (Figure 2A, 2B, and 2C). The biological processes, cellular components, molecular functions, and KEGG pathways between the LC10 group and L10 group are shown in Figures 1D and 2D. Figures 1E and 2E show the GO analysis and KEGG pathways of differentially expressed mRNAs between the LC10 and C10 groups. The differentially expressed mRNAs between the L10 and C10 groups were analyzed and are shown in Figures 1F and 2F.

    Figure 1.  GO analysis of differentially expressed mRNAs in the sham and microwave exposure groups. A: biological processes (BP), cellular components (CC), and molecular functions (MF) in L10 vs. S; B: biological processes, cellular components, and molecular functions in C10 vs. S; C: biological processes, cellular components, and molecular functions in LC10 vs. S; D: biological processes, cellular components, and molecular functions in LC10 vs. L10; E: biological processes, cellular components, and molecular functions in LC10 vs. C10; F: biological processes, cellular components, and molecular functions in L10 vs. C10.

    Figure 2.  KEGG pathway analysis of differentially expressed mRNAs in the sham and microwave exposure groups. A: KEGG pathways in L10 vs. S; B: KEGG pathways in C10 vs. S; C: KEGG pathways in LC10 vs. S; D: KEGG pathways in LC10 vs. L10; E: KEGG pathways in LC10 vs. C10; F: KEGG pathways in L10 vs. C10.

    Relative to the S group, more than 1,400 differentially expressed lncRNAs were found in each exposure group (Supplementary Figure S2 available in www.besjournal.com).

    Figure S2.  Differentially expressed lncRNAs in the sham and microwave exposure groups.

    Relative to the S group, there were two predicted target genes of differentially expressed lncRNAs in the L10 group connected with cognitive functions. The biological processes mainly included synaptic plasticity and calcium ion transport. The cellular components were located in the synapse and the membrane. Molecular functions focused on syntaxin binding and calcium-dependent protein binding (Supplementary Table S3 available in www.besjournal.com).

