About BES
Aims & Scope
SCI and IF
Editor in Chief
Editorial Board
Editorial Office
Articles
Advance Publication
Current Issues
Archive
Authors and Reviewer
Instruction for authors
Online Submission
Submission:FAQ
Revise:FAQ
Author Login
Reviewer Login
Editor-in-chief Login
Office Login
Subscribe
How to Subscribe
Links
NHFPC
China CDC
China doi
doi
PubMed
Elsevier
WANFANG data
CNKI
VIP data
Full-Text PDF: 216-223.pdf
Toxicity of Sodium Fluoride to Caenorhabditis elegans
 

Original Article

Toxicity of Sodium Fluoride to Caenorhabditis elegans*

LI Qiao1, ZHANG Shu Hua1,#, YU Yuan Hua1, WANG Li Ping2, GUAN Shu Wen2, and LI Peng Fei2

1.Life Science and Technology Institute, Changchun University of Science and Technology, Changchun 130022, Jilin, China; 2.College of Life Science, Jilin University, Changchun 130021, Jilin, China

*This research was supported by Jilin Provincial Science and Technology Development Project in China, 20100407.

#Correspondence should be addressed to ZHANG Shu Hua. E-mail: zhangsh1018@126.com

Biographical note of the first author: LI Qiao, female, born in 1986, master, majoring in environmental pollutants research.

Received: March 9, 2011;      Accepted: June 20, 2011

 

Abstract

Objective  To investigate the toxic effect of sodium fluoride (NaF) on the nematode Caenorhabditis elegans (C. elegans).

Methods  Adult C. elegans were exposed to different concentrations of NaF (0.038 mmol/L, 0.38 mmol/L, and 3.8 mmol/L) for 24 h. To assess the physiological effects of NaF, the brood size, life span, head thrashes, and body bend frequency were examined. Reactive oxygen species (ROS) and cell apoptosis were detected as parameters of biochemical response. The gene expressions were determined by real-time polymerase chain reaction (PCR) to assess the molecular-level response.

Results  At the physiological level, the brood size of C. elegans exposed to 0.038 mmol/L, 0.38 mmol/L, and 3.8 mmol/L concentrations of NaF were reduced by 6%, 26%, and 28% respectively in comparison with the control group. The maximum life spans of C. elegans exposed to 0.038 mmol/L, 0.38 mmol/L, and 3.8 mmol/L concentrations of NaF were reduced by 3 days and 5 days, respectively. Head thrashes and body bend frequency both decreased with increasing concentrations of NaF. At the biochemical level, the production of ROS and the incidence of cell apoptosis increased with increasing concentrations of NaF(P<0.05). At the molecular level, different concentrations of NaF exposure raised the expression of stress-related genes, such as hsp16.1, sod-3, ctl-2, dhs-28, gst-1, and cep-1.

Conclusion  NaF exposure could induce multiple biological toxicities to C. elegans in a concentration-dependent manner. These toxicities may be relevant to the oxidative stress induced by increased ROS production and accumulation in C. elegans.

Key words: Sodium fluoride; Caenorhabditis elegans; Toxicity; Real-time PCR

Biomed Environ Sci, 2012; 25(2):216-223   doi:10.3967/0895-3988.2012.02.014     ISSN:0895-3988

www.besjournal.com(full text)           CN: 11-2816/Q           Copyright ?2012 by China CDC

 


INTRODUCTION

F

luorine is a microelement that is essential to humans and animals, but its safe amount for consumption is very small. It has been reported that too much or too little fluorine can induce a number of diseases[1]. Since fluoride was added into tap water in U.S. and Canada to prevent tooth decay in 1945, fluoride has been widely used in water. In addition, the industrial discharge of fluorine has induced environmental pollution. These factors have led to acute human exposure to fluorine. According to the statistics, approximately 25 countries have reported frequent cases of fluorosis. Among these countries, fluorosis is most serious and widespread in China and India[2]. Fluorosis has been paid increasing attention in recent years. The standard concentration of fluoride added into drinking water is 0.7-1.2 mg/L according to the public health service, and an average of 1 mg of fluorine is consumed per day[3]. As reported, approximately 99% of the total body fluoride is retained in bones and teeth, and the remainder is distributed in highly vascularized soft tissues[4-5]. In vivo, fluoride can cross the cell membrane and be distributed in various soft tissues, such as the nervous system, reproductive system, liver, kidneys, skin, and erythrocytes[6-8]. Increased lipid peroxidation and disturbed antioxidant defense systems have been found in the brain, erythrocytes and liver of rats exposed to fluoride[9]. Therefore, studies on the toxic effect of fluorides at different levels are urgent and necessary.

