LI Yuan Yuan, FU Shi Hong, GUO Xiao Fang, LEI Wen Wen, LI Xiao Long, SONG Jing Dong, CAO Lei, GAO Xiao Yan, LYU Zhi, HE Ying, WANG Huan Yu, REN Xiao Jie, ZHOU Hong Ning, WANG Gui Qin, LIANG Guo Dong. Identification of a Newly Isolated Getah Virus in the China-Laos Border, China[J]. Biomedical and Environmental Sciences, 2017, 30(3): 210-214. doi: 10.3967/bes2017.028
Citation: LI Yuan Yuan, FU Shi Hong, GUO Xiao Fang, LEI Wen Wen, LI Xiao Long, SONG Jing Dong, CAO Lei, GAO Xiao Yan, LYU Zhi, HE Ying, WANG Huan Yu, REN Xiao Jie, ZHOU Hong Ning, WANG Gui Qin, LIANG Guo Dong. Identification of a Newly Isolated Getah Virus in the China-Laos Border, China[J]. Biomedical and Environmental Sciences, 2017, 30(3): 210-214. doi: 10.3967/bes2017.028

doi: 10.3967/bes2017.028
基金项目: 

Development Grant of State Key Laboratory of Infectious Disease Prevention and Control 2014SKLID103

Special National Project on Research and Development of Key Biosafety Technologies 2016YFC1201900

This work was supported by grants from National Natural Science Foundation of China 81290342 and 81501757

Identification of a Newly Isolated Getah Virus in the China-Laos Border, China

Funds: 

Development Grant of State Key Laboratory of Infectious Disease Prevention and Control 2014SKLID103

Special National Project on Research and Development of Key Biosafety Technologies 2016YFC1201900

This work was supported by grants from National Natural Science Foundation of China 81290342 and 81501757

More Information
    Author Bio:

    LI Yuan Yuan, female, born in 1989, MS, majoring in Japanese encephalitis and other arboviruses

    FU Shi Hong, female, born in 1967, Associate Chief Technician, majoring in Japanese encephalitis and other arboviruses

    Corresponding author: WANG Gui Qin, MD, Tel&Fax:86-13754830795, E-mail:guiqinwang321@163.comLIANG Guo Dong, MD, Tel&Fax:86-10-63510124, E-mail:gdliang@hotmail.com
图(2) / 表ll (3)
计量
  • 文章访问数:  3102
  • HTML全文浏览量:  1167
  • PDF下载量:  126
  • 被引次数: 0
出版历程
  • 收稿日期:  2016-10-31
  • 录用日期:  2017-03-03
  • 刊出日期:  2017-03-01

Identification of a Newly Isolated Getah Virus in the China-Laos Border, China

doi: 10.3967/bes2017.028
    基金项目:

    Development Grant of State Key Laboratory of Infectious Disease Prevention and Control 2014SKLID103

    Special National Project on Research and Development of Key Biosafety Technologies 2016YFC1201900

    This work was supported by grants from National Natural Science Foundation of China 81290342 and 81501757

    作者简介:

    LI Yuan Yuan, female, born in 1989, MS, majoring in Japanese encephalitis and other arboviruses

    FU Shi Hong, female, born in 1967, Associate Chief Technician, majoring in Japanese encephalitis and other arboviruses

    通讯作者: WANG Gui Qin, MD, Tel&Fax:86-13754830795, E-mail:guiqinwang321@163.comLIANG Guo Dong, MD, Tel&Fax:86-10-63510124, E-mail:gdliang@hotmail.com