    GroupsmRNA
    (transcripts, genes)
    lncRNA
    (transcripts, genes)
    BPCCMF
    L10 vs. SENSRNOT00000000117,
    Cplx2
    MSTRG.14373.2,
    Cplx2
    neurotransmitter transport, synaptic vesicle exocytosis, positive regulation of synaptic plasticity, regulation of neurotransmitter secretion and et al.Dendrite, SNARE complex, mast cell granule, neuronal cell body, terminal bouton, synapse, and et al.SNARE binding, syntaxin-1 binding, syntaxin binding, calcium-dependent protein binding
    ENSRNOT00000083373,
    Slc24a2
    MSTRG.27033.1,
    Slc24a2
    calcium ion transport, cellular calcium ion homeostasis, learning, memory, long-term synaptic potentiation, long term synaptic depression, calcium ion transmembrane transportintegral component of plasma membrane, membrane, integral component of membrane, intrinsic component of plasma membranecalcium channel activity, calcium, potassium: sodium antiporter activity, symporter activity, antiporter activity, protein dimerization activity
    C10 vs. SENSRNOT00000002044,
    Napa
    MSTRG.1068.1brain development, regulation of synaptic protein transport, vesicle-mediated transport, neuron differentiation, glutamatergic, SNARE complex disassemblySNARE complex, terminal bouton, myelin sheath, synaptobrevin 2-SNAP-25-syntaxin-1a complex, presynapse, postsynapse and et al.SNARE binding, syntaxin binding, protein-containing complex binding
    ENSRNOT00000072973,
    Vbp1
    MSTRG.2384.1protein folding, microtubule-based process, tubulin complex assemblyCytoplasm, polysome, prefoldin complextubulin binding
    ENSRNOT00000031230,
    ENSRNOT00000084012,
    Agap2
    MSTRG.31244.1positive regulation of phosphatidylinositol 3-kinase signaling, negative regulation of apoptotic process, negative regulation of neuron apoptotic process and et al.Nucleus, nucleolus, cytoplasm, mitochondrion, cytosolGTPase activity, GTPase activator activity, protein binding, GTP binding, metal ion binding and et al.
    ENSRNOT00000023196,
    Pdgfb
    MSTRG.31953.1,
    Pdgfb
    positive regulation of MAPK cascade, positive regulation of ERK1 and ERK2 cascade, positive regulation of calcium ion import and et al.Intracellular, membranegrowth factor activity, superoxide-generating NADPH oxidase activator activity, identical protein binding and et al.
    ENSRNOT00000073079,
    Tbcc
    MSTRG.34726.1,
    Bicral
    cell morphogenesis, protein folding, tubulin complex assembly, post-chaperonin tubulin folding pathwayCytoplasm, cytosol, photoreceptor connecting ciliumnucleotide binding, GTPase activity, GTP binding, tubulin binding
    ENSRNOT00000022351,
    Dlgap1
    MSTRG.35922.1,
    Dlgap1
    chemical synaptic transmission, signaling, protein localization to synapse, regulation of proteasomal protein catabolic process, maintenance of postsynaptic density structure and et al.postsynaptic density, synapse, postsynaptic membrane, glutamatergic synapse, postsynaptic density, intracellular component and et al.protein binding, protein domain specific binding, protein-containing complex binding, structural constituent of postsynaptic density
    C10 vs. SENSRNOT00000012533,
    Ccdc47
    MSTRG.6501.2,
    Limd2
    ER overload response, endoplasmic reticulum organization, post-embryonic development, ubiquitin-dependent ERAD pathway, calcium ion homeostasisendoplasmic reticulum, rough endoplasmic reticulum, membrane, integral component of membrane)calcium ion binding
    ENSRNOT00000002906,
    Atg3
    MSTRG.7482.1autophagosome assembly, autophagy of mitochondrion, autophagy, macroautophagycytoplasmic ubiquitin ligase complex, cytoplasm, cytosoltransferase activity, Atg8 ligase activity, Atg12 transferase activity, ubiquitin-like protein transferase activity, enzyme binding
    LC10 vs. SENSRNOT00000023066,
    Syngr1
    MSTRG.31953.1,
    Pdgfb
    regulation of long-term neuronal synaptic plasticity, regulation of short-term neuronal synaptic plasticity, synaptic vesicle membrane organization and et al.synaptic vesicle, membrane, integral component of synaptic vesicle membrane, synaptic vesicle membrane, cytoplasmic vesicle, synapse and et al.
    ENSRNOT00000023196,
    Pdgfb
    MSTRG.31953.1,
    Pdgfb
    positive regulation of MAP kinase activity, positive regulation of calcium ion import, positive regulation of reactive oxygen species metabolic process and et al.Intracellular, membraneidentical protein binding, protein homodimerization activity, protein heterodimerization activity, platelet-derived growth factor binding
    ENSRNOT00000010827,
    Slc24a2
    MSTRG.27033,
    Slc24a2
    calcium ion transport, cellular calcium ion homeostasis, learning, memory, long-term synaptic potentiation, long term synaptic depression and et al.integral component of plasma membrane, membrane, integral component of membrane, intrinsic component of plasma membranecalcium channel activity, calcium, potassium: sodium antiporter activity, and et al.
    ENSRNOT00000018190,
    Rala
    MSTRG.14864.1Ras protein signal transduction, exocytosis, regulation of exocytosis and et al.cell surface, membrane, cleavage furrow, myelin sheath, Flemming bodyGTPase activity, protein tyrosine kinase activity, GTP binding, myosin binding, GDP binding, ATPase binding
    ENSRNOT00000019340,
    Rap2b
    MSTRG.19020.1,
    MSTRG.19019.1
    Rap protein signal transduction and et al.bicellular tight junction, membrane, recycling endosome, extracellular exosomenucleotide binding, GTP binding, GDP binding, protein domain specific binding
    LC10 vs. L10NoneNoneNoneNoneNone
    LC10 vs. C10NoneNoneNoneNoneNone
    L10 vs. C10ENSRNOT00000043627,
    Map2
    MSTRG.35424.1Axonogenesis, microtubule binding, dendrite development, central nervous system neuron development, establishment of cell polarity, negative regulation of axon extension, neuron projection development, dendrite morphogenesis, regulation of axonogenesisMicrotubule, postsynaptic density, dendrite, nuclear periphery, axon initial segment, dendritic shaft, axon hillock, cell body, CA3 pyramidal cell dendrite, proximal neuron projectiondystroglycan binding, tubulin binding

    Table S3.  GO analysis of differentially expressed lncRNAs and corresponding mRNAs after microwave exposure

    The differentially expressed target mRNAs and lncRNAs in the C10 group were analyzed relative to those of the S group. The biological processes included brain development and tubulin complex assembly. The cellular components were located in the SNARE complex and synapse. Molecular functions focused on SNARE binding, syntaxin binding, and tubulin binding (Supplementary Table S3).

    The differentially expressed target mRNAs and lncRNAs in the LC10 were compared with those of the S group. The biological processes focused on synaptic plasticity and calcium ion import. The cellular components were located in synapses and membranes. The molecular functions included calcium channel activity and GTPase activity (Supplementary Table S3).

    When comparing the LC10 group with the L10 group or the C10 group, there were no cognitively connected differentially expressed lncRNAs and targeted mRNAs. When comparing the L10 group with the C10 group, only one cognitively connected differentially expressed lncRNAs was found (Supplementary Table S3). The KEGG pathways of the differentially expressed lncRNAs connected to the cognitive functions in the exposure groups mainly included the synaptic vesicle cycle and glutamatergic synapse (Supplementary Table S4 available in www.besjournal.com).