The nematode Caenorhabditis elegans is an excellent model organism. C.elegans is a small, soil-dwelling nematode with a simple body formed by 959 somatic cells in adult hermaphrodites and   1 031 somatic cells in adult males. Under laboratory conditions, C. elegans develops from a unicellular embryo to a fertile adult in 3-5 days. The life cycle of C. elegans consists of an embryonic stage and four larval stages (L1-L4)[10]. It is the most thoroughly studied and most completely understood metazoan in terms of molecular and classical genetics, development, behavior, and anatomy. Today, C. elegans is widely used in biological studies because of its short lifespan, cellular simplicity, genetic manipulability, and easy cultivation[11-13]. To assess the toxicity of NaF, C. elegans were exposed to three concentrations of NaF (0.038 mmol/L, 0.38 mmol/L, and 3.8 mmol/L) for 24 h. C. elegans were investigated and analyzed at the physiological, biochemical, and molecular levels .

MATERIALS AND METHODS

Chemicals and Organisms 

Three concentrations of NaF (pure analytical- grade, Sigma-Aldrich Chemical, USA) were used in this study (0.038 mmol/L, 0.38 mmol/L, and 3.8 mmol/L). These solutions were prepared with M9 medium (2.2 mmol/L KH2PO4, 4.2 mmol/L Na2HPO4, 8.55 mmol/L NaCl, and 1 mmol/L MgSO4). The wild- type C. elegans strain N2 was used and maintained on nematode growth medium (NGM) plates seeded with Escherichia coli strain OP50, at 20 °C [14].

Sample Preparation

Young adults (L4 stage) from a synchronized culture (three days after hatching) were exposed to the three concentrations of NaF for 24 h. The control groups were cultivated in M9 medium for 24 h. Three parallel experiments were conducted for all the test types.

Brood Size and Life Span

The methods were performed as previously described[15]. The brood size was assayed by placing a single tested nematode into an individual well of tissue culture plates. The nematode was transferred to a new well every 1.5 days until the nematode finished laying eggs. The progeny were counted the day following the transfer, and the test process lasted about 10 days. The brood size was the summation of eggs laid by the tested nematodes. For the brood size test, at least 10 replicates were performed for each experiment. Life span was assayed by placing 50 nematodes onto a single NGM plate with OP50 after the nematodes had been exposed to NaF for 24 h. The time of eggs brooding was recorded as t=0. The nematodes were transferred every 2 days to fresh plates during the brood period. The number of survivors was recorded every day. Nematodes that failed to respond to repeated touch stimulation were considered dead. The period of this test was about 27 days. To focus on aging, worms that had become desiccated on the side of the plate after crawling off, or that displayed extruded internal organs or that died because of hatching progeny inside the uterus (matricidal death) were excluded from the analysis. The results of the survival assays were analyzed by GraphPad Prism 5.

Head Thrashes and Body Bend Frequency

The methods were performed as previously described[16]. A thrash was defined as a change in the direction of bending at mid body. For the head thrash assay, the nematodes were washed with M9 medium after they had been exposed to NaF for 24 h. Each nematode was transferred to 60 μL of M9 medium on top of agar. After a 1-min recovery period, the head thrashes were counted for 1 min. A body bend was counted as a change in the direction of the part of the nematodes corresponding to the posterior bulb of the pharynx along the y axis, assuming that the nematode was traveling along the x axis. To assay the body bends, C. elegans was placed onto a new plate and scored for the number of body bends at an interval of 20 s. For both head thrashes and body bend frequency tests, 15 nematodes were examined per treatment.   

Quantification of Reactive Oxygen Species (ROS)

The quantification of ROS was performed as previously described[17]. To assay ROS, the nematodes that had been exposed to the chemical for 24 h were washed with ddH2O twice and with M9 medium once. The nematodes were then pendulated in M9 medium mixed with dichlorofluorescein (DCF) at 20 °C for 1 h. ROS was detected using a fluorescence microplate reader (ELX800, Biotek, America). The excitation wave was 528/20 nm, and the absorption wave was 485/20 nm. All of the above procedures were performed away from light. 

