Volume 37 Issue 4
Apr.  2024
Turn off MathJax
Article Contents

LUO Xi, LI Xue, ZHANG Miao Miao, HUANG Qing Lian, ZHANG Yi Quan, JI Shen Jie, LU Ren Fei. Characterization of the CpsQ Regulon Reveals Its Role in the Transcription of Type VI Secretion System 2 Genes in Vibrio parahaemolyticus[J]. Biomedical and Environmental Sciences, 2024, 37(4): 436-439. doi: 10.3967/bes2024.049
Citation: LUO Xi, LI Xue, ZHANG Miao Miao, HUANG Qing Lian, ZHANG Yi Quan, JI Shen Jie, LU Ren Fei. Characterization of the CpsQ Regulon Reveals Its Role in the Transcription of Type VI Secretion System 2 Genes in Vibrio parahaemolyticus[J]. Biomedical and Environmental Sciences, 2024, 37(4): 436-439. doi: 10.3967/bes2024.049

Characterization of the CpsQ Regulon Reveals Its Role in the Transcription of Type VI Secretion System 2 Genes in Vibrio parahaemolyticus

doi: 10.3967/bes2024.049
More Information
  • Author Bio:

    LUO Xi, female, born in 1991, Master of Clinical Laboratory, majoring in gene regulation of pathogenic bacteria

  • Corresponding author: ZHANG Yi Quan, E-mail: zhangyiquanq@163.com; JI Shen Jie, E-mail: 1275558317@qq.com; LU Ren Fei, E-mail: rainman78@163.com
  • Received Date: 2023-12-12
  • Accepted Date: 2024-02-23
  • 加载中
  • [1] Li LZ, Meng HM, Gu D, et al. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol Res, 2019; 222, 43−51. doi:  10.1016/j.micres.2019.03.003
    [2] Yildiz FH, Visick KL. Vibrio biofilms: so much the same yet so different. Trends Microbiol, 2009; 17, 109−18. doi:  10.1016/j.tim.2008.12.004
    [3] Zhou DS, Yan XJ, Qu F, et al. Quorum sensing modulates transcription of cpsQ-mfpABC and mfpABC in Vibrio parahaemolyticus. Int J Food Microbiol, 2013; 166, 458−63. doi:  10.1016/j.ijfoodmicro.2013.07.008
    [4] Kimbrough JH, Cribbs JT, McCarter LL. Homologous c-di-GMP-binding Scr transcription factors orchestrate biofilm development in Vibrio parahaemolyticus. J Bacteriol, 2020; 202, e00723-19.
    [5] Sun FJ, Zhang YQ, Qiu YF, et al. H-NS is a repressor of major virulence gene loci in Vibrio parahaemolyticus. Front Microbiol, 2014; 5, 675.
    [6] Gao H, Zhang YQ, Yang L, et al. Regulatory effects of cAMP receptor protein (CRP) on porin genes and its own gene in Yersinia pestis. BMC Microbiol, 2011; 11, 40. doi:  10.1186/1471-2180-11-40
    [7] Martínez-Méndez R, Camacho-Hernández DA, Sulvarán-Guel E, et al. A trigger Phosphodiesterase modulates the global c-di-GMP pool, motility, and biofilm formation in Vibrio parahaemolyticus. J Bacteriol, 2021; 203, e0004621.
    [8] Makino K, Oshima K, Kurokawa K, et al. Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from that of V cholerae. Lancet, 2003; 361, 743−9. doi:  10.1016/S0140-6736(03)12659-1
    [9] Zhang YQ, Qiu Y, Xue XF, et al. Transcriptional regulation of the virulence genes and the biofilm formation associated operons in Vibrio parahaemolyticus. Gut Pathog, 2021; 13, 15. doi:  10.1186/s13099-021-00410-y
    [10] Qiu Y, Hu LF, Yang WH, et al. The type VI secretion system 2 of Vibrio parahaemolyticus is regulated by QsvR. Microb Pathog, 2020; 149, 104579. doi:  10.1016/j.micpath.2020.104579
  • 23444+Supplementary Materials.pdf
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(6)  / Tables(2)

Article Metrics

Article views(671) PDF downloads(30) Cited by()

