-
Wild-type AB strain zebrafish were raised according to the methods described by Westerfield[28]. Zebrafish embryos were incubated in a dish, and larvae (14 d post fertilization, dpf) were housed in a recirculating tank system on a 14 h/10 h light/dark cycle. Water quality was maintained at 28.5 °C (pH 7.2–7.6; salinity 0.03%–0.04%). All procedures in this study were approved by the Key Laboratory of Zebrafish Modeling and Drug Screening for Human Diseases Institute, Southern Medical University (Guangzhou, China).
-
Thirty embryos [< 1 h post fertilization (hpf)] were exposed to toluene (0, 1, 2, or 4 mmol/L; Sigma-Aldrich, St. Louis, MO, USA) in zebrafish medium (3.50 g/L NaCl, 0.05 g/L KCl, 0.05 g/L NaHCO3, and 0.10 g/L CaCl2), with three replicates. To maintain the toluene concentration, embryos were incubated in 25 cm2 airtight flasks (ten embryos per flask) with air exchange once a day. Abnormal and dead zebrafish embryos/larvae were monitored, while hatched larvae were counted at 48 and 72 hpf. As described earlier, the morphological characteristics of the larvae were checked with a microscope to identify the abnormal fish[29]. The rates of malformation, death, and hatching were evaluated every 24 h by the ratio of counted numbers/total exposed numbers × 100, and the assessment stopped at 120 hpf. Embryos prepared for qPCR were collected at 72 hpf, immediately frozen in liquid nitrogen, and stored at −80 °C until RNA extraction.
-
The locomotion activities of larvae were monitored and recorded by a ViewPoint Zebrabox behavior testing system (ViewPoint Life Sciences, Lyon, France) as described by Chen et al.[30]. Larvae at 6 dpf (12 larvae per treatment) with no obvious abnormal phenotypes were transferred to a 96-well plate (1 fish per well) and incubated at 28 °C for 30 min before locomotion behavior assessment. The spontaneous movements of larvae were observed over a period of 20 min. Three independent experiments were performed.
-
The fluorescent labeling of zebrafish hair cells was performed following a previously established method[31, 32]. Three dpf larvae were first euthanized by 0.5 mmol/L tricaine (TCI, Tokyo, Japan) and then fluorescently labeled in an embryo medium containing 1 μmol/L YO-PRO-1 (Invitrogen, Carlsbad, CA, USA) for 1 h with ten larvae per tube to quantify the anatomic damage to zebrafish lateral line hair cells. After fixation in 2% paraformaldehyde for 1 h at room temperature (25 ℃) and storage overnight in phosphate-buffered saline at 4 °C, larvae were mounted in 4%–6% methylcellulose (TCI) and identified with a fluorescence stereomicroscope (Olympus Corporation, Tokyo, Japan). The relative fluorescence levels of each group were manually measured using ImageJ software[33]. Three independent experiments were performed.
-
Larvae were collected at 72 hpf, and total RNA was isolated using a RNAiso Plus kit (TaKaRa, Dalian, China) and transcribed to cDNA with a PrimeScript RT reagent kit with gDNA Eraser (Transgen Biotech, Beijing, China). RNA quality and quantity were checked with a Nanodrop-2000 (ThermoFisher Scientific, MA, USA). Relative levels of gene expression were measured by qPCR and were normalized to gapdh expression. qPCR was performed on a Lightcycle 96 (Roche, Basel, Switzerland) using a SYBR Green polymerase chain reaction core reagent kit (Transgen Biotech, Beijing, China) according to the manufacturer's instructions. The primers used for the gene amplification are shown in Table 1. To ensure the consistency of the results, the biological tests were performed at least in triplicate, using a total of ≥ 30 embryos or larvae per group.
Name Full name Primer type Primer sequence (5′–3′) cd164l2 CD164 sialomucin-like 2 forward AGCACCTATGAAACTATTGA reverse TTTGGTTGAACTATCCCT chrna9 cholinergic receptor, nicotinic, alpha 9 forward GGAGTCGGCTACCTTCAC reverse CACCTTGGCAACCTTCTT gapdh glyceraldehyde-3-phosphate dehydrogenase forward TCTGACAGTCCGTCTTGAGAAA reverse ACAAAGTGATCGTTGAGAGCAA myo6b myosin VIb forward TTGCGCAGAGATGCTACCAC reverse CAGCTCAGCGTACTTCCACT myo15ab myosin XVAb forward CGCCTGCTCTACATTCTC reverse GTAAACACTCCTGCCACC otofb otoferlin b forward TCCAGGCTTAGACCAAA reverse GAGGAGCGATGCTTATT pcsk5a proprotein convertase subtilisin/kexin type 5a forward GACGGCACTGTTTATCGC reverse GTCCTCCTGTTCATCTCCTA slc17a8 solute carrier family 17, member 8 forward AACTAGCGGCTAACAGGGTG reverse AAGCGGAGGAGCCCATTTAC tekt3 tektin 3 forward ACCATCTCCGAAACACCT reverse ATCCGTGAACTTTGACCAG tmc2a transmembrane channel-like 2a forward ACCACAGTGGGAGTAGAGT reverse AGCACCAGCAATAGTTCA Table 1. Primers for q-PCR
-
Locomotion data are presented as the mean ± standard error. qPCR data are shown as the mean ± standard deviation. After the homogeneity of variance tests, measurement data were analyzed using one-way analysis of variance with Bonferroni’s multiple comparisons correction (equal variances assumed) and Dunnett's T3 multiple comparisons (equal variances were not assumed) using SPSS 20.0 software. A P value of < 0.05 was considered statistically significant.
Effects of Toluene on the Development of the Inner Ear and Lateral Line Sensory System of Zebrafish
doi: 10.3967/bes2021.016
- Received Date: 2020-06-12
- Accepted Date: 2020-03-14
-
Key words:
- Toluene /
- Ototoxicity /
- Zebrafish /
- Lateral line sensory system
Abstract:
Citation: | LI Xu Dong, TU Hong Wei, HU Ke Qi, LIU Yun Gang, MAO Li Na, WANG Feng Yan, QU Hong Ying, CHEN Qing. Effects of Toluene on the Development of the Inner Ear and Lateral Line Sensory System of Zebrafish[J]. Biomedical and Environmental Sciences, 2021, 34(2): 110-118. doi: 10.3967/bes2021.016 |