Cell Apoptosis Assay

The cell apoptosis assay was performed as previously described[18]. Acridine orange (AO) was used to observe cell apoptosis induced by NaF. After exposure to NaF for 24 h, the nematodes were pendulated in M9 medium mixed with AO at 20 °C for 2 h. The concentration of AO was 2.5×10-2 g/mL. Then, the nematodes were allowed to recover for 10 min on the top of agar and were mounted in 6×10-2 g/mL levamisole onto agar pads on microscope slides. The nematodes were examined using a fluorescence inverted microscope (TE-2000E, Nikon, Japan) to determine cell apoptosis. The excitation wave was 515 nm, and the absorption wave was 488 nm. 15 nematodes were observed per treatment.   

Gene Expression Assay by Real-time PCR

For the gene expression assay, we first chose stress-related genes based on previous studies, such as glyceraldehyde 3-phosphate dehydrogenase (gpd-1) (as the parameter gene), heat shock protein (hsp16.1), superoxide dismutase (sod-3), catalase (ctl-2), glutathione s-transferases (gst-1), deHydrog- enasesb short-chain (dhs-28), and p53-like protein (cep-1). We designed these primers on the basis of the sequences retrieved from C. elegans database by Primer Premier 5.0 software (Table 1). After exposure to NaF for 24 h, 100 nematodes were collected for each concentration to isolate the total RNA using an EZ-10 Spin Column Total RNA Isolation Kit (BBI, Canada). Next, the two-step reverse transcription-polymerase chain reaction (RT-PCR) method was used to acquire the cDNA using the RNA PCR Kit (TaKaRa, Japan). The real-time PCR was conducted using the SYBR PCR kit (TaKaRa, Japan) and the 7500 Fast Real-time PCR System (ABI, America). The reaction mixture(25 μL) consisted of 17.25 μL RNase-Free water, 2.5 μL 10×buffer, 2 μL dNTP, 0.25 μL Taq DNA polymerase, 1 μL DNA template, and 0.5 μL of each primer. The real-time PCR proceeded as follows: an initial activation of DNA polymerase at 95 °C for 10 s one cycle followed by 45 cycles of primer annealing and extension at 95 °C for 15 s and 60 °C for 1 min.

Table 1. The Primers for Real-time PCR

Name

Primers (5'-3')

gpd-1

Sense: AGGGAATCCTCGCCTACACTG

 

Antisense: ATTCATTGTCGTACCAAGAGACGA

hsp16.1

Sense: CTTTACCACTATTTCCGTCCAGC

 

Antisense : GGCTTGAACTGCGAGACATTG

sod-3

Sense: CGAGCTCGAACCTGTAATCAGCCATG

 

Antisense: GTTGCTGATTGTCATAAGCCATTGC

ctl-2

Sense: TTCGCTGAGGTTGAACAATCCG

 

Antisense: GTTGCTGATTGTCATAAGCCATTGC

gst-1

Sense: GATGATCTTCGGCCAGGTTC

 

Antisense: TGTCTCGTTGGAGCCATTGA

dhs-28

Sense: TGGGATCTTATCTTCAAGGTCCA

 

Antisense: TGGG ACCAGGGTATTTGCC

cep-1

Sense: ACGCTCACTCGTCGACTGCT

 

Antisense: ACACTGAATCGTGCCCTGCT

Data Analysis   

All data in this report were expressed as means±SD, which were analyzed by Origin 6.0 software and GraphPad Prism 5.0 software. The statistical differences between the control group and the experimental groups were determined with the aid of the parametric t-test. A probability level of 0.05 was considered statistically significant.

RESULTS

Toxic Effects of NaF on the Reproduction of C. elegans

In this report, the brood sizes of all three experimental groups were smaller than those of the control group. As shown in Figure 1, the brood size of the nematodes exposed to 0.038 mmol/L, 0.38 mmol/L, and 3.8 mmol/L concentrations of NaF were reduced by 6% (P<0.05), 26% (P<0.01), and 28% (P<0.01) , respectively compared with the control group. The 0.38 mmol/L and 3.8 mmol/L concentrations of NaF exposure induced a more severe effect on the brood size compared with the control group. This also indicated that the reproductive toxicity of NaF was concentration- dependent.