English Abstract

LI Yuan Yuan, FU Shi Hong, GUO Xiao Fang, LEI Wen Wen, LI Xiao Long, SONG Jing Dong, CAO Lei, GAO Xiao Yan, LYU Zhi, HE Ying, WANG Huan Yu, REN Xiao Jie, ZHOU Hong Ning, WANG Gui Qin, LIANG Guo Dong. Identification of a Newly Isolated Getah Virus in the China-Laos Border, China[J]. Biomedical and Environmental Sciences, 2017, 30(3): 210-214. doi: 10.3967/bes2017.028
Citation: LI Yuan Yuan, FU Shi Hong, GUO Xiao Fang, LEI Wen Wen, LI Xiao Long, SONG Jing Dong, CAO Lei, GAO Xiao Yan, LYU Zhi, HE Ying, WANG Huan Yu, REN Xiao Jie, ZHOU Hong Ning, WANG Gui Qin, LIANG Guo Dong. Identification of a Newly Isolated Getah Virus in the China-Laos Border, China[J]. Biomedical and Environmental Sciences, 2017, 30(3): 210-214. doi: 10.3967/bes2017.028
  • Getah virus (GETV) was first isolated from Culex samples collected in Malaysia in 1955. The prototype virus strain was MM2021[1]. GETV belongs to the genus Alphavirus of the family Togaviridae and is a mosquito-transmitted arbovirus[2]. To date, GETV has been identified in about 10 countries or regions, including Australia[2], Malaysia[1], Japan[3], China[4], Mongolia[5], and Russia[5]. GETV can cause fever, body rashes, and leg edema in horses[3], as well as fetal death and reproduction disorders in pigs[6]. Thus, GETV is an important animal pathogen. Although antibodies neutralizing GETV have been identified in human serum samples in Malaysia, northern Australia, and Hainan Province in China[4,7], GETV has not been reported to cause human diseases.

    An arbovirus investigation was conducted in the China-Laos border region (longitude 100°5'E, latitude 21°69'N) in August 2012. Specimens of Armigeres subalbatus collected during this investigation were ground and centrifuged. The obtained supernatant was utilized to inoculate BHK cells and the resulting cytopathic effect (CPE) was monitored[8]. After 32 h, BHK-21 cells infected with YN12031 exhibited an obvious CPE, including rounding up, aggregation, and exfoliation (Figure 1A). This CPE progressed rapidly to the '+++' level (i.e., 75% of the cells became cytopathic) about 48 h post-infection.

    Figure 1.  Biological characteristics of YN12031. (A) Cytopathic effect of YN12031 in BHK-21 cells (200 × magnification). (A1) Control (uninfected BHK-21 cells; 48 h). (A2) Infected BHK-21 cells 48 h post-infection showing rounding and exfoliation. (B) Electron micrographs of YN12031 particles negatively stained with 2% potassium phosphotungstate. (B1) Black arrow indicates an intact particle. (B2) Morphology of virus particles. (C) Plaques formed after inoculation of (C1) 10-4, (C2) 10-5, and (C3) 10-6 dilutions of YN12031. (D) Growth curve of YN12031 in BHK-21 cells.

    BHK cells inoculated with YN12031 were visualized by transmission electron microscopy (TEM)[8]. YN12031 exhibited a typical alphavirus morphology; the virus particles were spherical, 0-70 nm in diameter, enveloped, and featured surface fibers (Figure 1B1). After infection, the BHK cells were centrifuged, sectioned, and visualized by TEM. Virus particles were evident, and the majority were located in cytoplasmic vesicles. Virus particles contained a core with a high electron density (Figure 1B2).

    To understand the plaque morphology and proliferation of YN12031 in tissue culture cells, we first observed the formation of virus plaques in BHK-21 cells and then detected dynamic changes in virus multiplication by plaque assay[9]. The plaques were 1.09 mm (1.15 ± 0.35 mm, n = 10, 2d) in diameter and regular in shape with distinct edges (Figure 1C). Following infection of BHK-21 cells at multiplicity of infeetion (MOIs) of 1 and 2, YN12031 proliferated rapidly about 8-24 h post-infection and reached peak titers of 1 × 107.69 and 1 × 107.55 pfu/mL, respectively. These titers decreased thereafter, reaching minima of 1 × 106.77 and 1 × 105.95 pfu/mL, respectively, at 72 h. Following infection at an MOI of 0.5, the YN12031 titer increased rapidly from 8 h to 16 h. The titer increased slowly from 16 h to 32 h, at which point it peaked (1 × 107.86 pfu/mL). The YN12031 titer decreased slowly afterward, reaching a level comparable with that following infection at an MOI of 1 (1 × 106.76 pfu/mL) at 72 h. These results are shown in Figure 1D.