Proportional views
Related

Characterization of the CpsQ Regulon Reveals Its Role in the Transcription of Type VI Secretion System 2 Genes in Vibrio parahaemolyticus

doi: 10.3967/bes2024.049
LUO Xi, LI Xue, ZHANG Miao Miao, HUANG Qing Lian, ZHANG Yi Quan, JI Shen Jie, LU Ren Fei. Characterization of the CpsQ Regulon Reveals Its Role in the Transcription of Type VI Secretion System 2 Genes in Vibrio parahaemolyticus[J]. Biomedical and Environmental Sciences, 2024, 37(4): 436-439. doi: 10.3967/bes2024.049
Citation: LUO Xi, LI Xue, ZHANG Miao Miao, HUANG Qing Lian, ZHANG Yi Quan, JI Shen Jie, LU Ren Fei. Characterization of the CpsQ Regulon Reveals Its Role in the Transcription of Type VI Secretion System 2 Genes in Vibrio parahaemolyticus[J]. Biomedical and Environmental Sciences, 2024, 37(4): 436-439. doi: 10.3967/bes2024.049
  • Vibrio parahaemolyticus, a gram-negative halophilic bacterium that naturally inhabits coastal waters, causes gastroenteritis, skin infections, and septicemia in human beings[1]. This bacterium produces multiple virulence factors, including thermostable direct hemolysin (TDH), TDH-related hemolysin (TRH), type III secretion system 1 (T3SS1), T3SS2, type VI secretion system 1 (T6SS1), and T6SS2[1]. Furthermore, V. parahaemolyticus forms biofilms on the surface, which help it in adapting to unfavorable conditions[2]. Mature biofilm formation requires special structures, including lateral and polar flagella, exopolysaccharide (EPS), and type IV pili[2].

    CpsQ, a c-di-GMP-binding regulatory protein, is encoded by the cpsQ-mfpABC operon[3]. Although CpsQ plays important roles in biofilm formation and the expression of RTX matrix proteins and capsules[4], whether it can regulate other genes remains obscure. In this study, nucleotides 35 to 616 of cpsQ were deleted from the genome of V. parahaemolyticus RIMD2210633 (wild-type, WT) using the suicide plasmid pDS132 to generate the cpsQ deletion mutant (ΔcpsQ)[5], and then the RNA sequencing (RNA-seq) and several phenotypic and molecular experimental assays were employed to explore the genes regulated by CpsQ.

    Overnight cell cultures of WT and ΔcpsQ in 2.5% (w/v) Bacto heart infusion (HI) broth (BD Biosciences, Franklin Lakes, NJ, USA) at 37 °C were serially diluted 10-fold using phosphate-buffered saline (PBS) buffer (pH 7.2); then, 200 μL of the diluted cells was spread onto an HI plate, followed by statical incubation at 37 °C for 48 h. Colonies were randomly selected in triplicate for each strain, resuspended in PBS, and adjusted to obtain an OD600 value of 1.4 for each bacterial suspension (defined here as bacterial seeds); they were then diluted 50-fold using 10 mL HI broth and allowed to continuously grow at 37 °C with shaking at 200 rpm. The OD600 values of all cultures were measured at 1 h intervals to plot growth curves. As shown in Supplementary Figure S1, available in www.besjournal.com, the two strains showed similar growth rates under the studied growth conditions, which suggested that CpsQ did not regulate the growth of V. parahaemolyticus.

    Figure S1.  Growth curves of WT and ΔcpsQ. V. parahaemolyticus strains were grown in HI broth at 37 °C with shaking at 200 rpm, and the OD600 values of each culture were monitored at 1 h intervals. Experiments were performed thrice with three different colonies per experiment.

    Two colonies of each strain were randomly harvested from the HI plate and placed in TRIzol reagent (Invitrogen, California, USA) for RNA extraction. RNA-related operations were performed at GENEWIZ Biotechnology Co., Ltd. (Suzhou, China). The mRNA profiles in ΔcpsQ (test group) were compared with those of WT (reference group) via RNA-seq to determine the genes that were regulated by CpsQ in V. parahaemolyticus. Significantly differentially expressed genes (DEGs) were analyzed using the DESeq2 (V1.6.3) software with at least two-fold changes in the ratio of mRNA levels (test/reference) and a P-value of < 0.05. As shown in Figure 1, CpsQ regulated the transcription of 567 genes, including 311 upregulated and 441 downregulated genes. Of these, 28 polar flagellar genes and 23 T6SS2 genes were down- and upregulated, respectively, in ΔcpsQ relative to those in WT (Supplementary Table S1, available in www.besjournal.com). A total of six genes encoding GGDEF- or EAL-domain proteins were significantly differentially expressed in ΔcpsQ relative to those in WT (Supplementary Table S1). Additionally, at least 31 putative regulatory genes, including 12 putative two-component system genes (highlighted with gray shadows in Supplementary Table S1), were significantly differentially expressed in ΔcpsQ relative to those in WT. Other genes such as antioxidative genes, T3SS2 genes, and putative outer membrane protein genes were also differentially expressed in ΔcpsQ and WT (Supplementary Table S1). The reliability of the transcriptome data was validated using quantitative PCR (qPCR) (Figure 2), which was performed as described previously[6]. The primers used in this study are listed in Supplementary Table S2, available in www.besjournal.com.