Figure 1. Brood sizes are reduced dramatically in C. elegans exposed to NaF. Bars represent means±SD. *P<0.05; **P<0.01.

Life Span Defects Caused by NaF Toxicity

When the nematodes were exposed to 0.038 mmol/L, 0.38 mmol/L, and 3.8 mmol/L concentrations of NaF, the maximum life spans were reduced by three days, three days and five days compared with the control group, respectively (Figure 2a). Moreover, the mean life span of the nematodes exposed to 3.8 mmol/L concentration of NaF were remarkably decreased compared with the control group (P<0.05) (Figure 2b). However, no significant differences were found among the 0.038 mmol/L and 0.38 mmol/L concentr- ations groups and the control group. Accordingly, exposure to high concentration (3.8 mmol/L) of NaF could cause more severe life span reduction. The low concentrations (0.038 mmol/L and 0.38 mmol/L) in the NaF exposure groups exhibited no apparent changes compared with the control group.

Figure 2. (a) Life spans of C. elegans exposed to different concentrations of NaF. (b) Mean life spans of C. elegans exposed to different concentrations of NaF. Bars represent means±SD. *P<0.05.

Locomotion Behavior Assay 

Head thrashes and body bends were used to assay the locomotion behavior of C. elegans[19-20]. As shown in Figure 3, the frequency of the head thrashes and body bends both decreased dramatically after exposure to NaF, even at the low concentration of 0.038 mmol/L (P<0.05). More severe phenotypes were observed for the 0.38 mmol/L and 3.8 mmol/L concentrations of NaF (P<0.01). The results indicated that the toxic effect of NaF on the locomotion behavior of C. elegans was concentration- dependent. 

Figure 3. NaF exposure causes locomotion behavior defects in C. elegans. (a) Head thrashes of C. elegans exposed to NaF show a concen- tration-dependent decrease. (b) Body bend frequency of C. elegans exposed to NaF show a concentration-dependent decrease. Bars represent means±SD. *P<0.05; **P<0.01.

ROS Assay

ROS is the main in vivo free radical in humans and animals. An ROS assay can help us understand the toxic effects of NaF on C. elegans at the biochemical level. As shown in Figure 4, ROS increased rapidly with the increased concentration of NaF (P<0.05). This relationship indicated that the generation of ROS in the tested nematodes was concentration-dependent. This result is consistent with a report showing increased free radical in the liver of rats exposed to NaF[21]. 

Figure 4. NaF exposure effects on reactive oxygen species. Bars represent means±SD. *P <0.05; **P<0.01.

Cell Apoptosis Assay 

Acridine orange (AO) was used to determine cell apoptosis. We found that the apoptotic cells were yellow or orange under the fluorescence inverted microscope because of DNA cleavage. The normal cells were green. As shown in Figure 5, increasing numbers of apoptotic cells were found in C. elegans with increased NaF concentration. Apoptotic cells were spread over nearly the entire body of C. elegans exposed to 3.8 mmol/L concentration of NaF. 

Gene Expression Assay

We determined the gene expression of hsp16.1, sod-3, ctl-2, dhs-28, gst-1, and cep-1. As shown in Figure 6, the expression of gst-1, dhs-28, hsp16.1, sod-3, and cep-1all increased compared with the control group. The expression of ctl-2 decreased in the nematodes exposed to the 0.038 mmol/L concentration of NaF compared with the control group but increased in the nematodes exposed to the 0.38 mmol/L and 3.8 mmol/L concentrations of NaF. These results indicated that the expression of stress- related genes changed after NaF exposure. Taken together, the altered expression of stress-related genes at the molecular level suggested that severe oxidative stress was induced by NaF exposure in C. elegans.

DISCUSSION

In this study, we investigated the toxicity of NaF to C. elegans at the physiological, biochemical and molecular levels. By assaying the three levels and the relationships among them, we were able to explore  the toxicity of NaF in a comprehensive and intensive way. 

Brood size reflects the reproductive capacity of C. elegans. Thus, brood size can help us assess the toxicity of NaF to the reproductive system of C. elegans. The brood sizes of all three experimental groups were reduced compared with the control group. This result indicates that NaF exposure could induce reproductive toxicity to C. elegans. Moreover, the toxicity was concentration-dependent.

