-
Wild-type AB strain zebrafish were raised according to the methods described by Westerfield[28]. Zebrafish embryos were incubated in a dish, and larvae (14 d post fertilization, dpf) were housed in a recirculating tank system on a 14 h/10 h light/dark cycle. Water quality was maintained at 28.5 °C (pH 7.2–7.6; salinity 0.03%–0.04%). All procedures in this study were approved by the Key Laboratory of Zebrafish Modeling and Drug Screening for Human Diseases Institute, Southern Medical University (Guangzhou, China).
-
Thirty embryos [< 1 h post fertilization (hpf)] were exposed to toluene (0, 1, 2, or 4 mmol/L; Sigma-Aldrich, St. Louis, MO, USA) in zebrafish medium (3.50 g/L NaCl, 0.05 g/L KCl, 0.05 g/L NaHCO3, and 0.10 g/L CaCl2), with three replicates. To maintain the toluene concentration, embryos were incubated in 25 cm2 airtight flasks (ten embryos per flask) with air exchange once a day. Abnormal and dead zebrafish embryos/larvae were monitored, while hatched larvae were counted at 48 and 72 hpf. As described earlier, the morphological characteristics of the larvae were checked with a microscope to identify the abnormal fish[29]. The rates of malformation, death, and hatching were evaluated every 24 h by the ratio of counted numbers/total exposed numbers × 100, and the assessment stopped at 120 hpf. Embryos prepared for qPCR were collected at 72 hpf, immediately frozen in liquid nitrogen, and stored at −80 °C until RNA extraction.
-
The locomotion activities of larvae were monitored and recorded by a ViewPoint Zebrabox behavior testing system (ViewPoint Life Sciences, Lyon, France) as described by Chen et al.[30]. Larvae at 6 dpf (12 larvae per treatment) with no obvious abnormal phenotypes were transferred to a 96-well plate (1 fish per well) and incubated at 28 °C for 30 min before locomotion behavior assessment. The spontaneous movements of larvae were observed over a period of 20 min. Three independent experiments were performed.
-
The fluorescent labeling of zebrafish hair cells was performed following a previously established method[31, 32]. Three dpf larvae were first euthanized by 0.5 mmol/L tricaine (TCI, Tokyo, Japan) and then fluorescently labeled in an embryo medium containing 1 μmol/L YO-PRO-1 (Invitrogen, Carlsbad, CA, USA) for 1 h with ten larvae per tube to quantify the anatomic damage to zebrafish lateral line hair cells. After fixation in 2% paraformaldehyde for 1 h at room temperature (25 ℃) and storage overnight in phosphate-buffered saline at 4 °C, larvae were mounted in 4%–6% methylcellulose (TCI) and identified with a fluorescence stereomicroscope (Olympus Corporation, Tokyo, Japan). The relative fluorescence levels of each group were manually measured using ImageJ software[33]. Three independent experiments were performed.
-
Larvae were collected at 72 hpf, and total RNA was isolated using a RNAiso Plus kit (TaKaRa, Dalian, China) and transcribed to cDNA with a PrimeScript RT reagent kit with gDNA Eraser (Transgen Biotech, Beijing, China). RNA quality and quantity were checked with a Nanodrop-2000 (ThermoFisher Scientific, MA, USA). Relative levels of gene expression were measured by qPCR and were normalized to gapdh expression. qPCR was performed on a Lightcycle 96 (Roche, Basel, Switzerland) using a SYBR Green polymerase chain reaction core reagent kit (Transgen Biotech, Beijing, China) according to the manufacturer's instructions. The primers used for the gene amplification are shown in Table 1. To ensure the consistency of the results, the biological tests were performed at least in triplicate, using a total of ≥ 30 embryos or larvae per group.
