-
Male wild-type (WT) Sprague Dawley rats (180–200 g, 6–8 weeks old) were supplied by the Laboratory Animal Center of Health Science Center, Peking University. Male knockout rats (C6orf120-/-; 180–200 g, 6–8 weeks old) were provided by Guangzhou Saiye Biotechnology Co., Ltd., using TALEN-mediated gene knockout technology. This technique can cause a partial base-shift mutation in the C6orf120 gene, making the transcriptional translation of the C6ORF120 protein unsuccessful[14]. To verify the reliability of the knockout, we obtained tissues from the tail from WT and C6orf120-/- rats for gene identification. Both WT and C6orf120-/- rats were kept in a pathogen-free environment (3 rats/cage, 21 ± 2 °C, 50% relative humidity, 12/12 h daytime/nighttime artificial light cycle, and water and food at all times) at the Laboratory Animal Center of Health Science Center, Peking University.
To establish an experimental AIH model in rats induced by Con A, WT and C6orf120-/- rats aged 6–8 weeks were randomly divided into two groups; the control group was administered saline via tail-vein injection and the experimental group was administered Con A dissolved in saline (16 mg/kg) (Sigma, Aldrich, USA). After 24 h, the rats were euthanized, and the liver, spleen, and inferior vena cava blood were collected for further studies. All animal experiments followed the NIH Guide for the Care and Use of Laboratory Animals[15].
-
PCR and gene sequencing were used to identify the rat genotypes. DNA was extracted from the rat tails using an animal tissue DNA extraction kit (Invitrogen, MA, USA). Subsequently, the DNA was amplified using PCR. The specific amplification method was as follows: initial 95 °C for 5 min, 40 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; the termination step was 72 °C for 1 min. The specific primer sequences for C6orf120 are Forward: 5′-AGCACCTCCGGTCAAGTCTGTCAC-3′ and Reverse: 3′-GTCGGACACATACAGGTCCGCA-5′. The final amplified DNA sequences of WT and C6orf120-/- rats were compared to identify specific and complete knockouts of the C6orf120 gene.
-
Serum from the peripheral veins of patients with AIH (n = 15) and healthy volunteers (n = 15) was collected at Beijing Ditan Hospital. All procedures were carried out under the supervision of the Ethics Committee of Beijing Ditan Hospital, Capital Medical University.
-
A human C6ORF120 ELISA kit purchased from Mlbio (Shanghai, China) was used to detect C6ORF120 protein levels in the serum of patients with AIH and healthy individuals. All operations were performed according to the instruction manual.
-
Whole blood samples from the inferior vena cava were obtained and centrifuged at 3,000 rpm at 4 °C for 10 min to obtain serum samples. ALT and AST levels in the rat serum were measured using a HITACHI instrument according to the method standards provided by the manufacturer.
-
After euthanizing the rats, the liver tissue was fixed in 4% paraformaldehyde. After dehydration and paraffin embedding, the liver tissue was cut into 4-µm thick sections to stain for H&E. Photographs were acquired under a microscope (Zeiss AG, Germany).
-
The degree of liver damage was assessed using the Ishak score[16]. Liver pathology is mainly assessed based on three major aspects: necrotic area (0 for no necrosis, 1 for < 10% of hepatic parenchyma necrosis, 2 for 10%–25%, and 3 for > 25%), lobular inflammation (0 for no inflammation, 1 for < 10% of hepatic parenchyma inflammation, 2 for 10%–50%, and 3 for > 50%), and portal inflammation (0 for no inflammation, 1 for < 1/3 of the area, 2 for 1/3–1/2 of the area, and 3 for > 1/2 of the area), with the overall score being the Tissue Inflammation Score. The pathology score for the extent of liver injury was assessed by two independent authors (Hui Liu and Yingying Lin) who are well-trained and were blinded to group allocation.
-
THP-1 cells were obtained from Wuhan Procell Technology Co. and cultured in Dulbecco's Modified Eagle Medium (DMEM), containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. Cells were grown in a 37 °C incubator with 5% CO2. Phorbol 12-myristate 13-acetate (PMA) (100 ng/mL), lipopolysaccharide (LPS) (100 ng/mL), gamma interferon γ (INF-γ) (20 ng/mL), interleukin 13 (IL13) (20 ng/mL), interleukin 4 (IL4) (20 ng/mL), and rC6ORF120 (Cusabio, Wuhan, China) were used to stimulate THP-1 cells.
-
THP-1 cells were equally inoculated in 12-well plates, and PMA (100 ng/mL) was added to stabilize the cells to adhere to the wall and become mature M0 macrophages. The siRNA was synthesized by Shanghai GenePharma Technology Co. The sequence of the RNA targeting the C6orf120 gene (siC6orf120) is 5′-GCGAGUUCGAGAUGAAGGUTT-3′, and the non-specific RNA sequence is 5′-UUCUCCGAACGUGUCACGUTT-3′. The siRNA expression vectors were transfected into THP-1 cells using Lipofectamine 3000 (Invitrogen, MA, USA).
-
Tissues obtained from rats were lysed using RIPA lysis buffer (Gene-protein link, Beijing, China). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate proteins extracted from the liver or spleen tissues. The proteins were then transferred wet onto polyvinylidene fluoride membranes (PVDF membranes). After blocking with 5% skimmed milk, the following primary antibodies were incubated with membranes overnight at 4 °C: C6ORF120 (bs-9354R; Bioss, Beijing, China; 1:500 dilution), CD206 (18704-1-AP; Proteintech Group, Chicago, IL, USA; 1:1,000 dilution), and CD86 (bs-1035R; Bioss; 1:500 dilution). The strips were then incubated with a secondary immunoglobulin antibody on a shaker at room temperature for 1 h. Finally, the target strips were detected using chemiluminescence.