    Figure 1.  RNA-seq revealed the genes regulated by CpsQ on the HI agar plate. Volcano plot. Red, blue, and grey points indicate the upregulated, downregulated, and non-significant genes, respectively.

    Figure 2.  The transcriptional variation between ΔcpsQ (test) and WT (reference) was calculated for each target gene. A mean ratio of 2 was designated as the cutoff for determining statistical significance. The 16S rRNA gene was used as the internal control. WT, wild type.

    Approximately 50% of the polar flagellar genes were activated by CpsQ (Supplementary Table S1). Therefore, we investigated whether CpsQ regulates polar flagellum-mediated swimming motility. Two microliters of bacterial seeds were inoculated onto a semi-solid swimming plate containing 1% Oxoid tryptone (Oxoid, Basingstoke, England), 2% NaCl (Merck, Darmstadt, Germany), and 0.5% Difco Noble agar (BD Biosciences). The diameters of swimming areas were measured per hour after incubation at 37 °C. Results showed that the swimming capacities of WT and ΔcpsQ were not significantly different under the studied growth conditions at all time points tested (Supplementary Figure S2A, available in www.besjournal.com), which contradicted the results of RNA-seq and qPCR (Supplementary Table S1 and Figure 2). To verify whether the contradiction is attributed to the different growth conditions, V. parahaemolyticus strains were grown in the same medium as the swimming plate but with no agar at 37 °C and harvested at the mid-log phase. qPCR assays were employed to detect the regulation of polar flagellar genes (VP0785 and VP0788) by CpsQ. As shown in Supplementary Figure S2B, the mRNA levels of VP0785 and VP0788 were similar in ΔcpsQ compared to those in WT, which suggested that CpsQ had no regulatory effect on the transcription of polar flagellar genes. Therefore, CpsQ did not regulate the swimming motility of V. parahaemolyticus.

    Figure S2.  CpsQ did not affect the swimming motility of V. parahaemolyticus. (A) Swimming motility of WT and ΔcpsQ was evaluated by measuring the diameter of swimming areas in a semi-solid agar. (B) qPCR. Relative mRNA levels of each target gene were compared between WT and ΔcpsQ. Results were analyzed using paired Student’s t-test. ns, P > 0.05.

    Six putative c-di-GMP metabolism-associated genes, including tpdA, are regulated by CpsQ (Supplementary Table S1). TpdA is a phosphodiesterase that plays a key role in the modulation of intracellular c-di-GMP levels, motility, and biofilm formation[7]. This prompted us to determine whether CpsQ regulates c-di-GMP production. The WT and ΔcpsQ colonies were randomly collected in triplicate from the HI plate, resuspended in 2 mL ice-cold PBS (pH 7.2), incubated at 100 °C for 5 min, and sonicated for 15 min (power, 100%; frequency, 37 kHz) in an ice-water bath. The intracellular c-di-GMP levels and total protein in the supernatants were measured using a c-di-GMP enzyme-linked immunosorbent assay (ELISA) kit (Mskbio, Wuhan, China) and Pierce bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific, Massachusetts, USA), respectively. Intracellular c-di-GMP levels are expressed as picomoles per gram of protein. As shown in Supplementary Figure S3 (available in www.besjournal.com), there were no significant differences in the intracellular c-di-GMP levels between WT and ΔcpsQ, suggesting that CpsQ did not affect the synthesis of c-di-GMP in V. parahaemolyticus.

    Figure S3.  CpsQ did not affect the c-di-GMP pool in V. parahaemolyticus. Data are expressed as the mean ± SD of values from at least three independent experiments. Results were analyzed using paired Student’s t-test. ns, P > 0.05.