Table 1. Primers for q-PCR
Name Full name Primer type Primer sequence (5′–3′) cd164l2 CD164 sialomucin-like 2 forward AGCACCTATGAAACTATTGA reverse TTTGGTTGAACTATCCCT chrna9 cholinergic receptor, nicotinic, alpha 9 forward GGAGTCGGCTACCTTCAC reverse CACCTTGGCAACCTTCTT gapdh glyceraldehyde-3-phosphate dehydrogenase forward TCTGACAGTCCGTCTTGAGAAA reverse ACAAAGTGATCGTTGAGAGCAA myo6b myosin VIb forward TTGCGCAGAGATGCTACCAC reverse CAGCTCAGCGTACTTCCACT myo15ab myosin XVAb forward CGCCTGCTCTACATTCTC reverse GTAAACACTCCTGCCACC otofb otoferlin b forward TCCAGGCTTAGACCAAA reverse GAGGAGCGATGCTTATT pcsk5a proprotein convertase subtilisin/kexin type 5a forward GACGGCACTGTTTATCGC reverse GTCCTCCTGTTCATCTCCTA slc17a8 solute carrier family 17, member 8 forward AACTAGCGGCTAACAGGGTG reverse AAGCGGAGGAGCCCATTTAC tekt3 tektin 3 forward ACCATCTCCGAAACACCT reverse ATCCGTGAACTTTGACCAG tmc2a transmembrane channel-like 2a forward ACCACAGTGGGAGTAGAGT reverse AGCACCAGCAATAGTTCA -
Locomotion data are presented as the mean ± standard error. qPCR data are shown as the mean ± standard deviation. After the homogeneity of variance tests, measurement data were analyzed using one-way analysis of variance with Bonferroni’s multiple comparisons correction (equal variances assumed) and Dunnett's T3 multiple comparisons (equal variances were not assumed) using SPSS 20.0 software. A P value of < 0.05 was considered statistically significant.
doi: 10.3967/bes2021.016
Effects of Toluene on the Development of the Inner Ear and Lateral Line Sensory System of Zebrafish
-
Abstract:
Objective The aim of this study was to explore the ototoxicity of toluene in the early development of zebrafish embryos/larvae. Methods Zebrafish were utilized to explore the ototoxicity of toluene. Locomotion analysis, immunofluorescence, and qPCR were used to understand the phenotypes and molecular mechanisms of toluene ototoxicity. Results The results demonstrated that at 2 mmol/L, toluene induced zebrafish larvae death at 120 hours post fertilization (hpf) at a rate of 25.79% and inhibited the rate of hatching at 72 hpf. Furthermore, toluene exposure inhibited the distance travelled and average swimming velocity of zebrafish larvae while increasing the frequency of movements. As shown by fluorescence staining of hair cells, toluene inhibited the formation of lateral line neuromasts and middle line 1 (Ml1) neuromasts in 3 days post fertilization larvae in a concentration-dependent manner. Toluene altered the expression level of genes involved in ear development/function in zebrafish, among which the mRNA levels of cd164l2, tekt3, and pcsk5a were upregulated, while the level of otofb was downregulated, according to the qPCR results. Conclusion This study indicated that toluene may affect the development of both the inner ear and lateral line systems in zebrafish, while the lateral line system may be more sensitive to toluene than the inner ear. -
Key words:
- Toluene /
- Ototoxicity /
- Zebrafish /
- Lateral line sensory system
注释: -
Figure 3. The inner ear structure of 3 d post fertilization larvae was observed under a light microscope (A). Three dpf larvae were stained with Yo-Pro-1 for 1 h. The green fluorescence spots indicate stained neuromasts. Representative stained larvae of the control group and each toluene exposure group are presented (B, D). The red box indicates the area presented in Figure 3B. Fluorescence areas were calculated using ImageJ software (C, three replicates), *P < 0.05 and **P < 0.01, and compared with the control group. MI1, middle line; O1, otic 1; O2, otic 2; and IO4, infraorbital 4.
