Volume 35 Issue 1
Jan.  2022
Turn off MathJax
Article Contents

ZHANG Yi Quan, MA Li Zhi, GAO Yue, QIN Qin, LI Jie, LOU Jing, ZHANG Miao Miao, XUE Xing Fan, KAN Biao, GAO He. Master Quorum Sensing Regulator HapR Acts as A Repressor of the Mannitol Phosphotransferase System Operon in Vibrio cholerae[J]. Biomedical and Environmental Sciences, 2022, 35(1): 69-72. doi: 10.3967/bes2022.009
Citation: ZHANG Yi Quan, MA Li Zhi, GAO Yue, QIN Qin, LI Jie, LOU Jing, ZHANG Miao Miao, XUE Xing Fan, KAN Biao, GAO He. Master Quorum Sensing Regulator HapR Acts as A Repressor of the Mannitol Phosphotransferase System Operon in Vibrio cholerae[J]. Biomedical and Environmental Sciences, 2022, 35(1): 69-72. doi: 10.3967/bes2022.009

Master Quorum Sensing Regulator HapR Acts as A Repressor of the Mannitol Phosphotransferase System Operon in Vibrio cholerae

doi: 10.3967/bes2022.009
More Information
  • Author Bio:

    ZHANG Yi Quan, male, born in 1985, PhD, Associate Professor, majoring in gene regulation of pathogenic bacteria

  • Corresponding author: KAN Biao, E-mail: kanbiao@icdc.cn; GAO He, E-mail: gaohe@icdc.cn
  • Received Date: 2021-07-17
  • Accepted Date: 2021-10-19
  • 加载中
  • [1] Deutscher J, Aké FM, Derkaoui M, et al. The bacterial phosphoenolpyruvate: carbohydrate phosphotransferase system: regulation by protein phosphorylation and phosphorylation-dependent protein-protein interactions. Microbiol Mol Biol Rev, 2014; 78, 231−56. doi:  10.1128/MMBR.00001-14
    [2] Kumar S, Smith KP, Floyd JL, et al. Cloning and molecular analysis of a mannitol operon of phosphoenolpyruvate-dependent phosphotransferase (PTS) type from Vibrio cholerae O395. Arch Microbiol, 2011; 193, 201−8. doi:  10.1007/s00203-010-0663-8
    [3] Ymele-Leki P, Houot L, Watnick PI. Mannitol and the mannitol-specific enzyme IIB subunit activate Vibrio cholerae biofilm formation. Appl Environ Microbiol, 2013; 79, 4675−83. doi:  10.1128/AEM.01184-13
    [4] Chang H, Replogle JM, Vather N, et al. A cis-regulatory antisense RNA represses translation in Vibrio cholerae through extensive complementarity and proximity to the target locus. RNA Biol, 2015; 12, 136−48. doi:  10.1080/15476286.2015.1017203
    [5] Zhou YY, Zhang HZ, Liang WL, et al. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae. Biomed Environ Sci, 2013; 26, 831−40.
    [6] Ball AS, Chaparian RR, Van Kessel JC. Quorum sensing gene regulation by LuxR/HapR master regulators in vibrios. J Bacteriol, 2017; 199, e00105−17.
    [7] Zhang YQ, Qiu YF, Tan YF, et al. Transcriptional regulation of opaR, qrr2-4 and aphA by the master quorum-sensing regulator OpaR in Vibrio parahaemolyticus. PLoS One, 2012; 7, e34622. doi:  10.1371/journal.pone.0034622
    [8] Gao H, Xu JL, Lu X, et al. Expression of hemolysin is regulated under the collective actions of HapR, Fur, and HlyU in Vibrio cholerae El Tor serogroup O1. Front Microbiol, 2018; 9, 1310. doi:  10.3389/fmicb.2018.01310
    [9] Gao H, Wang H, Qin Q, et al. Transcriptional regulation of the mannitol phosphotransferase system operon by the ferric uptake regulator (Fur) in Vibrio cholerae El Tor Serogroup O1. Res Microbiol, 2021; 172, 103848. doi:  10.1016/j.resmic.2021.103848
    [10] Liang WL, Pascual-Montano A, Silva AJ, et al. The cyclic AMP receptor protein modulates quorum sensing, motility and multiple genes that affect intestinal colonization in Vibrio cholerae. Microbiology (Reading), 2007; 153, 2964−75. doi:  10.1099/mic.0.2007/006668-0
  • Supplementary Materials21236.pdf
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(5)  / Tables(1)