Life span is an important parameter for assessing the toxicity of NaF. C. elegans provides an excellent model system for the study of aging because of its relatively short life span. As a life span indicator, the maximum and mean life span of C. elegans after NaF exposure were reduced in all three experimental groups compared with the control group. This result reveals that NaF exposure causes reduced life span of C. elegans in a concentration- dependent manner. 

Fluorine and its compounds can accumulate in the brain, inducing overoxidation in the brain tissue of animals. Recent reports have confirmed the neurotoxicity of NaF to organisms[22]. It has been reported that NaF exposure can induce damage to the nervous system of rats[23-24]. The behavioral phenotypes for both the head thrashes and body bend frequency were remarkably decreased in the NaF exposure groups compared with the control group. This result demonstrates that NaF can induce neurotoxicity to C. elegans. 

Reactive oxygen species (ROS) are mainly produced in mitochondria during respiration by the incomplete reduction of oxygen and as a side-product of cellular reactions[25]. Environmental stressors, such as radiation, drugs, metal ions, ultraviolet (UV) radiation, and heat, can generate free radicals, including ROS, thereby causing damage to tissues, cells and nucleic acids[26]. Numerous researches have considered that the mechanism of fluorosis is mainly determined by the metabolic disorder of free radicals[27]. Increased free radical generation have been proposed as mediators of the toxic effects of fluoride on soft tissues[28]. ROS in C. elegans increased along with an increasing concentration of NaF, which indicates that fluorosis may be related to the oxidative damage induced by increased ROS in C. elegans.

Apoptosis results from the action of a genetically encoded suicide program that leads to a series of characteristic morphological and biochemical changes. Fluorine is a protoplasmic poison that can accumulate in all tissues because it can penetrate


Figure 5. (a) Apoptosis of the control group under dark field. (b) Apoptosis of the control group under bright field. (c) Apoptosis of C. elegans exposed to 0.038 mmol/L concentration of NaF under dark field. (d) Apoptosis of C. elegans exposed to 0.038 mmol/L concentration of NaF under bright field. (e) Apoptosis of C. elegans exposed to 0.38 mmol/L concentration of NaF under dark field. (f) Apoptosis of C. elegans exposed to 0.38 mmol/L concentration of NaF under bright field. (g) Apoptosis of C. elegans exposed to 3.8 mmol/L concentration of NaF under dark field. (h) Apoptosis of C. elegans exposed to 3.8 mmol/L concentration of NaF under bright field.


Figure 6. NaF exposure effect on stress-related gene expression. Bars represent means±SD. *P<0.05.

the cell wall of almost any tissue and combine with the protoplasm[29-30]. The cytotoxicity of fluorine is mainly exhibited in two ways: the inhibition of cell growth and the inducing of cell apoptosis. Thus, it is an effective way to study the mechanism of fluorosis by assessing the toxic effect of NaF on cells. In this study, the toxic effect of NaF induced far more apoptosis in C. elegans compared with the control group. The result is consistent with the report that apoptosis could be induced by the generation of ROS in organisms[31]. 

Many environmental stresses result in an increased generation of active oxygen species in animals and the changes of related gene expression. In this study, the expression of some oxidative stress-related genes and that of apoptosis were tested. Temperature elevation or a variety of chemical agents would induce the heat shock response in both eukaryotic and prokaryotic systems, resulting in the induced synthesis of a group of heat shock polypeptides (HSPs)[32]. Sod-3 and ctl-2 are reported to play an important role in the oxidative stress response[33]. Dhs-28 has the function of an oxidoreductase. Glutathione S-transferases (GSTs) performs functions ranging from catalyzing the detoxification of electrophilic compounds to protecting against peroxidative damage[34]. Cep-1 is a p53-like protein gene that is concerned with immunity and apoptosis induced by DNA damage[35-36]. The results of these genes expression were consistent with those of the above ROS assay and apoptosis assay. These facts also indicate that cells respond to oxidative stress by inducing the expression of stress-related genes, by repairing stress-related damage or by inactivating ROS[37].