    GroupsmRNA
    (transcripts, genes)
    lncRNA
    (transcripts,genes)
    KEGG pathways
    L10 vs. SENSRNOT00000000117, Cplx2MSTRG.14373.2, Cplx2Synaptic vesicle cycle
    C10 vs. SENSRNOT00000002044, NapaMSTRG.1068.1Synaptic vesicle cycle
    ENSRNOT00000031230, Agap2MSTRG.31244.1FoxO signaling pathway, Endocytosis
    ENSRNOT00000084012, Agap2MSTRG.31244.1FoxO signaling pathway, Endocytosis
    ENSRNOT00000022351, Dlgap1MSTRG.35922.1, Dlgap1Glutamatergic synapse
    LC10 vs. SENSRNOT00000023196, PdgfbMSTRG.31953.1, PdgfbMAPK signaling pathway, Ras signaling pathway, Rap1 signaling pathway, PI3K-Akt signaling pathway, and et al.
    ENSRNOT00000018190, RalaMSTRG.14864.1Ras signaling pathway, Rap1 signaling pathway and et al.
    LC10 vs. L10NoneNoneNone
    LC10 vs. C10NoneNoneNone
    L10 vs. C10NoneNoneNone

    Table S4.  KEGG pathways of differentially expressed lncRNAs and corresponding mRNAs after microwave exposure

    From combined GO enrichment and KEGG pathway analyzes, five-pair genes were selected for the following validation related to the cognitive changes. The genes, their transcripts, and the fold difference between groups are shown in Supplementary Table S5 (available in www.besjournal.com). The qRT-PCR was used to verify the sequencing results. Compared with that of the S group, the expression level of lncRNA (MSTRG.1068.1) decreased only in the C10 group, but the level of expression of mRNA (ENSRNOT00000002044) did not significantly change, which was not consistent with the sequencing data (Figure 3A). Compared with that of the S group, the level of expression of lncRNA (MSTRG. 27033.1) increased significantly in the C10 and LC10 groups, and the level of expression of mRNA (ENSRNOT00000083373) decreased in the L10, C10, and LC10 groups, which was consistent with the sequencing data (Figure 3B). The lncRNA (MSTRG.31953.1) was targeted with two mRNAs (ENSRNT00000023196 and ENSRNOT000000023066). The qRT-PCR results of lncRNA (MSTRG.31953.1) and mRNAs (ENSRNT00000023196 and ENSRNOT000000023066) showed a decrease in their expression in the L10, C10, and LC10 groups, which was consistent with the sequencing data (Figure 3C). Only mRNA (ENSRNOT00000022351) decreased in the LC10 group. The lncRNA (MSTRG. 35922.1) and mRNA (ENSRNOT00000022351) validation results were not consistent with the sequencing results (Figure 3D). Statistical analysis results are shown in Supplementary Table S6 (available in www.besjournal.com). The results indicated that the lncRNAs (Slc24a2 and Pdgfb) and mRNAs (Slc24a2, Pdgfb, and Syngr1) might be sensitive genes of microwave exposure, which should be considered for future study.

    Figure 3.  Validation data of the selected genes using qRT-PCR. A: qRT-PCR results of lncRNA (MSTRG.1068.1) and its target mRNA; B: qRT-PCR results of lncRNA (MSTRG.27033.1) and its target mRNA; C: qRT-PCR results of lncRNA (MSTRG.31953.1) and its target mRNA; D: qRT-PCR results of lncRNA (MSTRG.35922.1) and its target mRNA. Compared with the S group, *P < 0.05 and **P < 0.01.

    lncRNAmRNA
    transcriptsgeneslog2 (FC)
    L10 vs. S
    log2 (FC)
    C10 vs. S
    log2 (FC)
    LC10 vs. S
    transcriptsgeneslog2 (FC)
    L10 vs. S
    log2 (FC)
    C10 vs. S
    log2 (FC)
    LC10 vs. S
    MSTRG.1068.1NA−0.4−0.46−0.69ENSRNOT00000002044Napa−0.17−0.28−0.2
    MSTRG.27033.1Slc24a20.430.380.61ENSRNOT00000083373Slc24a2−0.36−0.66−0.47
    MSTRG.31953.1Pdgfb−0.52−0.73−0.84ENSRNOT00000023196Pdgfb−0.2−0.32−0.29
    MSTRG.31953.1Pdgfb−0.52−0.73−0.84ENSRNOT00000023066Syngr10.31−1.01−1.68
    MSTRG.35922.1Dlgap10.050.450.42ENSRNOT00000022351Dlgap1−0.24−0.33−0.17
      Note. NA meant not available in the datebase.