Article Metrics

Article views(1447) PDF downloads(37) Cited by()

Proportional views
Related

Master Quorum Sensing Regulator HapR Acts as A Repressor of the Mannitol Phosphotransferase System Operon in Vibrio cholerae

doi: 10.3967/bes2022.009
ZHANG Yi Quan, MA Li Zhi, GAO Yue, QIN Qin, LI Jie, LOU Jing, ZHANG Miao Miao, XUE Xing Fan, KAN Biao, GAO He. Master Quorum Sensing Regulator HapR Acts as A Repressor of the Mannitol Phosphotransferase System Operon in Vibrio cholerae[J]. Biomedical and Environmental Sciences, 2022, 35(1): 69-72. doi: 10.3967/bes2022.009
Citation: ZHANG Yi Quan, MA Li Zhi, GAO Yue, QIN Qin, LI Jie, LOU Jing, ZHANG Miao Miao, XUE Xing Fan, KAN Biao, GAO He. Master Quorum Sensing Regulator HapR Acts as A Repressor of the Mannitol Phosphotransferase System Operon in Vibrio cholerae[J]. Biomedical and Environmental Sciences, 2022, 35(1): 69-72. doi: 10.3967/bes2022.009
  • The phosphoenolpyruvate (PEP): carbohydrate phosphotransferase system (PTS) is widely used by bacteria to take up sugars or sugar derivatives [1]. PTS is usually composed of a histidine protein (HPr), enzyme I (EI), and several enzyme II (EII) proteins, such as EIIA, EIIB, EIIC, and EIID [1]. PEP, HPr, and one of several EIIA and EIIB pairs form a phosphorylation cascade where PEP acts as a phosphoryl donor [1]. PEP transfers a phosphoryl group to HPr, which then phosphorylates EIIA. The phosphorylated EIIA transfer the phosphoryl group to EIIB. The phosphorylated EIIB finally phosphorylates the membrane-spanning protein EIIC or EIID, which then facilitates the transport of sugars into bacterial cells.

    Vibrio cholerae, the causative agent of cholera, can utilize mannitol with the aid of PEP: PTS encoded by an mtlADR operon [2]. mtlA encodes the mannitol-specific EIICBA component (EIIMtl), mtlD encodes mannitol-1-phosphate-5-dehydrogenase, and mtlR encodes an mtlADR repressor [2]. MtlA is required for V. cholerae biofilm formation in the absence of mannitol [3]. In addition, mtlADR transcription is repressed by sRNA MtlS and the ferric uptake regulator (Fur), but it is activated by the cAMP receptor protein (CRP) [4, 5]. However, as a mannitol transport system, MtlADR expression should be strictly controlled by complex regulatory networks.

    Quorum sensing (QS) is a cell-to-cell communication process widely used by bacteria to regulate gene expression in response to changes in bacterial cell density [6]. QS usually uses its downstream master regulators to regulate gene expression [6]. LuxR orthologs, which are master QS regulators (MQSR) in Vibrio sp., regulate multiple behaviors, including virulence factors production, biofilm formation, and motility [6]. A 20 bp invert-repeat sequence TATTGATAAA-TTTATCAATA representing the DNA binding box of MQSR was constructed in a previous study [7]. HapR is an LuxR ortholog in V. cholerae. An MQSR box-like sequence ‘TATTGACAAAATAAAAAATA’ was detected within the regulatory DNA region of mtlADR, suggesting that mtlADR transcription is probably under the direct control of HapR in V. cholerae [7]. Therefore, the V. cholerae strain C7258 (wild type, WT), its non-polar hapR mutant (designated ΔhapR) [8], and the complementary mutant (ΔhapR/pBAD24-hapR, designated C-ΔhapR) [8] were employed to investigate the regulatory actions of HapR on mtlADR transcription.