The findings of the present study demonstrate that NaF could cause multiple biological defects in a concentration-dependent manner at physiological, biochemical and molecular levels. The main injury induced in C. elegans by NaF was oxidative damage caused by increased ROS production and its accumulation in these organisms. Therefore, understanding of the multiple biological toxicities of fluorine to C.elegans may help us to know the potential toxicity of fluorine to human, and may also provide new clues to reveal the mechanism of fluorine toxicity and lay the foundation for prevention and treatment of fluorosis. Above all, the present study can provide a sound scientific basis for the safe use of fluoride in medical and health care services.

ACKNOWLEDMENTS

The nematode strain used in this study was provided by the Caenorhabditis Genetics Center, USA. We are grateful to Prof. FAN (College of Medicine, MUSC, Charleston, SC, USA) for critical and valuable advice on the manuscript revision.

REFERENCES

1.  Shanthakumari D, Srinivasalu S, Subramanian S. Effect of fluoride intoxication on lipidper oxidation and antioxidant status in experimental rats. Toxicology, 2004; 204(2-3), 219-28.

2.  Chaudhary V, Kumar M, Sharma M, et al. Fluoride, boron and nitrate toxicity in ground water of northwest Rajasthan, India. Environ Monit Assess, 2010; 161(1-4), 343-8.

3.  Jha SK, Nayak AK, Sharma YK. Fluoride toxicity effects in onion (Allium cepa L.) grown in contaminated soils. Chemosphere, 2009; 76(3), 353-6.

4.  Mellberg JR, Ripa LW, Leske GS. The relationship between dental caries and tooth enamel fluoride. Caries Res, 1985; 19(5), 385-9.

5.  Whitford GM. The metabolism and toxicity of fluoride. Monogr Oral Sci, 1996; 16(2), 151-3. 

6.  Carlson CH, Armstrong WD, Singer L. Distribution and excretion of radio-fluoride in the human. Proc Soc Exp Biol Med, 1960; 104, 235-9.

7.  Jacyszyn K, Marut A. Fluoride in blood and urine in humans administered fluoride and exposed to fluoride-polluted air. Fluoride, 2001; 19(1), 26-32.

8.  Suska M. Energy metabolism of erythocytes in lambs chonically exposed to fluorine. Immunotoxicol, 2002; 25, 655-70.

9.  Shivarajashankara YM, Shivashankara AR, Gopalakrishna Bhat P, et al. Effect of fluoride intoxication on lipid peroxidation and antioxidant systems in rats. Fluoride, 2001; 34, 108-13.

10.    Brenner S. The genetics of Caenorhabditis elegans. Genetics, 1974; 77(1), 71-94.

11.    Boyd WA, Williams PL. Availability of metals to the nematode Caenorhabditis elegans: toxicity based on total concentrations in soil and extracted fractions. Environ Toxicol Chem, 2003; 22(5), 1100-6.

12.    Anderson GL, Cole RD, Williams PL. Assessing behavioral toxicity with Caenorhabditis elegans. Environ Toxicol Chem, 2004; 23(5), 1235-40.  

13.    Wang DY, Yang P. Multi-biological defects caused by lead exposure exhibit transferable properties from exposed parents to their progeny in Caenorhabditis elegans. J Environ Sci, 2007; 19(11), 1367-72.

14.    Swain SC, Keusekotten K, Baumeister B, et al. C. Elegans metallothioneins: new insights into the phenotypic effects of cadmium toxicosis. J Mol Biol, 2004; 341 (4), 951-9.

15.    Zhang Y, Wang D. Establishment of Toxicity Evaluat ion System Using Model Organism of Caenorhabditis elegans. Asian J Ecotoxicol, 2008; 3(4), 313-22.

16.    Tsalik EL, Hobert O. Functional mapping of neurons that control locomotory behavior in Caenorhabditis elegans. J Neuro biol, 2003; 56(2), 178-97.

17.    Kampkotter A, Nkwonkam CG, Zurawski RF, et al. Investigations of protective effects of the flavonoids quercetin and rutin on stress resistance in the model organism Caenorhabditis elegans. Toxicology, 2007; 234(1-2), 113-23.

18.    Yang F, Wang WL, Wang BY. The observation methods about apoptosis on morphology. J Cell Molr Immunol, 1997; 13, 8-9.

