Volume 31 Issue 5
May  2018
Turn off MathJax
Article Contents

CHU Mei Fen, LIU Xiao Xiang, ZHANG Shao Ni, HUANG Yan Ying, DU Peng, WANG Li Fang, JI Lei, YAN Jie, SUN Ai Hua. Molecular Characterization and Correlation with β-lactam Resistance of Streptococcus pneumonia Isolates in Hangzhou, China[J]. Biomedical and Environmental Sciences, 2018, 31(5): 389-393. doi: 10.3967/bes2018.050
Citation: CHU Mei Fen, LIU Xiao Xiang, ZHANG Shao Ni, HUANG Yan Ying, DU Peng, WANG Li Fang, JI Lei, YAN Jie, SUN Ai Hua. Molecular Characterization and Correlation with β-lactam Resistance of Streptococcus pneumonia Isolates in Hangzhou, China[J]. Biomedical and Environmental Sciences, 2018, 31(5): 389-393. doi: 10.3967/bes2018.050

Molecular Characterization and Correlation with β-lactam Resistance of Streptococcus pneumonia Isolates in Hangzhou, China

doi: 10.3967/bes2018.050
More Information
  • Author Bio:

    CHU Mei Fen, female, born in 1965, Associate Professor, majoring inclinical laboratory medicine

    LIU Xiao Xiang, female, born in 1982, Associate Professor, majoring in mechanism study of antibiotic resistance in bacteria

  • Corresponding author: YAN Jie, E-mail:Med_bp@zju.edu.cn; SUN Ai Hua, E-mail:aihuasun@126.com
  • Received Date: 2017-10-14
  • Accepted Date: 2018-03-08
  • Penicillin-binding proteins (PBPs) are the target of β-lactam antibiotics (the major treatment for Streptococcus pneumoniae infections), and mutations in PBPs are considered as a primary mechanism for the development of β-lactam resistance in S. pneumoniae. This study was conducted to investigate the mutations in the PBPs of clinical S. pneumoniae isolates in Hangzhou, China, in correlation with β-lactam resistance. Results showed that 19F was the predominant serotype (7/27) and 14 of the S. pneumoniae isolates were resistant to both penicillin G and cephalosporin. Genotyping results suggested that β-lactam-resistant isolates primarily exhibited single-site mutations in both the STMK and SRNVP motifs of pbp1a in combination with double-site mutations in the STMK motif of pbp2x, which might be the primary mechanisms underlying the β-lactam resistance of the isolates in this study.
  • 加载中
  • [1] Yao K, Yang Y. Streptococcus pneumoniae diseases in Chinese children: Past, present and future. Vaccine, 2008; 26, 4425-33. doi:  10.1016/j.vaccine.2008.06.052
    [2] Song JH, Jung SI, Ko KS. High prevalence of antimicrobial resistance among clinical Streptococcus pneumoniae isolates in Asia. Antimicrob Agents Chemother, 2004; 48, 2101-7. doi:  10.1128/AAC.48.6.2101-2107.2004
    [3] Macheboeuf P, Di Guilmi AM, Job V, et al. Active site restructuring regulates ligand recognition in class A penicillin-binding proteins. Proc Natl Acad Sci, 2005; 102, 577-82. doi:  10.1073/pnas.0407186102
    [4] Zerfass I, Hakenbeck R, Denapaite D. An important site in PBP2x of penicillin-resistant clinical isolates of Streptococcus pneumoniae: mutational analysis of Thr338. Antimicrob Agents Chemother, 2009; 53, 1107-15. doi:  10.1128/AAC.01107-08
    [5] Chesnel L, Carapito R, Croizé J, et al. Identical penicillin-binding domains in penicillin-binding proteins of Streptococcus pneumoniae clinical isolates with different levels of beta-lactam resistance. Antimicrob Agents Chemother, 2005; 49, 2895-902. doi:  10.1128/AAC.49.7.2895-2902.2005
    [6] Breakpoints C. CLSI Performance standards for antimicrobial susceptibility testing. Nineteenth informational supplement. CLSI document M100-S21. Wayne, PA: Clinical and Laboratory Standards Institute, 2011.
    [7] Huang S, Liu X, Lao W, et al. Serotype distribution and antibiotic resistance of Streptococcus pneumoniae isolates collected at a Chinese hospital from 2011 to 2013. BMC Infect Dis, 2015; 15, 312-22. doi:  10.1186/s12879-015-1042-5
    [8] Yang F, Xu XG, Yang MJ, et al. Antimicrobial susceptibility and molecular epidemiology of Streptococcus pneumoniae isolated from Shanghai, China. Int J Antimicrob Agents, 2008; 32, 386-91. doi:  10.1016/j.ijantimicag.2008.05.004
    [9] Su LH, Wu TL, Kuo AJ, et al. Antimicrobial susceptibility of Streptococcus pneumoniae at a university hospital in Taiwan, 2000-2007: impact of modified non-meningeal penicillin breakpoints in CLSI M100-S18. J Antimicrob Chemother, 2009; 64, 336-42. doi:  10.1093/jac/dkp209
    [10] Hackel M, Lascols C, Bouchillon Set, et al. Serotype prevalence and antibiotic resistance in Streptococcus pneumoniae clinical isolates among global populations. Vaccine, 2013; 31, 4881-7. doi:  10.1016/j.vaccine.2013.07.054
    [11] Davie TA, Shang W, Bush K, et al. Activity of doripenem and comparator β-lactams against US clinical isolates of Streptococcus pneumoniae with defined mutations in the penicillin-binding domains of pbp1a, pbp2b and pbp2x. J Antimicrob Chemother, 2008; 61, 751-3. doi:  10.1093/jac/dkn004
    [12] Engel H, Mika M, Denapaite D, et al. A low-affinity penicillin-binding protein 2x variant is required for heteroresistance in Streptococcus pneumoniae. Antimicrob Agents Chemother, 2014; 58, 3934-41. doi:  10.1128/AAC.02547-14
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(4)  / Tables(5)