    RNA-seq and qPCR data revealed that CpsQ repressed the transcription of T6SS2 (Supplementary Table S1 and Figure 2) genes. The T6SS2 gene cluster (VPA1024-1046) contains three operons—VPA1027-1024, VPA1043-1028, and VPA1044-1046[8]. VPA1043-1028 and VPA1044-1046 are transcribed in opposite directions and are adjacent to each other[8]. Thus, the first genes, VPA1027-1024 and VPA1043-1028, were selected as target genes to further investigate CpsQ-mediated gene expression. The regulatory DNA region of each target gene was cloned into the pHRP309 vector harboring the promoter-less lacZ reporter gene. Each recombinant plasmid was transferred into WT and ΔcpsQ. Colonies of the resulting transformants were lysed to measure β-galactosidase activity in the cellular extracts using a β-Galactosidase Enzyme Assay System (Promega, Madison, USA)[9]. As shown in Figure 3A, the promoter activity (Miller units) of VPA1027 or VPA1043 in the ΔcpsQ colony was significantly enhanced relative to that in the WT colony, suggesting that CpsQ repressed the promoter activities of T6SS2 genes in V. parahaemolyticus. In addition, E. coli 100 λpir (Epicenter) bearing pBAD33-cpsQ or pBAD33 and a recombinant lacZ plasmid were cultured in Luria-Bertani broth containing 0.1% L-arabinose and 20 μg/mL chloramphenicol at 37 °C and harvested when an OD600 value of 1.2 was reached, to test whether CpsQ regulates the T6SS2 gene expression in a heterologous host[10]. As shown in Figure 3B, the expression of CpsQ from pBAD33-cpsQ led to much lower promoter activities of VPA1027 and VPA1043 compared to those in strains bearing pBAD33. These findings indicated that CpsQ directly regulated the transcription of VPA1027-1024 and VPA1043-1028. Taken together, these results suggest that CpsQ may directly repress T6SS2 expression in V. parahaemolyticus.

    Figure 3.  The negative and positive numbers indicate the nucleotide positions upstream and downstream of indicated genes, respectively. Paired Student’s t-test was used to calculate statistical significance, with a P-value less than 0.05 indicating significant differences. **P < 0.01; *P < 0.05. (A) LacZ fusion. The regulatory DNA region of each target gene was cloned into the pHRP309 plasmid and then transferred into ΔcpsQ and WT to determine the promoter activities in cellular extracts. (B) Two-plasmid reporter assay. E. coli 100 λpir (Epicentre) bearing pBAD33 or pBAD33-cpsR and a recombinant lacZ plasmid were grown in LB broth containing 0.1% L-arabinose to mid-log phase, and then aliquots were collected and assayed for lacZ expression using the β-galactosidase assay.

    In conclusion, our findings showed that CpsQ regulated the transcription of 567 genes, including polar flagella, T6SS2, c-di-GMP metabolism-associated, putative regulatory, antioxidative, and outer membrane protein-encoding genes. CpsQ might directly repress the T6SS2-associated operons VPA1027-1024 and VPA1043-1028. Collectively, this study confirmed the new regulatory roles of CpsQ in V. parahaemolyticus.