19.    Roh JY, Choi J. Ecotoxicological evaluation of chlorpyrifos exposure on the nematode Caenorhabditis elegans. Ecotoxicol Environ Saf, 2008; 71(2), 483-9.

20.    Wang DY, Wang Y. Nickel sulfate induces numerous defects in Caenorhabditis elegans that can also be transferred to progeny. Environ Pollut, 2008; 151(3), 585-92.

21.    Wang SL, Gao Q, Yu YN. Study on the lesion of the liver of the rats with chonic fluorosis and the therapeutical effect of the Danshen-gypenosides composite. Chin J Chem Eng, 2004; 23(6), 546-8. 

22.    Cao CF, Ma HY, Wang JD. The research progression about neurotoxicity of fluorine. J Nematode Sci Veterin Med, 2007; 26(6), 38-40.

23.    Mullenix PJ, Denbesten PK, Schunior A, et al. Neurotoxicity of sodium fluoride in rats. Neurotoxicol Teratol, 1995; 17(2), 169-77.

24.    Whitford GM, Whitford JL, Hobbs SH. Appetitive-based learning in rats: lack of effect of chonic exposure to fluoride. Neurotoxicol Teratol, 2009; 31(4), 210-5.

25.    Cross AR, Jones OT. Enzymic mechanisms of superoxide production. Biochim Biophys Acta, 1991; 1057(3), 281-98. 

26.    Baverstock KF. Abnormal distribution of double strand breaks in DNA after direct ac1tion of ionizing energy. International Journal of Radiation Biology and Related Studies in Physics. Chem Med, 1985; 47(4), 369-74.

27.    Narayanaswamy M, Piler MB. Effect of maternal exposure of fluoride on biometals and oxidative stress parameters in developing CNS of rat. Biomed Res Trace Elem, 2009; 133(1), 71-82.

28.    Chlubek D. Fluoride and oxidative stress. Fluoride, 2003; 36(3), 217-28.

29.    Rzeuski R, Chlubek D, Machoy Z. Interactions between fluoride and biological free radical reactions. Fluoride, 1998; 31(4), 43-5.

30.    Hiramoto F, Nomura N, Furumai T, et al. Apoptosis-like cell death of Saccharomyces cerevisiae induced by a mannose- binding antifungal antibiotic, pradimicin. J Antibiot(Tokyo), 2003; 56(9), 768-72.

31.    Maike CR and Marc RK. Oxidative Stress-Induced Calcium Signaling in Arabidopsis. Plant Physiol, 2004; 135, 1471-9.

32.    Russnak RH, Candido EP. Locus Encoding a Family of Small Heat Shock Genes in Caenorhabditis elegans: Two Genes Duplicated to Form a 3.8-Kilobase Inverted Repeat. Mol Cell Biol, 1985; 5(6), 1268-78.

33.    Violeta C, Akiko MS, Arash M, et al. Oxidative Stress Enzymes Are Required for DAF-16-Mediated Immunity Due to Generation of Reactive Oxygen Species by Caenorhabditis elegans. Genetics, 2007; 176(3), 1567-77.

34.    Liebau E, Wildenburg G, Walter RD, et al. A Novel Type of Glutathione S-Transferase in Onchocerca volvulus. Infect Immun, 1994; 62(11), 4762-7.

35.   Greiss S, Hall J, Ahmed S, et al. elegans SIR-2.1 translocation is linked to a proapoptotic pathway parallel to cep-1/ p53 during DNA damage-induced apoptosis. Genes Dev, 2008; 22(20), 2831-42. 

36.    Fuhman LE, Goel AK, Smith J, et al. Nucleolar Proteins Suppress Caenorhabditis elegans Innate Immunity by Inhibiting p53/CEP-1. PLoS Genetics, 2009; 5(9), 1-14.

37.    Veal EA, Toone WM, Jones N, et al. Distinct Roles for Glutathione S-Transferases in the Oxidative Stress Response in Schizosaccharomyces pombe. J BiolChem, 2002; 277(38), 35523-31. 


 

 
Full-Text PDF: 216-223.pdf
Biomedical and Environmental Sciences ISSN 0895-3988 CN 11-2816/Q
Publish Under the Auspices of Chinese Center for Disease Control and Prevention
Distributed by Chinese Center for Disease Control and Prevention
All Rights Reserved by Chinese Center for Disease Control and Prevention
京ICP备11024750