Article Metrics

Article views(2047) PDF downloads(82) Cited by()

Proportional views
Related

Molecular Characterization and Correlation with β-lactam Resistance of Streptococcus pneumonia Isolates in Hangzhou, China

doi: 10.3967/bes2018.050

Abstract: Penicillin-binding proteins (PBPs) are the target of β-lactam antibiotics (the major treatment for Streptococcus pneumoniae infections), and mutations in PBPs are considered as a primary mechanism for the development of β-lactam resistance in S. pneumoniae. This study was conducted to investigate the mutations in the PBPs of clinical S. pneumoniae isolates in Hangzhou, China, in correlation with β-lactam resistance. Results showed that 19F was the predominant serotype (7/27) and 14 of the S. pneumoniae isolates were resistant to both penicillin G and cephalosporin. Genotyping results suggested that β-lactam-resistant isolates primarily exhibited single-site mutations in both the STMK and SRNVP motifs of pbp1a in combination with double-site mutations in the STMK motif of pbp2x, which might be the primary mechanisms underlying the β-lactam resistance of the isolates in this study.

CHU Mei Fen, LIU Xiao Xiang, ZHANG Shao Ni, HUANG Yan Ying, DU Peng, WANG Li Fang, JI Lei, YAN Jie, SUN Ai Hua. Molecular Characterization and Correlation with β-lactam Resistance of Streptococcus pneumonia Isolates in Hangzhou, China[J]. Biomedical and Environmental Sciences, 2018, 31(5): 389-393. doi: 10.3967/bes2018.050
Citation: CHU Mei Fen, LIU Xiao Xiang, ZHANG Shao Ni, HUANG Yan Ying, DU Peng, WANG Li Fang, JI Lei, YAN Jie, SUN Ai Hua. Molecular Characterization and Correlation with β-lactam Resistance of Streptococcus pneumonia Isolates in Hangzhou, China[J]. Biomedical and Environmental Sciences, 2018, 31(5): 389-393. doi: 10.3967/bes2018.050
  • Streptococcus pneumoniae (S. Pneumoniae) is a common pathogen with a significant morbidity and mortality because of its association with several invasive diseases, including pneumonia, tympanitis, and meningitis. China has a high incidence of S. pneumoniae infections, with children being more susceptible[1]. It has been estimated that China holds the second position in the world in this context, with the incidence of pneumococcal infections being 12% in children aged below 5 years[2].

