HTML
-
The human PCa cell line LNCaP (Cat. No. TCHu173) was obtained from the Chinese Academy of Science Cell Bank (Shanghai, China). Fetal bovine serum (FBS), charcoal-stripped FBS (CS-FBS), RPMI1640 (phenol-red free), and 0.25% Trypsin-EDTA were bought from Gibco (Grand Island, NY). MEHP and dimethylsulfoxide (DMSO) were obtained from Sigma (St. Louis, MO) and TRC (Toronto, Canada) respectively. Gene primers were synthesized by Sangon Biotech (Shanghai, China). The QIAamp® DNA Mini Kitwas from Qiagen (Hilden, Germany). The 5-mC DNA ELISA Kit, Quest 5-hmC™ DNA ELISA Kit, and EZ DNA MethylationTM Kit were from Zymo Research (Orange, California). GoTaq® Hot Start was obtained from Promega (Madison, USA). PyroMark® Gold Q96 Reagents were bought from Qiagen (Germany).
-
LNCaP cells were cultured in RPMI1640 containing 10% FBS in a humidified atmosphere of 5% CO2 at 37 ℃. The cells were seeded in 100-mm dishes at a density of 1 × 106 cells per dish and treated with MEHP (0, 1, 5, 10, and 25 μmol/L) in CS-FBS medium for 3 days, as described previously[11]. The equivalent volume of DMSO (final concentration ≤ 0.1%) served as the vehicle.
-
Genomic DNA was extracted using the QIAamp® DNA Mini Kit according to the manufacturer's recommended protocol. The concentration and quality of DNA were assayed with a NanoDrop 2000 spectrophotometer (Thermo Fisher, Inc.). The obtained DNA was stored at -80 ℃ until further use.
-
The percentage of 5-mC (%) and 5-hmC (%) in genomic DNA was assessed using the 5-mC DNA ELISA Kit and Quest 5-hmC™ DNA ELISA Kit respectively according to the manufacturer's protocol. Briefly, 100 ng of genomic DNA was denatured and incubated with a mix consisting of anti-5-mC or anti-5-hmC monoclonal antibodies and the corresponding secondary antibodies. The absorbance at 405 nm was measured using an ELISA plate reader. The percentage of 5-mC (%) and 5-hmC (%) was separately calculated using the standard curve equation and the DNA controls in the same experiment.
-
DNA methylation was evaluated using bisulfite-converted DNA by pyrosequencing, a quantitative assay based on PCR. A total of 500 ng DNA was modified by using the Zymo EZ DNA Methylation Kit. The bisulfite-converted DNA was eluted in 30 μL of M-Elution buffer and stored at -20 ℃ until analysis. Then the DNA was amplified using GoTaqR Hot Start Polymerase to generate PCR-amplified templates; the primers are shown in Table 1. The bisulfite-converted DNA of SMO was amplified by nested PCR. The primers, SMObis1 and SMObis2, were used for the outer and inner PCRs respectively. The biotinylated PCR product underwent pyrosequencing using PyroMark Gold Q96 Reagents in the PyroMark Q96 ID Pyrosequencing System (Qiagen, Germany). The methylation value was calculated as the percentage of cytosine bases that are methylated at each CpG site. The percentage of methylated cytosines was quantified for four CpG sites in PTCH and six CpG sites in SMO. The methylation (%) of each CpG site and the average methylation (%) of all studied CpG sites were calculated.
Items PTCH[18] SMO[19] PCR primers F:GGGGATAGAATGGTTTAG
R:Biotin-ACTCCAAAAACTACTACTSMObis1 F:GAYGATTTTAGATTAAGTAAGGTGTT
R:TCCCACCATTAAAACCACCT
SMObis2 F:TTYGTGTATTTTAGAGAGTTTAG
R:Biotin-TCCCACCATTAAAACCACCTAnnealing
temperatures52.0 ℃ 55.6 ℃ (SMObis1)
53.6 ℃ (SMObis2)Pyrosequencing
primersAGGAGTATAAGAAAGTAGAGTT GAGTTAGAGTAATAAAGGAGT Analyzed sequences
and regionsAGTAGTTATYGYGAATTTAGTAGTTAGAGTTYGAGTA
GTTYGA (from -310 to -269 bp)aGGTYGTYGGYGGGGAGAGTTYGGGGGGTTGYGGYG
(from -479 to -445 bp)aNote. aThe transcription initiation sites of PTCH and SMO were separately designated as 0. YG indicates the detected CpG site. Table 1. PCR and Pyrosequencing Primers for PTCH/SMO CpG Site Amplification and Analysis (5'-3')
-
The methylation levels (%) were presented as the mean ± standard deviation (SD) values from triplicate experiments. For group comparisons, one-way analysis of variance (ANOVA) followed by Bonferroni's test was performed using SPSS Statistics software (version 19.0, IBM, Inc.) for statistical data analysis. The correlations between the DNA methylation of PTCH and SMO and gene expression were tested separately using Pearson correlation. Differences were considered significant at P values < 0.05. Plotting of the figures was performed using the GraphPad Prim 5 software package (GraphPad Software, Inc.).