Table 1. Primers for q-PCR
Name Full name Primer type Primer sequence (5′–3′) cd164l2 CD164 sialomucin-like 2 forward AGCACCTATGAAACTATTGA reverse TTTGGTTGAACTATCCCT chrna9 cholinergic receptor, nicotinic, alpha 9 forward GGAGTCGGCTACCTTCAC reverse CACCTTGGCAACCTTCTT gapdh glyceraldehyde-3-phosphate dehydrogenase forward TCTGACAGTCCGTCTTGAGAAA reverse ACAAAGTGATCGTTGAGAGCAA myo6b myosin VIb forward TTGCGCAGAGATGCTACCAC reverse CAGCTCAGCGTACTTCCACT myo15ab myosin XVAb forward CGCCTGCTCTACATTCTC reverse GTAAACACTCCTGCCACC otofb otoferlin b forward TCCAGGCTTAGACCAAA reverse GAGGAGCGATGCTTATT pcsk5a proprotein convertase subtilisin/kexin type 5a forward GACGGCACTGTTTATCGC reverse GTCCTCCTGTTCATCTCCTA slc17a8 solute carrier family 17, member 8 forward AACTAGCGGCTAACAGGGTG reverse AAGCGGAGGAGCCCATTTAC tekt3 tektin 3 forward ACCATCTCCGAAACACCT reverse ATCCGTGAACTTTGACCAG tmc2a transmembrane channel-like 2a forward ACCACAGTGGGAGTAGAGT reverse AGCACCAGCAATAGTTCA -
[1] Brouette T and Anton R. Clinical review of inhalants. Am J Addict, 2001; 10, 79−94. doi: 10.1080/105504901750160529 [2] ICIS. Toluene uses and market data. 2007: https://www.icis.com/resources/news/2007/11/07/9076550/toluene-uses-and-market-data/. [2018-8-8]. [3] Zhang J, An J, Qu Y, et al. Impacts of potential HONO sources on the concentrations of oxidants and secondary organic aerosols in the Beijing-Tianjin-Hebei region of China. Sci Total Environ, 2018; 647, 836−52. [4] Lyu XP, Zeng LW, Guo H, et al. Evaluation of the effectiveness of air pollution control measures in Hong Kong. Environ Pollut, 2017; 220, 87−94. doi: 10.1016/j.envpol.2016.09.025 [5] Lekkas T, Kolokythas G, Nikolaou A, et al. Evaluation of the pollution of the surface waters of Greece from the priority compounds of list II, 76/464/EEC directive, and other toxic compounds. Environ Int, 2004; 30, 995−1007. doi: 10.1016/j.envint.2004.04.001 [6] Ling ZH, Guo H, Cheng HR, et al. Sources of ambient volatile organic compounds and their contributions to photochemical ozone formation at a site in the Pearl River Delta, southern China. Environ Pollut, 2011; 159, 2310−19. doi: 10.1016/j.envpol.2011.05.001 [7] Bao Z. Characteristics of organic pollutants in drinking water sources of the Yangtze River Delta region. 2016. [8] Kauneliene V, Meisutovic-Akhtarieva M, Martuzevicius D. A review of the impacts of tobacco heating system on indoor air quality versus conventional pollution sources. Chemosphere, 2018; 206, 568−78. doi: 10.1016/j.chemosphere.2018.05.039 [9] Saraga D, Pateraki S, Papadopoulos A, et al. Studying the indoor air quality in three non-residential environments of different use: a museum, a printery industry and an office. Building & Environment, 2011; 46, 2333−41. [10] Bruno P, Caselli M, de Gennaro G, et al. Monitoring of volatile organic compounds in non-residential indoor environments. Indoor Air, 2008; 18, 250−6. doi: 10.1111/j.1600-0668.2008.00528.x [11] Zhang GS, Li TT, Luo M, et al. Air pollution in the microenvironment of parked new cars. Building & Environment, 2008; 43, 315−9. [12] Walser T, Juraske R, Demou E, et al. Indoor exposure to toluene from printed matter matters: complementary views from life cycle assessment and risk assessment. Environ Sci Technol, 2014; 48, 689−97. doi: 10.1021/es403804z [13] Fabietti F, Ambruzzi A, Delise M, et al. Monitoring of the benzene and toluene contents in human milk. Environ Int, 2004; 30, 397−401. doi: 10.1016/j.envint.2003.09.007 [14] Lim SK, Shin HS, Yoon KS, et al. Risk assessment of volatile organic compounds benzene, toluene, ethylbenzene, and xylene (BTEX) in consumer products. J Toxicol Environ Health A, 2014; 77, 1502−21. doi: 10.1080/15287394.2014.955905 [15] Cao XL, Pelletier L, Sparling M, et al. Occurrence of toluene in Canadian total diet foods and its significance to overall human exposure. Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2018; 35, 110−7. doi: 10.1080/19440049.2017.1395520 [16] Violante-Soria V, Cruz SL, Rodriguez-Manzo G. Sexual behaviour is impaired by the abused inhalant toluene in adolescent male rats. Eur J Neurosci, 2019, 50, 2113−23 . [17] Arslan S, Uzunhasan I, Kocas BB, et al. Effect of chronic toluene exposure on heart rhythm parameters. Pacing Clin Electrophysiol, 2018; 41, 783-7. [18] Grandjean P, Landrigan PJ. Neurobehavioural effects of developmental toxicity. Lancet Neurol, 2014; 13, 330−8. doi: 10.1016/S1474-4422(13)70278-3 [19] Grandjean P, Landrigan PJ. Developmental neurotoxicity of industrial chemicals. Lancet, 2006; 368, 2167−78. doi: 10.1016/S0140-6736(06)69665-7 [20] Biscaldi GP, Mingardi M, Pollini G, et al. Acute toluene poisoning. Electroneurophysiological and vestibular investigations. Toxicol Eur Res, 1981; 3, 271−3. [21] Schaper M, Seeber A, van Thriel C. The effects of toluene plus noise on hearing thresholds: an evaluation based on repeated measurements in the German printing industry. Int J Occup Med Environ Health, 2008; 21, 191−200. [22] Waniusiow D, Campo P, Cossec B, et al. Toluene-induced hearing loss in acivicin-treated rats. Neurotoxicol Teratol, 2008; 30, 154−60. doi: 10.1016/j.ntt.2008.02.006 [23] Waniusiow D, Campo P, Venet T, et al. Toluene-induced hearing loss in the guinea pig. Toxicol Sci, 2009; 111, 362−71. doi: 10.1093/toxsci/kfp169 [24] Kari G, Rodeck U, Dicker AP. Zebrafish: an emerging model system for human disease and drug discovery. Clin Pharmacol Ther, 2007; 82, 70−80. doi: 10.1038/sj.clpt.6100223 [25] Lu Z, DeSmidt AA. Early development of hearing in zebrafish. J Assoc Res Otolaryngol, 2013; 14, 509−21. doi: 10.1007/s10162-013-0386-z [26] Goodrich LV. Hear, hear for the zebrafish. Neuron, 2005; 45, 3−5. doi: 10.1016/j.neuron.2004.12.027 [27] Ton C and Parng C. The use of zebrafish for assessing ototoxic and otoprotective agents. Hear Res, 2005; 208, 79−88. [28] Westerfield M. The Zebrafish Book. A guide for the laboratory use of zebrafish (Danio rerio). Zebrafish Book A Guide for the Laboratory Use of Zebrafish, 2000. [29] Tu H, Fan C, Chen X, et al. Effects of cadmium, manganese, and lead on locomotor activity and neurexin 2a expression in zebrafish. Environ Toxicol Chem, 2017; 36, 2147−54. doi: 10.1002/etc.3748 [30] Chen L, Yu K, Huang C, et al. Prenatal transfer of polybrominated diphenyl ethers (PBDEs) results in developmental neurotoxicity in zebrafish larvae. Environ Sci Technol, 2012; 46, 9727−34. doi: 10.1021/es302119g [31] Philip RC, Rodriguez JJ, Niihori M, et al. Automated high-throughput damage scoring of zebrafish lateral line hair cells after ototoxin exposure. Zebrafish, 2018; 15, 145−55. doi: 10.1089/zeb.2017.1451 [32] Coffin AB, Ou H, Owens KN, et al. Chemical screening for hair cell loss and protection in the zebrafish lateral line. Zebrafish, 2010; 7, 3−11. doi: 10.1089/zeb.2009.0639 [33] Rebernick R, Fahmy L, Glover C, et al. DNA area and NETosis analysis (DANA): a high-throughput method to quantify neutrophil extracellular traps in fluorescent microscope images. Biol Proced Online, 2018; 20, 7. doi: 10.1186/s12575-018-0072-y [34] Monroe JD, Rajadinakaran G, Smith ME. Sensory hair cell death and regeneration in fishes. Front Cell Neurosci, 2015; 9, 131. [35] Hoet P, Lison D. Ototoxicity of toluene and styrene: state of current knowledge. Crit Rev Toxicol, 2008; 38, 127−70. doi: 10.1080/10408440701845443 [36] GT P, Dickinson J, Feeney EM, et al. Hearing loss in rats first exposed to toluene as weanlings or as young adults. Neurobehav Toxicol Teratol, 1984; 6, 111. [37] Johnson AC, Canlon B. Progressive hair cell loss induced by toluene exposure. Hear Res, 1994; 75, 201−8. doi: 10.1016/0378-5955(94)90071-X [38] Zhao Z, Tong JW, Zhang JP, et al. Zebrafish model for the study on drug ototoxicity of aminoglycoside antibiotics. Acta Pharm Sin, 2011; 46, 928−35. (In Chinese [39] Rabinowitz PM, Galusha D, Slade MD, et al. Organic solvent exposure and hearing loss in a cohort of aluminium workers. Occup Environ Med, 2008; 65, 230−5. doi: 10.1136/oem.2006.031047 [40] Korn S, Moles DA, Rice SD. Effects of temperature on the median tolerance limit of pink salmon and shrimp exposed to toluene, naphthalene, and Cook Inlet crude oil. Bull Environ Contam Toxicol, 1979; 21, 521−5. [41] Mcconville MM, Roberts JP, Boulais M, et al. The sensitivity of a deep-sea fish species (Anoplopoma fimbria) to oil-associated aromatic compounds, dispersant, and Alaskan North Slope crude oil. Environ Toxicol Chem, 2018; 37, 2210-21. [42] Devlin EW, Brammer JD, Puyear RL. Acute toxicity of toluene to three age groups of fathead minnows (Pimephales promelas). Bull Environ Contam Toxicol, 1982; 29, 12−7. doi: 10.1007/BF01606082 [43] Teuschler LK, Gennings C, Hartley WR, et al. The interaction effects of binary mixtures of benzene and toluene on the developing heart of medaka (Oryzias latipes). Chemosphere, 2005; 58, 1283−91. doi: 10.1016/j.chemosphere.2004.09.075 [44] Mizell M, Romig ES. The aquatic vertebrate embryo as a sentinel for toxins: zebrafish embryo dechorionation and perivitelline space microinjection. Int J Dev Biol, 1997; 41, 411−23. [45] Soberanes-Chavez P, Lopez-Rubalcava C, de Gortari P, et al. Exposure to toluene and stress during pregnancy impairs pups' growth and dams' lactation. Neurotoxicol Teratol, 2013; 40, 9−16. doi: 10.1016/j.ntt.2013.07.011 [46] Bowen SE, Hannigan JH. Binge toluene exposure in pregnancy and pre-weaning developmental consequences in rats. Neurotoxicol Teratol, 2013; 38, 29−35. doi: 10.1016/j.ntt.2013.04.002 [47] Yavari F, van Thriel C, Nitsche MA, et al. Effect of acute exposure to toluene on cortical excitability, neuroplasticity, and motor learning in healthy humans. Arch Toxicol, 2018; 92, 3149-3162. [48] Dick ALW, Pooters T, Gibbs S, et al. NMDA receptor binding is reduced within mesocorticolimbic regions following chronic inhalation of toluene in adolescent rats. Brain Res, 2015; 1624, 239−52. doi: 10.1016/j.brainres.2015.07.037 [49] Furlong TM, Duncan JR, Corbit LH, et al. Toluene inhalation in adolescent rats reduces flexible behaviour in adulthood and alters glutamatergic and GABAergic signalling. J Neurochem, 2016; 139, 806. doi: 10.1111/jnc.13858 [50] Raible DW, Kruse GJ. Organization of the lateral line system in embryonic zebrafish. J Comp Neurol, 2000; 421, 189−98. doi: 10.1002/(SICI)1096-9861(20000529)421:2<189::AID-CNE5>3.0.CO;2-K [51] Erickson T, Nicolson T. Identification of sensory hair-cell transcripts by thiouracil-tagging in zebrafish. BMC Genomics, 2015; 16, 842. doi: 10.1186/s12864-015-2072-5 [52] Chatterjee P, Padmanarayana M, Abdullah N, et al. Otoferlin deficiency in zebrafish results in defects in balance and hearing: rescue of the balance and hearing phenotype with full-length and truncated forms of mouse otoferlin. Mol Cell Biol, 2015; 35, 1043−54. doi: 10.1128/MCB.01439-14 [53] Kniss J S, Jiang L, Piotrowski T. Insights into sensory hair cell regeneration from the zebrafish lateral line. Curr Opin Genet Dev, 2016; 40, 32−40. doi: 10.1016/j.gde.2016.05.012 [54] Hernandez PP, Olivari FA, Sarrazin AF, et al. Regeneration in zebrafish lateral line neuromasts: expression of the neural progenitor cell marker sox2 and proliferation-dependent and-independent mechanisms of hair cell renewal. Dev Neurobiol, 2007; 67, 637−54. doi: 10.1002/dneu.20386 [55] Barta CL, Liu H, Chen L, et al. RNA-seq transcriptomic analysis of adult zebrafish inner ear hair cells. Sci Data, 2018; 5, 180005. doi: 10.1038/sdata.2018.5