    β-Lactam antibiotics are the first-line treatment for S. pneumoniae infections. These antibiotics participate in the synthesis of bacterial peptidoglycans by binding to the active site of penicillin-binding proteins (PBPs), followed by the induction of cell death via bacteriolysis[3]. However, in recent years, there have been continuous reports of penicillin-nonsusceptible S. pneumoniae, indicating an increasing trend in the antimicrobial drug resistance of S. pneumoniae, which poses challenges to the diagnosis and therapy of S. pneumoniae infections[2]. Till date, more than 10 types of PBPs have been identified. However, the type and expression levels of PBPs are different among various bacterial species. For S. pneumoniae, six common types of PBP shave been identified, including pbp1a, pbp1b, pbp2a, pbp2b, pbp2x, and pbp3. The transpeptidase domains of PBP molecules contain three motifs, including SXXK, SXNVP, and KT(S)G[4]. It has been recognized that mutations in pbp1a, pbp2b, and pbp2x could attribute to the development of β-lactam resistance in S. pneumoniae. To mention more clearly, mutations in these motifs could reduce the affinity of the bacteria to β-lactam antibiotics, which has been considered as the major mechanism of S. pneumoniae drug resistance[5].

    There are reports regarding the antimicrobial susceptibility and the molecular epidemiology of S. pneumoniae in various cities in China. However, there are variations among the different regions in terms of the serotype distribution and the antibiotic-resistant properties of S. pneumoniae, which has increased the importance of a region-specific study to provide strategic references for the prevention and control of S. pneumoniae infections. However, only a few studies have assessed the characteristics of β-lactam resistance of S. pneumoniae in Hangzhou, China. In this context, the present study was conducted to analyze the drug resistance property of S. pneumoniae isolates against β-lactam antibiotics in Hangzhou, China, with a focus on the mutations in PBPs.

    This study was approved by the ethics committee of Hangzhou Medical College, Hangzhou, Zhejiang, China. A total of 27 S. pneumoniae isolates were collected from patients between 2010 and 2013 from The Affiliated People's Hospital of Hangzhou Medical College. The average age of the patients was 54 years. All the isolates were validated by Gram staining and VITEK 2-Compact System (BioMérieux, France). S. pneumoniae ATCC6306 was used as the quality control. The clinical isolates and S. pneumoniae ATCC6306 were cultured on Columbia agar plates (BioMérieux) at 37 ℃ in the presence of 5% CO2 for 24 h.

    Genomic DNA was extracted from all the isolates and S. pneumoniae ATCC6306 using a commercially available kit (Zoman Biotechnology, China) and then dissolved in TE buffer for quantification by Nanodrop 2000 (ThermoFisher, USA). All the isolates were serotyped by multiple polymerase chain reaction (PCR) and latex agglutination test. Primers used for serotyping are shown in supplementary Table S1 (available in www.besjournal.com), and cpsA was used as the housekeeping gene. Thermal conditions for the multiple PCR were as follows: 94 ℃ for 4 min; 30 cycles at 94 ℃ for 45 s, 54 ℃ for 45 s, 65 ℃ for 2.5 min; and 72 ℃ for 10 min. The PCR products were prestained by ethidium bromide and run in a 1.5% agarose gel electrophoresis. The latex agglutination test was performed for all the S. pneumoniae isolates using a specific kit (Statens Serum Institut, Denmark). Based on the test results, the serotype was characterized using chess board serotyping system, which was indicated in the manual of the kit (Table S2, available in www.besjournal.com).