Cells and Reagents
LNCaP Cell Culture and Treatment with MEHP
DNA Extraction
Quantification of 5-mC and 5-hmC
Bisulfite Modification, PCR, and Pyrosequencing for DNA Methylation
Statistical Analysis
-
The methylation status of LNCaP cells treated with MEHP was detected for 3 days because our previous findings showed that MEHP can regulate the expression of PTCH and SMO after 3 days of treatment. The effects of MEHP on genomic methylation (including the content of 5-mC and 5-hmC) in LNCaP cells were also tested. The proportion of 5-mC (%) detected in the control group was 2.28% ± 0.09%. Compared to that in the control, the amount of 5-mC (%) significantly decreased in the groups treated with MEHP (1, 5, 10, and 25 μmol/L) for 3 days (P < 0.01), decreasing by 28.16% in the group treated with 25 μmol/L MEHP (Figure 1A). However, the proportion of 5-hmC (%) in the control group was 0.06% ± 0.01%. Compared to after the control treatment, there was no significant difference in the percentage of 5-hmC (%) after treatment with MEHP (1, 5, 10, and 25 μmol/L) for 3 days (Figure 1B).
Figure 1. Effect of MEHP on the amount of 5-mC and 5-hmC in LNCaP cells. Cells were treated with MEHP (0, 1, 5, 10, and 25 μmol/L) for 3 days. Then the proportion of cytosines with 5-mC (A) and 5-hmC (B) was assessed in LNCaP cells. Bars represent the mean ± SD values from triplicate experiments. (**P < 0.01, compared to the CS-FBS control group).
-
In the CS-FBS control group, the mean methyla-tion levels of PTCH in CpG 1, CpG 2, CpG 3, and CpG 4 were 6.35% ± 1.03%, 4.25% ± 2.10%, 9.13% ± 2.27%, and 6.60% ± 0.62% respectively. Compared to the control, there were no significant changes in the methylation levels of each CpG site in groups treated with MEHP (1, 5, 10, and 25 μmol/L). Moreover, the average methylation of all of the studied CpG sites of PTCH also showed no significant differences (Figure 2). Interestingly, compared to the CS-FBS control, the methylation levels of each CpG site in SMO showed significant differences following MEHP treatment (Figure 3). Moreover, the average methylation level of the six studied CpG sites in SMO in the CS-FBS control was 14.76% ± 0.54%. Compared to the control, there were also significant changes in the average methylation levels of SMO and the methylation levels were observably upregulated after treatment with MEHP doses of 5 and 10 μmol/L.
Figure 2. Effect of MEHP on the DNA methylation of PTCH. The methylation (%) of each of the four CpG sites in PTCH and the average methylation (%) of all of the studied CpG sites were calculated. Results are presented as the mean ± SD values from triplicate experiments.
Figure 3. Effect of MEHP on the DNA methylation of SMO. The methylation (%) of each of the six CpG sites in SMO and the average methylation (%) of all of the studied CpG sites were calculated. Results are presented as the mean ± SD values from triplicate experiments. (*P < 0.05 and **P < 0.01, compared to the CS-FBS control group)
-
To explore the relationship between DNA methylation and the genetic expression of PTCH and SMO, the methylation levels of these genes were compared with their mRNA expression levels at day 3 of treatment with MEHP. Correlation analysis showed that there were no significant correlations between DNA methylation and the expression of PTCH and SMO under treatment with MEHP (Table 2).
Item Pearson Coefficient PValue PTCH CpG 1 0.168 0.788 CpG 2 0.537 0.351 CpG 3 0.000 1.000 CpG 4 0.577 0.308 Average 0.164 0.792 SMO CpG 1 -0.234 0.705 CpG 2 0.064 0.919 CpG 3 0.405 0.499 CpG 4 0.711 0.178 CpG 5 0.494 0.397 CpG 6 -0.048 0.938 Average 0.400 0.504 Note. aThe correlation coefficients between the gene methylation levels and gene expression when treated with MEHP for 3 days were analyzed by Pearson' correlation test. Table 2. Correlation between Methylation and PTCH and SMO Expression under MEHP Treatmenta