    Fresh colonies of V. cholerae strains on LB agar [1% tryptone (Oxoid), 0.5% yeast extract (Oxoid), 1% NaCl (Merck Millipore), and 1.5% bacto agar (BD biosciences)] were inoculated into a 5-mL LB broth at 37 °C with shaking to grow overnight. The resultant cultures were diluted 50-fold into a 5-mL LB broth; these were statically grown at 37 °C to an OD600 value of about 0.3. Then, the resultant cultures were diluted 30-fold into 5 mL of mannitol fermentation medium (0.5% NaCl, 0.1% tryptone, and 0.2% mannitol; pH 8.0) containing 0.025% phenol red and 100 μg/mL ampicillin. This was statically cultured at 37 °C to investigate their abilities to ferment mannitol by observing the color changes of the medium [9]. As shown in Figure 1, the color of the medium for ΔhapR/pBAD24 (ΔhapR harboring the empty pBAD24 plasmid) culture completely became yellow after 10 h, whereas those for WT/pBAD24 and C-ΔhapR culture manifested no significant color changes after 0 to 12 h relative to the control. The pH values of each culture medium were determined during the mannitol fermentation test [9]. Results showed that the pH values of the mannitol fermentation medium of ΔhapR/pBAD24 dropped gradually over time, whereas those of WT/pBAD24 and C-ΔhapR hardly changed over time (Figure 2). These results indicated that ΔhapR/pBAD24 produced more organic acids than the other two strains.

    Figure 1.  Mannitol fermentation phenotypes. V. cholerae strains were cultured at 37 °C in a mannitol fermentation medium containing phenol red as an indicator. The color of the medium shows purple-red if the pH value is > 7.0, and it turns yellow if the pH value is < 6.5[9]. A blank medium was used as a negative control. The pictures illustrated here represent three independent experiments with three replicates each.

    Figure 2.  pH-time curves of WT/pBAD24, ΔhapR/pBAD24, and C-ΔhapR in mannitol fermentation media. The pH values of each culture medium were measured during the mannitol fermentation test with a 1-h interval. The assay was performed in at least three independent bacterial cultures, with values expressed as the mean ± standard deviation. Paired Student’s t-test was used to calculate the statistical significance, with P < 0.01 considered as significant. The asterisks indicate the statistical significance between ΔhapR/pBAD24 and WT/pBAD24.

    To determine whether the phenotype of hapR mutant that produced more organic acids was related to its growth, the growth curves of WT/pBAD24, ΔhapR/pBAD24, and C-ΔhapR in a mannitol fermentation medium were measured. Results showed that ΔhapR/pBAD24 had a lower growth rate than WT/pBAD24, whereas C-ΔhapR exhibited a restored growth rate (Supplementary Figure S1 available in www.besjournal.com). Thus, the higher level of organic acids produced by the hapR mutant was directly unrelated to its growth.

    Figure S1.   Growth curves of the Vibrio cholerae strains in mannitol fermentation media. WT/pBAD24, ΔhapR/pBAD24, and C-ΔhapR were statically cultured in mannitol fermentation media at 37°C, and the OD600 values for each strain were monitored with a 1-h interval. The experiments were performed at least twice, with three biological replicates for each strain per time.

    The mtlADR operon has been shown to be required for mannitol utilization in V. cholerae [2]. To detect whether HapR had regulatory actions on mtlADR expression, the 558 bp upstream DNA region of mtlADR was cloned into the pBBRlux vector harboring a promoterless luxCDABE reporter gene. The primers used in this study are listed in Supplementary Table S1 available in www.besjournal.com. Then, the recombinant plasmid was transferred into WT and ΔhapR to determine the luminescence activities in each strain. As shown in Figure 3A, the promoter activities of mtlA in both WT and ΔhapR considerably increased with the increase in OD600 from 0.05 to 0.25. Then, these significantly declined with a further increase in cell density. In addition, the promoter activities of mtlA significantly decreased in WT relative to those in ΔhapR at any cell density analyzed, suggesting that HapR acted as a negative regulator of mtlADR expression.