    Gene Primer (5'→3') Amplicon Length (bp)
    6A/B F:AATTTGTATTTTATTCATGCCTATATCTGG 250
    R:TTAGCGGAGATAATTTAAAATGATGACTA
    9V F:CTTCGTTAGTTAAAATTCTAAATTTTTCTAAG 753
    R:GTCCCAATACCAGTCCTTGCAACACAAG
    14 F:GAAATGTTACTTGGCGCAGGTGTCAGAATT 189
    R:GCCAATACTTCTTAGTCTCTCAGATGAAT
    18C F:CTTAATAGCTCTCATTATTCTTTTTTTAAGCC 573
    R:TTATCTGTAAACCATATCAGCATCTGAAAC
    19A F:GTTAGTCCTGTTTTAGATTTATTTGGTGATGT 478
    R:GAGCAGTCAATAAGATGAGACGATAGTTAG
    19F F:GTTAAGATTGCTGATCGATTAATTGATATCC 304
    R:GTAATATGTCTTTAGGGCGTTTATGGCGATAG
    23F F:GTAACAGTTGCTGTAGAGGGAATTGGCTTTTC 384
    R:CACAACACCTAACACACGATGGCTATATGATTC
    1 F:CTCTATAGAATGGAGTATATAAACTATGGTTA 280
    R:CCAAAGAAAATACTAACATTATCACAATATTGGC
    3 F:ATGGTGTGATTTCTCCTAGATTGGAAAGTAG 371
    R:CTTCTCCAATTGCTTACCAAGTGCAATAACG
    4 F:CTGTTACTTGTTCTGGACTCTCGATAATTGG 430
    R:GCCCACTCCTGTTAAAATCCTACCCGCATTG
    5 F:ATACCTACACAACTTCTGATTATGCCTTTGTG 362
    R:GCTCGATAAACATAATCAATATTTGAAAAAGTATG
    8 F:GATGCCATGAATCAAGCAGTGGCTATAAATC 294
    R:ATCCTCGTGTATAATTTCAGGTATGCCACC
    20 F:GAGCAAGAGTTTTTCACCTGACAGCGAGAAG 514
    R:CTAAATTCCTGTAATTTAGCTAAAACTCTTATC
    7F F:CCTACGGGAGGATATAAAATTATTTTTGAG 826
    R:CAAATACACCACTATAGGCTGTTGAGACTAAC
    10A F:GGTGTAGATTTACCATTAGTGTCGGCAGAC 628
    R:GAATTTCTTCTTTAAGATTCGGATATTTCTC
    11A F:GGACATGTTCAGGTGATTTCCCAATATAGTG 463
    R:GATTATGAGTGTAATTTATTCCAACTTCTCCC
    12F F:GCAACAAACGGCGTGAAAGTAGTTG 376
    R:CAAGATGAATATCACTACCAATAACAAAAC
    15B/C F:TTGGAATTTTTTAATTAGTGGCTTACCTA 496
    R:CATCCGCTTATTAATTGAAGTAATCTGAACC
    17F F:TTCGTGATGATAATTCCAATGATCAAACAAGAG 693
    R:GATGTAACAAATTTGTAGCGACTAAGGTCTGC
    22F F:GAGTATAGCCAGATTATGGCAGTTTTATTGTC 643
    R:CTCCAGCACTTGCGCTGGAAACAACAGACAAC
    33F F:GAAGGCAATCAATGTGATTGTGTCGCG 338
    R:CTTCAAAATGAAGATTATAGTACCCTTCTAC
    cpsA F:GCAGTACAGCAGTTTGTTGGACTGACC 160
    R:GAATATTTTCATTATCAGTCCCAGTC
    Note.1 Bentley SD, Aanensen DM, Mavroidi A, et al. Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet, 2006; 2, e31-8. 2 Pai R, Gertz RE, Beall B. Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates. J Clin Microbiol, 2006; 44, 124-31.

    Table Table S1.  Primers in PCR for Serotyping of S. pneumoniae1, 2

    Gene Primer (5'→3') Amplicon Length (bp)
    pbp2x F:CGCATGAAGTGGACAAAAAGAGTAATC 2, 253
    R:CGCTTAGTCTCCTAAAGTTAATGTAA
    pbp1a F:CGCATGAACAAACCAACGATTCTGCGC 2, 160
    R:CGCTTATGGTTGTGCTGGTTGAGGATTCTG
    pbp2b F:CGCATGAGACTGATTTGTATGAGAAA 2, 058
    R:CGCCTAATTCATTGGATGGTATTTTTG
    pbp2a F:CGCATGAAATTAGATAAATTATTTGAG 2, 196
    R:CGCTTAGCGAAATAGATTGACTATCGT
    pbp1b F:CGCATGCAAAATCAATTAAATGAATTA 2, 466
    R:CGCTTATCGTCTCGCCCTTGAAGAAGA
    pbp3 F:CGCATGAAAAAAATATTTTTAACTTTG 1, 242
    R:CGCTTATAATTTCTCGTTAACAAAGCG

    Table Table S2.  Primers in PCR for Amplification of S. pneumoniae pbps Genes

    Penicillin G and cephalosporin are the two major types of β-lactam antibiotics. Therefore, the susceptibilities of all the isolates and S. pneumoniae ATCC6306 to penicillin G and cefotaxime were tested using E-test strips (BioMérieux, France). The minimum inhibitory concentration (MIC) was recorded.