    Table S5.  Differential genes for validation after microwave exposure

    Recently, lncRNAs have attracted much attention due to their roles in transcriptional, post-transcriptional, and epigenetic networks and in certain physiological and pathological processes. Many lncRNAs are expressed in the central nervous system and play an important role in regulating neural functions such as central nervous system development, synaptic plasticity, and stress response. Changes in the expression levels of specific lncRNAs have been reported[5]. Through the mRNA and lncRNA analyzes, we found that brain development might be the main biological process. The glutamatergic synapse and synaptic vesicle cycle should be considered important pathways for microwave radiation studies. Previous studies have also indicated the important roles of glutamate and glutamatergic synapse in microwave-induced hippocampal injuries[6].

    Slc24a2, also named NCKX2, plays a role in the calcium ion transmembrane transport[7]. We have previously reported calcium efflux during microwave exposure in primary hippocampal neurons[8]. The NCKX is another possible reason for microwave-induced calcium changes, which should be given potential attention in future studies.

    The lncRNA Pdgfb was targeted to two mRNAs (Pdgfb and Syngr1). The mRNA of Pdgfb plays an essential role in the regulation of embryonic development and cell proliferation. The mRNA of Syngr1 probably plays a role in synaptic-like microvesicle formation and/or maturation[9]. An abnormal number of synaptic vesicles were found in transmission electron microscope pictures of the hippocampus after microwave exposure[10].

    In conclusion, exposure to microwaves might affect the biological processes of brain development and ion transport, KEGG pathways of the glutamatergic synapse, and synaptic vesicle cycle, thereby inducing neurological impairment. Exposure to microwaves causes differential expression of lncRNAs (Slc24a2 and Pdgfb) and mRNAs (Slc24a2, Pdgfb, and Syngr1). The response of differentially expressed RNAs in body fluid samples should be further explored.

    Differential geneComparisonSignificantly different?F valueP value
    MSTRG.1068.1L-band main effectNoF (1,12) = 1.6810.204
    C-band main effectNoF (1,12) = 4.1070.051
    Interaction effectNoF (1,12) = 0.7990.378
    S vs. L10No0.133
    S vs. C10Yes0.048
    S vs. LC10No0.194
    ENSRNOT00000002044L-band main effectNoF (1,12) = 0.2400.628
    C-band main effectNoF (1,12) = 1.5330.225
    Interaction effectNoF (1,12) = 1.3040.262
    S vs. L10No0.684
    S vs. C10No0.946
    S vs. LC10No0.231
    MSTRG. 27033.1L-band main effectNoF (1,12) = 0.0350.853
    C-band main effectYesF (1,12) = 10.0110.004
    Interaction effectNoF (1,12) = 0.9180.358
    S vs. L10No0.577
    S vs. C10Yes0.010
    S vs. LC10Yes0.016
    ENSRNOT00000083373L-band main effectYesF (1,12) = 4.5920.040
    C-band main effectNoF (1,12) = 3.2110.083
    Interaction effectNoF (1,12) = 1.670.206
    S vs. L10Yes0.018
    S vs. C10No0.043
    S vs. LC10Yes0.007
    MSTRG.31953.1L-band main effectYesF (1,12) = 10.3070.004
    C-band main effectYesF (1,12) = 46.1860.000
    Interaction effectNoF (1,12) = 2.8770.102
    S vs. L10Yes0.002
    S vs. C10Yes0.000
    S vs. LC10Yes0.000
    ENSRNT00000023196L-band main effectNoF (1,12) = 3.6010.067
    C-band main effectYesF (1,12) = 4.3260.046
    Interaction effectNoF (1,12) = 1.3910.248
    S vs. L10Yes0.032
    S vs. C10Yes0.033
    S vs. LC10Yes0.007
    ENSRNOT000000023066L-band main effectYesF (1,12) = 5.5450.025
    C-band main effectNoF (1,12) = 3.2440.081
    Interaction effectNoF (1,12) = 2.90.099
    S vs. L10Yes0.007
    S vs. C10Yes0.021
    S vs. LC10Yes0.006
    MSTRG. 35922.1L-band main effectNoF (1,12) = 2.3660.134
    C-band main effectNoF (1,12) = 0.3950.534
    Interaction effectNoF (1,12) = 0.0870.770
    S vs. L10No0.204
    S vs. C10No0.519
    S vs. LC10No0.135
    ENSRNOT00000022351L-band main effectNoF (1,12) = 3.7090.065
    C-band main effectYesF (1,12) = 23.210.000
    Interaction effectNoF (1,12) = 4.1420.052
    S vs. L10No0.932
    S vs. C10No0.060
    S vs. LC10Yes0.000

    Table S6.  Statistical analysis of differential gene validation results

&These authors contributed equally to this work.
Reference (10)
Supplements:
22212Supplementary Materials.pdf

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return