    Figure 3.  Negative regulation of mtlA by HapR. (A) luminescence assay. The promoter DNA region of mtlA was cloned into a pBBRlux vector. Then, it was transferred into V. cholerae strains to determine the luminescence activity of each strain using Infinite® 200 Pro NanoQuant. The lux activity was calculated as light units/OD600 (LU/OD600). The assay was performed in at least three independent bacterial cultures, with values expressed as the mean ± standard deviation. Paired Student’s t-test was used to calculate the statistical significance, with P < 0.01 considered as significant. The asterisks indicate the statistical significance between ΔhapR and WT. (B) DNase I footprinting assay. Fluorescently labeled DNA probes were incubated with increasing quantities of His-HapR (Lanes I, II, and III contain 0, 2.31, and 6.92 pmol, respectively) and were digested with DNase I. The results were analyzed with an ABI 3500XL DNA analyzer. Footprint regions are boxed and marked with positions. The negative numbers represent the nucleotide positions upstream of the first nucleotide of the translation start site of mtlA. WT, wild type.

    TargetPrimers (forward/reverse, 5'-3')
    Protein expression
    hapRGCGGGATCCATGGACGCATCAATCGAAAAAC
    /GCGAAGCTTCTAGTTCTTATAGATACACAG
    DNase I footprinting
    mtlAGTAAAACGACGGCCAGTTTACGTATAGTGTACG
    /CAGGAAACAGCTATGACGTTGGATGTTCCGTTTG
    M13FAM-GTAAAACGACGGCCAGT
    /CAGGAAACAGCTATGAC-HEX
    Luminescence assay
    mtlAGCGGAGCTCGTGCGTATGACATTATCC
    /GCGGGATCCCGCGTCCCCCGTTGGATG

    Table S1.  Oligonucleotide primers used in this study

    To determine whether HapR directly regulated the mtlADR transcription, a DNase I footprinting assay was performed to detect the binding activity of His-HapR on the promoter-proximal DNA fragment of mtlADR in vitro [8, 9]. Results showed that His-HapR protected a single region within the DNA fragment, which was located from 244 to 206 bp upstream of the start codon of mtlADR (Figure 3B). Notably, the HapR site was located far upstream of the transcription start site and -35 element, and it partly overlaps with the CRP site 2 and almost completely overlaps with the Fur site (Supplementary Figure S2 available in www.besjournal.com). It is unclear whether the binding of HapR to the mtlADR promoter can interfere with the binding of CRP and Fur. However, it has been shown that CRR was required for HapR expression [10], whereas HapR acted as a fur repressor [8]. Thus, mtlADR expression should be under the strict regulation of the regulatory circuit composed of CRP, Fur, and HapR, which may lead to the expression of mtlADR always at a reasonable level.

    Figure S2.   Structural organization of the mtlADR promoter. The transcription and translation starts are marked with bent arrows. The Shine-Dalgarno (SD) box and -10/-35 elements are enclosed in boxes. The MQSR box-like sequence is enclosed in a yellow shadowed box. The Fur, CRP, and HapR binding sites (references in[5,9] and the current study) are underlined with solid, dotted, and break point lines, respectively.

    In summary, our data showed that the capacity for mannitol fermentation was significantly enhanced in ΔhapR relative to that in WT and its complementary mutant. The level of organic acids produced by ΔhapR was also enhanced in comparison to that produced by WT or its complementary mutant. The data also showed that HapR can bind to the promoter-proximal DNA region of mtlADR to repress its transcription. Thus, the HapR-dependent regulation of mannitol utilization in V. cholerae was through direct regulation of matlADR transcription. The data presented here provided a deeper understanding of the regulatory network of mtlADR in V. cholerae.

Funds:  This study was supported by grants from the National Natural Science Foundation of China [Grant No. 81471917] and the Science Foundation for the State Key Laboratory for Infectious Disease Prevention and Control of China [Grant No.2015SKLID509]
Reference (10)
Supplements:
Supplementary Materials21236.pdf

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return