    Primers used for the amplification of pbpsgenes were designed by Primer 5.0 (Figure S1, available in www.besjournal.com) to amplify pbpsgenes in the isolates. The amplification conditions were as follows: 1) pbp2x and pbp2a: 94 ℃ for 5 min; 30 cycles at 94 ℃ for 30 s, 52 ℃ for 30 s, 72 ℃ for 3 min; and 72 ℃ for 10 min. 2) pbp1a and pbp3: 94 ℃ for 5 min; 30 cycles at 94 ℃ for 30 s, 50 ℃ for 30 s, 72 ℃ for 3 min; and 72 ℃ for 10 min. 3) pbp2b: 94 ℃ for 5 min; 30 cycles at 94 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 3 min; and 72 ℃ for 10 min. 4) pbp1b: 94 ℃ for 5 min; 30 cycles at 94 ℃ for 30 s, 54 ℃ for 30 s, 72 ℃ for 3 min; and 72 ℃ for 10 min. The amplification products were purified using AxyPrep PCR kit (Axygen, USA) according to the instructions and then run in a 1.5% agarose gel electrophoresis.

    Figure S1.  Chessboard serotyping system of S. pneumoniae.

    The purified amplification products of pbps genes were ligated into plasmid pMD19-Tpbps using a T-A cloning kit (Takara, China). The recombinant plasmids were sent to Invitrogen Co., Ltd, Shanghai, China, for sequencing by the chain termination method. The sequencing data of all the clinical isolates were compared with the data of S. pneumoniae ATCC6306 and S. pneumoniae R6 available in Gene Bank using BLAST software. (https://blast.ncbi.nlm.nih.gov/Blast/cgi).

    Using the results of multiple PCR, six serotypes were identified, including 19F (7/28), 3 (5/28), 19A (4/28), 6A/B (2/28), 23F (2/28), and 18C (1/28). In total, 75% (21/28) of all the isolates were serotyped (Figure 1) (Table S3 available in www.besjournal.com). On the other hand, the results of the latex agglutination test suggested that 17 of the isolates were B-pool-positive. According to the instructions of the kit, 4 serotypes could be included in type B pool, including 19F, 19A, 3, and 6A/B, which were the most common serotypes identified by the multiple PCR. The results of the latex agglutination test further confirmed the serotypes identified by the multiple PCR.

    Figure 1.  Results of the 1st and 2nd multiple PCRs for serotyping S. pneumoniae strains.

    Isolate Serotype
    Multiple PCR Latex agglutination test
    ATCC6306 3 B
    SP1 18C A
    SP2 19A B
    SP3 19F B
    SP4 19F B
    SP5 3 B
    SP6 23F H
    SP7 19A B
    SP8 19A B
    SP9 19F B
    SP10 19F B
    SP11 6A/B B
    SP12 3 B
    SP13 3 B
    SP14 19A B
    SP15 19F B
    SP16 23F H
    SP17 19F B
    SP18 3 B
    SP19 N/A H
    SP20 19F B
    SP21 6A/B B
    SP22 N/A N/A
    SP23 N/A N/A
    SP24 N/A N/A
    SP25 N/A N/A
    SP26 N/A N/A
    SP27 N/A N/A
    Note. N/A indicates the serotype can not be identified.

    Table Table S3.  Comparison of Serotyping Effects of Multiple PCR and Latex Agglutination Test

    According to the criteria of the Clinical and Laboratory Standards Institute, the MICs of penicillin G and cefotaxime against S. pneumoniae are ≤ 0.06 and 1 μg/mL, respectively[6]. E-test results of the present study indicated that the MICs of penicillin G and cefotaxime against S. pneumoniae ATCC6306 were ≤ 0.02 and 0.03 μg/mL, respectively, suggesting the susceptibility of S. pneumoniae ATCC6306 to β-lactam antibiotic treatment. Among the 27 clinical isolates, 16 (59.3%) were resistant to penicillin G and 14 (51.9%) were cefotaxime-resistant (Table 1), which was above the average resistance level compared with that reported in other regions in China[1, 7-9]. We also found that all the 7 isolates with the 19F serotype and 3 isolates with the 19A serotype were resistant to both penicillin G and cefotaxime, which was consistent with the results of a previous study that reported that 19F and 19A serotypes had a high resistance rate[7, 10]. In addition, the susceptibility of the tested 27 clinical isolates toward penicillin G and cefotaxime was consistent, except for SP21 and SP23, which were resistant only to penicillin G, but not cefotaxime (Table 1).