    BHK-21 cells infected with GETV exhibited an obvious CPE 32 h post-infection, and the CPE level reached '+++' after 48 h. The virus titer peaked 32 h post-infection [1 × 107.86 pfu/mL (MOI = 1/2)] and then decreased gradually (Figure 1D). Previous studieshave reported that BHK-21 cells infected with Sindbis virus (YN87448), the model virus of alphavirus, can exhibit an obvious CPE at 24 h and that the virus titer peaks (1 × 109.5 pfu/mL) at 36 h[10]. By comparison, the CPE caused by infection with Japanese encephalitis virus, a flavivirus with linear positive-sense single-stranded RNA, appears at 48-72 h, and the highest viral titer could reach 1 × 107.1 pfu/mL[9]. These findings reveal that alphaviruses can cause CPEs in tissue culture cells faster than other virus types can.

    Whole-genome amplification of YN12031 was performed using the GETV gene amplification primers described in Table 1. The amplified products were examined by agarose gel electrophoresis, purified using a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA USA), and then sequenced directly. The sequences obtained were assembled, edited, and corrected using SeqMan in DNASTAR[8]. The coding region of YN12031 is 11, 166 nt in length and encodes 3, 720 amino acids. The length of the non-structural gene is 7, 404 nt and located in the region between 79 and 7, 482 nt. The non-structural gene codes four non-structural proteins (NSP1-NSP4) with a total of 2, 467 amino acids. The structural gene is 3, 762 nt in length and located in the region between 7, 527 and 11, 288 nt. This gene encodes a variety of structural proteins (E1, E2, E3, 6K, and capsid protein) with a total of 1, 253 amino acids.

    Table 1.  Primers Used in This Study

    PrimerAmplity RegionOrientationSequence (5'-3')Site in Genome
    GETV-F15'UTR-Nsp1SenseATGGCGGACGTGTGACATCAC1-21
    GETV-R1AntisenseGTAACCTTCGCATGACACCACC909-930
    GETV-F2Nsp1-Nsp2SenseGGCATTTACCTTCCGTGTTTC848-868
    GETV-R2AntisenseTGTGCTTGCGGTGTAACCTTC1710-1730
    GETV-F3Nsp2SenseTAGTGAGCGGCTCTTGTGCTG1610-1630
    GETV-R3AntisenseCCGCACAGTACTACCTTACCTGAC2493-2516
    GETV-F4Nsp2SenseGATGAGGCGTTCGCGTGTCACT2434-2455
    GETV-R4AntisenseGGTAACCGACGATTGGATGGGACT3480-3503
    GETV-F5Nsp2-Nsp3SenseTCTACGTGGCAACATGAACTCG3399-3420
    GETV-R5AntisenseCGTGAATAAGTGGTTCAAGGACTGC4440-4464
    GETV-F6Nsp3SenseGCTGTGGCTAGCATAATTAGTACC4345-4368
    GETV-R6AntisenseTGGGATAGCGCGTATGTCTGT5308-5328
    GETV-F7Nsp3-Nsp4SenseGTCGCCCAACTTAGACAGG5212-5230
    GETV-R7AntisenseTGGTTGGTGGTATGCGTGG6171-6189
    GETV-F8Nsp4SenseCCGATGAGTATGACGCTTATCTGG6071-6094
    GETV-R8AntisenseACTTCCATGTTGACCCAACTC7098-7118
    GETV-F9Nsp4-C ProteinSenseCGCTGCTGAACATTGTCATAG6965-6985
    GETV-R9AntisenseGGTTGTCGATCACACCTTTG7967-7986
    GETV-F10C Protein-E2SenseGATTGCATCTTCGAGGTCAAGC7881-7922
    GETV-R10AntisenseGTGCGTGTTTGTACTGCACTTTG8897-8919
    GETV-F11E2 -6K ProteinSenseTGCGCTATTCGAGGCACGAT8793-8812
    GETV-R11AntisenseATGATTATGGCAGCGAGCGG9861-9880
    GETV-F12E2-E1SenseCCGGTAACACTAGGAGTACTATGC9744-9767
    GETV-R12AntisenseTTGTCATTCAGCGACGTGCCT10712-10732
    GETV-F13E1-3'UTRSenseCCTCAAGTTGTCAAGACCTTCGTC10625-10648
    GETV-R13AntisenseGTAAAATATTAAAAAAACAAATTAGACGCC11661-11690