-
Total RNA was extracted from tissues and cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and tested for RNA concentration and purity using a spectrophotometer. The RNA was reverse-transcribed into cDNA using the PrimeScriptTM RT reagent Kit (RR037A; TaKaRa, Shiga, Japan) according to the manufacturer's instructions, and the RNA was extracted using the Power SYBR Green Master Mix (Applied Biosystems, Thermo Fisher Scientific). RT-qPCR was performed using a standard protocol. GAPDH was used as the reference and all data were analyzed according to 2-ΔΔCT. All primer sequences are listed in Table 1.
Gene (ID) Species Forward (5‘-3’) Reverse (5‘-3’) GAPDH Rat GGCATCGTGGAAGGGCTCAT CGTCGGGTCTTGTAGTAGGGA TNF-α Rat GCGATGTGGAACTGGCAGAGG GAGAAGAGTAAGGACGAGCACCG IL-1β Rat ATCTCACAGCAGCATCTCGACAAG CCTACTACTGCTGGACGATCACAC IL-6 Rat TTCCAGCCAGTTGCCTTCTT GTGAAGTGTTCAGCCTCCGAA ARG1 Rat CCAAGCCAAAGCCCATAGAGAT ACCAGGCCAGCTTTCCTTAAT IL-10 Rat GAAGGACCAGCTGGACAACA GGGGCATCACTTCTACCAGG GAPDH Human AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC CCL1 Human CTCATTTGCGGAGCAAGAGAT GCCTCTGAACCCATCCAACTG IL6 Human TGGCAGAAAACAACCTGAACC GGCTTGTTCCTCACTACTCTCA IL10 Human GGCATCTACAAAGCCATGAGTG TTTCTCAAGGGGCTGGGTCA CD206 Human GGGACGTGGCTGTGGATAAA TCCAAAACCCAGAAGACGCA TNF-α Human TGCACTTTGGAGTGATCGGC ACTCGGGGTTCGAGAAGATG CD80 Human TTGGTGCTGGCTGGTCTTTC TGCCAGTAGATGCGAGTTTGT Table 1. Primer sequence for RT-qPCR
-
When liver tissue was obtained from rats in vivo, phosphate-buffered saline-BSA-EDTA buffer (PBEB) was injected via the hepatic portal vein to remove intrahepatic red blood cells. The hepatocyte suspension was then passed through a 40-µm cell filter (BD, NJ, USA). The filtered cell suspension was resuspended in 15 mL of PBEB and centrifuged at 50 g, 4 °C for 3 min to remove the hepatic parenchymal cells. The supernatant was collected and centrifuged at 1,200 rpm, 4 °C for 5 min. The cells were resuspended in 40% Percoll and slowly added to the upper layer containing 4 mL of 80% Percoll and centrifuged at 450 g (acceleration 9, brake 1), 4 °C for 20 min. The intermediate cell layer was collected to prepare a cell suspension for flow analysis.
After obtaining the spleen tissue, a spleen cell suspension was prepared in PBEB to which 4 mL of erythrocyte lysis solution was added, mixed, and allowed to stand for 10 min to fully lyse the erythrocytes. The lysis process was terminated by adding 2 mL of pre-cooled PBEB buffer. Then the mixture was centrifuged at 1,200 rpm, 4 °C was performed for 5 min and the lower cell layer was obtained, dissolved in PBEB, and filtered for flow cytometric analysis.
-
The obtained liver and spleen single-cell suspensions were stained with anti-rat CD45 APC cy7 (Biolegend, CA, USA), anti-rat CD86 FITC (Biolegend), and anti-rat CD163 PE (Bio-Rad, CA, USA) antibodies at 4 °C for 30 min. THP-1 cells were stained with anti-human CD80 APC (eBioscience, CA, USA) and anti-human CD206 FITC (eBioscience) antibodies. To determine the fluorescence level of intracellular CD68, the cell membrane was disrupted in the presence of intracellular permeabilization buffer and stained with anti-rat CD68 APC (Miltenyi Biotec, North Rhine-Westphalia, Germany) and anti-human CD86 PEcy7 (eBioscience) antibody for 30 min at room temperature. Cell counting was performed using a BD FACS Canto II flow cytometer (BD Biosciences) and imaging data were analyzed using the FlowJo software (FlowJo, LLC, Ashland, OR).
-
Quantitative data are shown as the mean ± standard deviation and statistically processed using GraphPad Prism 9.0 (San Diego, CA, USA). The t-test, one-way ANOVA, two-way ANOVA, and Kruskal–Wallis test were used for the majority of the data. Statistical significance was considered at P < 0.05.
Knockout of C6orf120 in Rats Alleviates Concanavalin A-induced Autoimmune Hepatitis by Regulating Macrophage Polarization
doi: 10.3967/bes2024.066
- Received Date: 2023-07-12
- Accepted Date: 2023-11-13
-
Key words:
- C6orf120 /
- Autoimmune hepatitis /
- Macrophage polarization /
- M1 macrophages
Abstract:
Citation: | Xin Wang, Yuqi Wang, Hui Liu, Yingying Lin, Peng Wang, Yunyun Yi, Xin Li. Knockout of C6orf120 in Rats Alleviates Concanavalin A-induced Autoimmune Hepatitis by Regulating Macrophage Polarization[J]. Biomedical and Environmental Sciences, 2024, 37(6): 594-606. doi: 10.3967/bes2024.066 |