    Isolate Serotype Penicillin G R/S Cefotaxime R/S
    MIC (μg/mL) MIC (μg/mL)
    SP1 18C 0.02 S 0.02 S
    SP2 19A 3.00 R 2.00 R
    SP3 19F 2.00 R 2.00 R
    SP4 19F 6.00 R 12.0 R
    SP5 3 0.01 S 0.10 S
    SP6 23F 1.50 R 8.00 R
    SP7 19A 3.00 R 3.00 R
    SP8 19A 6.00 R 2.00 R
    SP9 19F 0.05 S 0.20 S
    SP10 19F 8.00 R 12.0 R
    SP11 6A/B 0.02 S 0.03 S
    SP12 3 0.02 S 0.05 S
    SP13 3 0.02 S 0.02 S
    SP14 19A 0.02 S 0.03 S
    SP15 19F 1.00 R 16.0 R
    SP16 23F 3.00 R 2.00 R
    SP17 19F 3.00 R 3.00 R
    SP18 3 0.01 S 0.02 S
    SP19 N/A 0.06 S 0.20 S
    SP20 19F 0.02 S 0.02 S
    SP21 N/A 0.09 R 1.00 S
    SP22 N/A 2.00 R 2.00 R
    SP23 N/A 0.20 R 0.30 S
    SP24 N/A > 32 R > 32 R
    SP25 N/A 6.00 R 8.00 R
    SP26 N/A 2.00 R 16.0 R
    SP27 N/A 0.02 S 0.02 S
    Note. R indicates resistance and S indicates susceptibility.

    Table 1.  Results of E-test of S. pneumoniae Isolates

    Amplicons of pbp1a, pbp1b, pbp2a, pbp2b, pbp2x, and pbp3 could be obtained for S. pneumoniae ATCC6306 and for all the 27 clinical isolates, indicating that all the six pbps genes are coded in the genome of all the tested strains (Figure S2, available in www.besjournal.com). However, due to some issues during storage, only 18 of the 27 clinical isolates could be revived successfully for sequencing. Therefore, these 18 strains comprising 8 susceptible strains (SP1, SP5, SP9, SP11, SP12, SP13, SP14, and SP18) and 10 resistant strains (SP2, SP3, SP4, SP6, SP7, SP8, SP10, SP15, SP16, and SP17) were included in further study to determine the potential relationship between pbps gene mutations and β-lactam resistance. The sequencing data of each tested strain were compared with the corresponding sequencing data of S. pneumoniae R6 or S. pneumoniae ATCC6306 strains that were susceptible to penicillin G and cefotaxime.

    Figure S2.  Amplification segments of six pbps genes of S. pneumoniae.

    It has been reported that three motifs, including SXXK, SXN, and KT(S)G, comprise a transpeptidase super family among the PBPs of S. pneumoniae. SXXK, SXN, and KT(S)G are potential binding sites of β-lactam antibiotics, and mutations in these motifs may result in drug resistance[5]. The sites of SXXK, SXN, and KT(S)G in each protein among the PBP family of S. pneumoniae R6 are presented in Figure S3 (available in www.besjournal.com). Compared with S. pneumoniae R6, the sequences of SXXK, SXNVP, and KT(S)G in S. pneumoniae ATCC6306 were all similar (Figures S4-S9, available in www.besjournal.com). These sequencing results indicated that there was no mutation in the motifs of pbp1b, pbp2a, pbp2b, or pbp3 among all the 10 resistant strains in the present study (Figures S5-S9, available in www.besjournal.com), suggesting that the motifs in these four proteins might not play crucial roles in the development of β-lactam resistance.

    Figure S3.  Domains and motifs in PBPs of S. pneumoniae strain R6.

