HTML
-
Hepatocellular carcinoma (HCC) is the second most common cancer, with 700,000 annual deaths recorded globally [1]. Surgical resection remains the primary treatment[2]. However, the prognosis of hepatectomy is not optimistic, and the postoperative recurrence rate is as high as 70%[3].
As a highly selective α2-adrenergic receptor agonist, Dexmedetomidine (DEX) is widely used in clinic and demonstrated favorable properties such as sedation, analgesia, anti-anxiety, anti-inflammatory, anti-apoptotic, and anti-oxidant. Although DEX is highly safe and has ideal pharmacological properties, we still need to be aware of the potential risks of DEX to avoid serious adverse reactions. New evidence suggests that anesthetic drugs may play a key role in the progression of malignant tumors[4-8].
With the growth of malignant solid tumors, hypoxia in tumor tissues promotes angiogenesis, thereby increasing the probability of metastasis[9,10]. Hypoxia-inducible factor-1 alpha (HIF-1α) regulates stress responses such as inflammation, metabolism, oxygen transfer, and cell survival by mediating the adaptive response of tissues to hypoxia[11-13]. Studies have confirmed[14-16] that HIF-1α is highly expressed in highly aggressive tumors, such as liver cancer, and is closely related to various biological activities in tumors. Liver cancer and other malignant tumor cells adapt to low-oxygen environments by expressing HIF-1α protein at high levels.
In addition to hypoxia, tumor angiogenesis also relies on the perception of hypoxia signals by the tumor-related microenvironment, and promotes the proliferation of vascular endothelial cells by producing chemokines and pro-angiogenic factors such as vascular endothelial growth factor a (VEGFA)[17]. VEGFA is an important regulator of angiogenesis. Several studies have shown that the increase in VEGFA concentration in the peripheral blood of hypoxic patients is closely related to the severity of the disease[18,19]. Researchers have also found that the transcription of HIF-1α can adjust VEGFA and plays a crucial role in activating vascular growth and improving oxygen supply in response to oxygen deficiency, including reduction of tissue deficiency, prevention of apoptosis, and promotion of macrophage migration and inflammatory development[20,21]. VEGFA is an important growth factor that stimulates and induces the formation of blood and lymphatic vessels in malignant tumors and is closely related to the hematogenous and lymphatic metastasis of some malignant tumors [22,23].
Recently, in ischemia-reperfusion injury (IRI) studies, it was found that DEX can upregulate HIF-1α expression to protect ischemic and hypoxic tissues [24-27]. However, its effect on HIF-1α and its downstream VEGFA in response to an oxygen-deficient environment in tumor tissues remains poorly understood.
In the present study, we used SMMC-7721 cells, MHCC97-H cells, and a mouse model of orthotopic hepatic carcinoma to explore the effect of DEX on angiogenesis and VM in HCC and the induction of cellular HIF-1α and VEGFA expression. We assumed that the risk impact on the HIF-1α/VEGFA pathway mediated by DEX might promote tumor angiogenesis and VM formation.
-
SMMC-7721 cells (the Chinese Academy of Sciences, China) and MHCC97-H cells (HangZhou Hibio Technology Co.,LTD, China) were maintained in the 1640 (Gibco, USA) and DMEM medium (Gibco, USA) respectively, with 10% FBS (Gibco, USA) and 1% penicillin-streptomycin solution (Meilunbio, China) as the supplement. Cell lines were cultured in a humidified environment with 5% CO2 and 20% O2 (normoxic groups) or 1% O2 (hypoxic groups) at 37 °C. DEX (Yangtze River, China) with a concentration of 0.5 μg/mL was designated for subsequent experiments, and the α2-AR antagonist yohimbine (Aladdin, China) was used in this study.
-
Animal experiments were carried out in accordance with the National Institutes of Health guidelines and were approved in advance by the Animal Ethical and Welfare Committee of Hibiotech Company (China). Experimental BALB/c nude mice (male, 4–6 weeks, 16–22 g) were purchased from Sleek Experimental Animal Center (China) and fed in the SPF-grade animal center of Hibiotech company. SMMC7721 cells were subcutaneously injected into the mice (5 × 106 cells per mouse). The tumor volume was monitored every three days until the 14th day. The subcutaneous tumor was cut into 1 mm3 sized tissue and inoculated under the left liver envelope of BALB/c nude mice[28]. The mice with successful modeling were randomly divided into low-dose, high-dose, and control groups (n = 8/per group) and intraperitoneally injected with an equal volume of 10 μg/kg, 25 μg/kg DEX, and normal saline respectively each day for consecutive 14 days .
-
Individual wells of the tube formation slide (ibid, Germany) were coated with 250 µL Matrigel (Corning, USA) for 30 min before cell seeding. MHCC97-H and SMMC-7721 cells (2 × 104 cells/well) were seeded in coated wells and incubated for 12 h, 24 h, and 48 h. The tube shapes were photographed using an inverted microscope (Olympus, Japan).