    Nucleotide and amino acid homology analyses of the GETV coding region (excluding 5' and 3' non-coding sequences) were conducted using MegAlign in DNASTAR (version 5.00) and BioEdit (version 7.0.5.3), respectively[8]. The nucleotide homology of YN12031 with 13 other GETVs obtained from GenBank ranged from 95.9% (Korean isolate South Korea) to 97.7% (Russian isolate LEIV/16275/Mag), and its amino acid homology ranged from 95.4% (Korean isolate South Korea) to 97.0% (Russian isolate LEIV/16275/Mag). The coding region of GETV was clearly relatively conserved. Both the nucleotide and amino acid homology between various strains varied between 95% and 98%, and YN12031 showed the closest relationship with the LEIV/16275/Mag isolate obtained in Russia among other GETV strains studied.

    Twenty-six GETV strains isolated from both China and abroad were selected for homology analysis of the nucleotides and amino acids of the E2 gene. The nucleotide homology between YN12031 and 25 other strains ranged from 93.8% (Malaysia prototype strain MM2021) to 97.4% (Russian isolate LEIV/16275/Mag), and its amino acid homology ranged from 96.0% (Malaysia prototype strain MM2021) to 98.1% (Russian isolate LEIV/16275/ Mag). The homology of YN12031 with the Russian isolate LEIV/16275/Mag was the closest found. GETV isolates used in this study and the sequence identities of the E2 gene are provided in Supplementary Tables 1 and 2, respectively, which are available in BES online.

    Table 1.  GETV Isolates Analyzed in This Study

    StrainDateCountryHostGenebank Accession No
    complete
    sequences
    E2Capsid
    MM20211955MalaysiaC.gelidus-AF339484AF339484
    GETV-SAGV1956JapanmosquitoAB032553AB032553AB032553
    GETV-SAGV-Original1956Japan--AF339483AF339483
    Kochi/01/20052005JapanSus scrofaAY702913AB859822AB859822
    14-I-605-C22014JapanEquus caballusLC079089LC079089LC079089
    14-I-605-C12014JapanEquus caballusLC079088LC079088LC079088
    MI-110-C21978JapanEquus caballusLC079087LC079087LC079087
    MI-110-C11978JapanEquus caballusLC079086LC079086LC079086
    South Korea2004South KoreaswineAY702913AY702913AY702913
    LEIV 16275 Mag2000RussiaAedes spEF631998EF631998EF631998
    LEIV 17741 MPR2000MongoliaCulex spEF631999EF631999EF631999
    M11964China, HainanCulex spEU015061EU015061EF375826
    YN05402005China, YunnanArmigeres subalbatusEU015063EU015063EU015063
    HB02342002China, HebeiCulex tritaeniorhynchus GilesEU015062EU015062EF375825
    SC12102012China, SichuanArmigeres subalbatusLC107870LC107870LC107870
    HB0215-32002China, HebeiCulex tritaeniorhynchus Giles-EU015065EF375824
    QIAG93031993South Koreaswine-KR081240KR081240
    QIAG93021993South Koreaswine-KR081239KR081239
    QIAG93011993South Koreaswine-KR081238KR081238
    GS10-22006China, GansuArmigeres subalbatus-EU015070-
    SH05-172005China, ShanghaiCulex tritaeniorhynchus-EU015069-
    SH05-162005China, ShanghaiCulex tritaeniorhynchus-EU015068-
    SH05-152005China, ShanghaiCulex tritaeniorhynchus-EU015067-
    SH05-62005China, ShanghaiCulex tritaeniorhynchus-EU015066-
    YN05422005China, YunnanArmigeres subalbatus-EU015064-
    YN12031*2012China, YunnanArmigeres subalbatus
    MI-1101978JapanEquus caballus--LC012886
    Miho20142014JapanEquus caballus--LC012884
    YN082008China, YunnanAedes albopictus--JN578104
    Note.*First report of the Getah virus in this study. '-':not available in GenBank.