    In contrast, there were mutations in these motifs of pbp1a or pbp2x. Specifically, mutations in STMK and SRNVP were present in pbp1a and a mutation in STMK was present in pbp2x. However, neither KT(S)G of pbp1a nor SRNVP or KT(S)G of pbp2x was mutated (Table 2) (Figures S4, S8, available in www.besjournal.com). Four of the resistant isolates (SP2, SP3, SP8, and SP16) had mutations in STMK (T317A) and SRNVP (P432T) of pbp1a as well as mutations in STMK (T338A) of pbp2x at the same time (Table 2, Figures S4, S8). In addition, five resistant isolates (SP4, SP6, SP10, SP15, and SP17) had mutations in STMK (T317A) and SRNVP (P432T) of pbp1a as well as mutations in STMK (T338A and M339F) of pbp2x at the same time (Table 2, Figures S4, S8). There was one resistant isolate (SP7) with a mutation in STMK at the site of T338A in pbp2x only (Table 2, Figures S4, S8). Regarding the susceptible isolates, no mutation was observed in the motifs of pbp1a or pbp2x, except for SP9, which was coupled with the mutation of STMK at the sites of T338A and M339F in pbp2x (Table 2, Figures S4, S8). It is worth to notice that mutations inT371A and P432T of pbp1a and T338A of pbp2x have already been reported[11]. It was also found that there was no mutation in pbp1a or pbp2x among all the isolates susceptible topenicillin G and cefotaxime, except for SP9, which was coupled with the mutation in STMK in pbp2x at the sites of T338A and M339F. Since the only mutation in pbp2x might not lead to drug resistance[12], it might be the reason for the susceptibility of SP9 to penicillin G or cefotaxime treatment. Altogether, although single-site or double-site mutations were present in the motifs of STMK and SRNVP in pbp1a and pbp2x, there were only three forms of mutations, including T-to-A, P-to-T, and M-to-F. Nevertheless, due to the limited number of sample in this study, further investigations are required to confirm the relationship between the mutations in pbp1a and pbp2x and the β-lactam resistance of S. pneumoniae.

    Isolate Serotype pbp1a pbp2x
    370-STMK-373 428-SRNVP-432 337-STMK-340
    ATCC6306 3 N/A N/A N/A
    SP2 19A T371A P432T T338A
    SP3 19F T371A P432T T338A
    SP4 19F T371A P432T T338A, M339F
    SP6 23F T371A P432T T338A, M339F
    SP7 19A N/A N/A T338A
    SP8 19A T371A P432T T338A
    SP10 19F T371A P432T T338A, M339F
    SP15 19F T371A P432T T338A, M339F
    SP16 23F T371A P432T T338A
    SP17 19F T371A P432T T338A, M339F
    Note. N/A indicates no mutation at the specific site.

    Table 2.  SXXK and SXNVP Motif Mutations in pbp1a and pbp2x of β-lactam-Resistant S. pneumoniae Isolates

    In conclusion, the S. pneumoniae isolates from Hangzhou, China, exhibited high resistance rate to penicillin G and cefotaxime. 19F was the predominant serotype of the isolates. All the β-lactam-resistant isolates had no mutation in SXXK, SXNVP, and KT(S)G in pbp1b, pbp2a, pbp2b, or pbp3. Instead, STMK and SRNVP in pbp1a and pbp2x were mutated primarily exhibiting a single-site mutation in both the STMK and the SRNVP motifs of pbp1a combined with double-site mutations in the STMK motif of pbp2x. The results of this study could help provide strategies for the prevention and control of S. pneumoniae infections in Hangzhou, China.

    No conflict of interest to declare.

    CHU Mei Fen and LIU Xiao Xiang: contributed equally to this work, they collected the samples and carried out the molecular tests, participated in the statistical analysis, and drafted the manuscript. ZHANG Shao Ni and HUANG Yan Ying: performed drug sensitive test. DU Peng: participated in bioinformatics analysis. WANG Li Fang: participated in sample collection and helped to draft the manuscript. JI Lei: participated in the molecular tests and the statistical analysis. YAN Jie: participated in the design of the study and helped to draft the manuscript. SUN Ai Hua: designed and coordinated the study and helped to draft the manuscript.

Funds:

the National Natural Sciences Foundation of China 81772232

Reference (12)

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return