-
When the cell density reached 30%–50%, MHCC97-H and SMMC-7721 cells were cultured in Opti-MEM (Gibco, USA). The siRNA targeting HIF-1α and the negative control sequence were purchased from RiBobio (China) for transfection with ExFect2000, according to the manufacturer’s specifications. qPCR and western blotting were performed to detect HIF-1α expression. Optimal cell groups were determined for subsequent experiments. To mimic the effect of DEX on human hepatocellular carcinoma angiogenesis in vitro, cells were cultured with 0.5 μg/mL DEX for 12 h, 24 h, and 48 h in a medium containing a series of concentrations of yohimbine. Cultured cells were collected to analyze the expression of protein and RNA, and supernatants were harvested for ELISA.
-
According to the extracted using TRIzol reagent (Generay Biotech, China), and HiScript® II qRT SuperMix (Vazyme Biotech, China) was used to extract total RNA and transcribe it into cDNA. The reaction was performed at 25 °C, 42 °C, and 70 °C for 10 min, 60 min, and 10 min, respectively. The ChamQ SYBR Color qPCR Master Mix (Vazyme Biotech, China) was used to perform quantitative reverse transcriptase PCR (qRT-PCR). Actin was used as the internal reference gene listed in Table 1. The relative mRNA expression of the target genes was analyzed using the 2−ΔΔCt method[19]. The data were analyzed using the comparative Ct method. Primers (Sunny Biotech, China) for PCR were as follows:
Primer Sequence bp (s) Size of product (bp) Homo Actin F TGACGTGGACATCCGCAAAG 20 205 Homo Actin R CTGGAAGGTGGACAGCGAG 19 Homo HIF-1α F CACCACAGGACAGTACAGGAT 21 146 Homo HIF-1α R CGTGCTGAATAATACCACTCACA 23 Table 1. PCR primers sequences and length of fragments
-
First, cells were lysed in RIPA buffer (Beyotime, China) containing PMSF (Beyotime, China). Second, a bicinchoninic acid assay (Sigma, USA) was performed to quantify the protein concentrations. Third, the protein extracts (30 μg) were heated, denatured, loaded on 10% SDS-PAGE for electrophoresis, and then transferred to a PVDF membrane (Merck Millipore, Ireland). Thereafter, the membrane was blocked with 5% skim milk in TBS-T for 2 h at 37 °C. After that, the membrane was probed with primary and secondary antibodies at 4 °C overnight, aiming to detect the proteins of interest, and anti-β-actin (1:4,000, ab008), anti-HIF-1α (1:1,000, pA1-16601) were included. After four washes, the membrane was developed with the appropriate horseradish peroxidase-conjugated secondary antibody at room temperature for 1 h. HRP-conjugated secondary antibodies (Multi Sciences, China, 1:5,000). Staining was then observed using a micro ultraviolet spectrophotometer (Merinton, China) with ECL solution (Beyotime, China). Finally, the loading control was the constitutively expressed protein β-actin, and the blots were detected using an enhanced chemiluminescence system (Bio-Rad) and Image J.
-
The concentration of VEGFA secreted by MHCC97-H and SMMC-7721 cells was determined by ELISA using the corresponding ELISA kit (Multi Sciences, China), following the manufacturer’s instructions. The samples collected from the supernatants and the standard products were placed into plates with the anti-VEGFA antibody (Invitrogen, USA) at room temperature for 2 h. Then, the substrate solution and stop solution were added to react gradually. The protein content was calculated according to the OD values at a wavelength of 450 nm.
-
Paraffin-embedded mice hepatocellular carcinoma tissues were cut into slices. The slides were deparaffinized in xylene, hydrated in gradient alcohol, treated with 3% H2O2 to block endogenous peroxidase activity, and fixed with a citrate buffer for high-pressure thermal treatment. The tissues were cultured with mouse anti-CD31, anti-HIF-1α (Invitrogen, USA), and anti-VEGFA (Invitrogen, USA) antibodies at 4 ℃ overnight, followed by a setting with HRP-conjugated secondary antibodies (Multi Sciences, China) 37 ℃ for 30 min. The slices were successively stained with DAB, counterstained with hematoxylin, differentiated, turned blue, dehydrated, and sealed. The graphs were captured using a microscope under the same conditions.
-
After 48-hour fixation in 4% paraformaldehyde and paraffin embedding, the tumor tissue was conventionally cut into 5 μm portions. Then, the portions were dewaxed and rehydrated, and the antigen was retrieved by PH 9.0. Slices were sealed at 37 ℃ for 30 min and hydrated for incubation after washing 3 times with TBS for 5 min each time. Then Rabbit anti-CD31 polyclonal antibody (Abcam, AB281583, 1:100 dilution) and anti-CD147 antibody (Proteinatech, 66443-1-IG, 1:100 dilution) were incubated overnight at 4 ℃. After washing 3 times in TBS-T, sections were incubated with diluted fluorescent-labeled secondary antibodies for 30 min at room temperature and then stained in darkness with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min to indicate the nuclei. Images were captured using a fluorescence microscope (U-25ND25; Olympus, Tokyo, Japan).
-
Statistical analysis was performed using Graphpad Prism 9.0 (Graphpad, USA). Quantitative measurement data were displayed as the mean ± SEM. Two-way and one-way ANOVA procedures were used in the cell and animal models experiments respectively. Statistical significance was set at P < 0.05.