    Table 2.  Sequence ldentities for the E2 Gene of GETV

    We constructed a phylogenetic tree using the coding region sequences of YN12031 and 10 other alphaviruses-Western equine encephalitis virus, Eastern equine encephalitis virus, Sindbis virus, Chikungunya virus, several Maya Luo virus, BarmahForestvirus, O'Nyong-nyongvirus, Semlikiforestvirus, RossRivervirus and GETV-using the neighbor-joining method (Figure 2A). YN12031 and MM2021, the prototype strain of GETV first isolated in Malaysia in 1955, were included in the same clade, which means YN12031 could be a GETV.

    Figure 2.  Phylogenetic analysis of YN12031. (A) Phylogenetic tree constructed using the coding region sequences of YN12031 and 10 other alphavirus strains. (B) Phylogenetic analysis of the E2 gene sequences of GETV isolates from Malaysia, Japan, South Korea, Russia, and China. (C) Phylogenetic tree constructed using the nucleotide sequences of the GETV capsid protein gene.

    Further phylogenetic analysis of the E2 gene sequences of GETV isolates from Malaysia, Japan, South Korea, Russia, and China demonstrated that the Malaysia prototype strain MM2021 was located at the root of phylogenetic tree. The newly isolated strain YN12031 was identified in the same clade as the LEIV/16275/Mag isolate obtained in Russia (Figure 2B). Phylogenetic analysis of the GETV capsid gene sequences of these strains yielded similar results (Figure 2C).

    In this study, the structural gene (E2) nucleotide and amino acid homologies between the GETV prototype strain isolated in Malaysia in 1955 and other GETVs isolated during the next 60 years were 93.8%-100% and 96.0%-100%, respectively, thus suggesting that the GETV gene is conserved. Phylogenetic analysis of E2 and capsid genes showed that GETVs isolated from different mosquito vectors, pigs, and horses in different countries (or regions), such as China, Japan, Korea, Mongolia, and Russia, from 1964 to 2014 were clustered in the same evolutionary clade. All of the GETVs isolated in Russia (60°N latitude) and Hainan province in China (19°N latitude) where thousands of kilometers apart from each other, and no matter GETVs isolated from specimens of mosquito or host animals (horses, pigs), they were all located at the different positions in the evolutionary branches. No vector, host specificity and geographic distribution characteristic were observed in the distribution of GETVs in the phylogenetic tree.

    GETV was previously isolated form A. subalbatus in Yunnan Province[7], but the newly isolated strain (YN12031) is not located in the same evolutionary branch as two other stains (YN0540, YN0542) isolated from samples of A. subalbatus in the same province (Figure 2B-C), this finding suggests that diverse GETV populations with different evolutionary states exist in A. subalbatus in Yunnan Province. The YN12031 and LEIV/16275/Mag isolates obtained from mosquito specimens in Russia (60°N latitude) are in the same evolutionary branch, and homology analysis of the GETV coding region and E2 gene revealed the very close relationship between YN12031 and LEIV/16275/Mag. These results suggest that GETV could adapt to both tropical environments (Yunnan, China) and frigid zone environments (Russia) to survive and evolve; this characteristic could enable the spread of equine diseases[11] endemic in tropical regions to a wider range or higher latitude (such as Russia). Therefore, strengthening the detection and monitoring of GETV and its infections in temperate and northern frigid zones is essential.

    GETV is an important animal pathogen, and epidemics of GETV infection among horses and pigs have emerged several times across Asia[3,6,11]. A number of GETV strains in China have been geographically isolated across the latitudes 19°N (Hainan Province) to 42°N (Liaoning Province) and longitudes 97°E (Gansu Province) to 124°E (Liaoning Province). GETV can be isolated from Culex[1,7], Aedes[1], Armigeres[7], and Anopheles[1]. Considering this prevalence, GETV and GETV infections present an increasing threat to animal health, particularly horses and pigs, and strengthening the detection and monitoring of GETV in animals is necessary to prevent development of the related animal diseases in China and reduce economic losses.

参考文献 (11)

目录

    /

    返回文章
    返回