  • Locus Name FoldChange Product
    Lateral flagella
    VPA0261 2.077 flagellar export chaperone FlgN
    Polar flagellum
    VP0774 0.358 protein-glutamate O-methyltransferase
    VP0776 flgC 0.300 flagellar basal body rod protein FlgC
    VP0777 flgD 0.212 flagellar hook assembly protein FlgD
    VP0778 flgE 0.463 flagellar hook protein FlgE
    VP0780 0.180 flagellar basal body rod protein FlgF
    VP0781 flgG 0.243 flagellar basal-body rod protein FlgG
    VP0782 flgH 0.274 flagellar basal body L-ring protein FlgH
    VP0783 0.218 flagellar basal body P-ring protein FlgI
    VP0784 flgJ 0.253 flagellar assembly peptidoglycan hydrolase FlgJ
    VP0785 flgK 0.281 flagellar hook-associated protein FlgK
    VP0786 flgL 0.280 flagellar hook-associated protein FlgL
    VP0788 flaC 0.254 flagellin
    VP2111 0.231 OmpA family protein
    VP2225 0.458 chemotaxis protein CheW
    VP2227 0.441 ParA family protein
    VP2229 0.391 chemotaxis protein CheA
    VP2231 cheY 0.486 chemotaxis response regulator CheY
    VP2232 0.478 RNA polymerase sigma factor FliA
    VP2233 0.415 MinD/ParA family protein
    VP2237 fliR 0.483 flagellar type III secretion system protein FliR
    VP2241 fliN 0.265 flagellar motor switch protein FliN
    VP2242 fliM 0.460 flagellar motor switch protein FliM
    VP2244 0.465 flagellar hook-length control protein FliK
    VP2246 fliI 0.380 flagellar protein export ATPase FliI
    VP2249 fliF 0.432 flagellar M-ring protein FliF
    VP2251 0.414 sigma-54 dependent transcriptional regulator
    VP2252 0.444 PAS domain-containing protein
    VP2256 fliD 0.483 flagellar filament capping protein FliD
    Scv exopolysaccharide
    VP1464 0.300 O-antigen ligase family protein
    VP1469 scvE 3.975 sigma-54 dependent transcriptional regulator
    Type IV pilin
    VP2524 pilB 3.295 type IV-A pilus assembly ATPase PilB
    c-di-GMP
    VP1255 0.375 GGDEF-only
    VP1483 0.481 GGDEF-only
    VP1881 tpdA 0.421 EAL-only
    VP1979 3.129 EAL-only
    VPA0360 0.320 GGDEF-only
    VPA0518 2.100 hybrid
    T3SS1
    VP1657 vopB 2.380 type III secretion system translocon subunit VopB
    T3SS2
    VPA1326 2.725 hypothetical protein
    VPA1327 vopT 2.644 T3SS effector ADP-ribosyltransferase toxin VopT
    VPA1329 3.741 conjugal transfer protein TraA
    VPA1345 2.128 hypothetical protein
    VPA1346 vopA 4.834 type III secretion system YopJ family effector VopA
    T6SS1
    VP1416 0.462 hypothetical protein
    T6SS2
    VPA1024 5.741 hypothetical protein
    VPA1025 2.905 PAAR domain-containing protein
    VPA1026 vgrG 10.472 type VI secretion system tip protein VgrG
    VPA1027 10.854 type VI secretion system tube protein Hcp
    VPA1028 tssH 8.675 type VI secretion system ATPase TssH
    VPA1029 tssG 14.030 type VI secretion system baseplate subunit TssG
    VPA1030 tssF 13.979 type VI secretion system baseplate subunit TssF
    VPA1031 tssE 5.256 type VI secretion system baseplate subunit TssE
    VPA1032 7.011 protein of avirulence locus
    VPA1033 tssC 10.549 type VI secretion system contractile sheath large subunit
    VPA1034 tssC 3.575 type VI secretion system contractile sheath large subunit
    VPA1035 tssB 7.754 type VI secretion system contractile sheath small subunit
    VPA1036 tssA 9.924 type VI secretion system protein TssA
    VPA1037 6.385 protein phosphatase 2C domain-containing protein
    VPA1038 tagF 8.848 type VI secretion system-associated protein TagF
    VPA1039 tssM 5.244 type VI secretion system membrane subunit TssM
    VPA1040 tssL 4.422 type VI secretion system protein TssL%2C long form
    VPA1041 tssK 6.433 type VI secretion system baseplate subunit TssK
    VPA1042 tssJ 3.863 type VI secretion system lipoprotein TssJ
    VPA1043 tagH 4.076 type VI secretion system-associated FHA domain protein TagH
    VPA1044 4.890 serine/threonine protein kinase
    VPA1045 3.486 response regulator
    VPA1046 4.304 hypothetical protein
    Extracellular proteases
    VPA1071 2.654 S8 family serine peptidase
    Putative regulatory genes
    VP0080 2.651 sigma-54 dependent transcriptional regulator
    VP0358 0.399 DeoR family transcriptional regulator
    VP0838 seqA 0.318 replication initiation negative regulator SeqA
    VP1032 torR 0.439 two-component system response regulator TorR
    VP1382 2.345 LysR family transcriptional regulator
    VP1469 scvE 3.975 sigma-54 dependent transcriptional regulator
    VP1649 2.449 GntR family transcriptional regulator
    VP1906 0.415 MarR family transcriptional regulator
    VP1939 2.411 transcriptional regulator
    VP2037 0.421 chemotaxis protein CheV, response regulator
    VP2229 0.391 chemotaxis protein CheA, histidine kinase
    VP2231 0.486 chemotaxis response regulator CheY, response regulator
    VP2251 0.414 sigma-54 dependent transcriptional regulator
    VP2252 0.444 PAS domain-containing protein
    VP2299 glnB 0.430 nitrogen regulatory protein P-II
    VP2603 3.631 LysR family transcriptional regulator
    VP2710 scrP 2.352 helix-turn-helix transcriptional regulator
    VPA0358 0.229 helix-turn-helix transcriptional regulator
    VPA0420 0.486 TetR/AcrR family transcriptional regulator
    VPA0431 0.455 chemotaxis protein, response regulator
    VPA0619 3.870 MerR family DNA-binding transcriptional regulator
    VPA0663 2.174 AraC family transcriptional regulator
    VPA0717 0.253 LysR family transcriptional regulator
    VPA0740 3.494 LysR family transcriptional regulator
    VPA0746 0.414 chemotaxis protein CheV, response regulator
    VPA0826 pgtB 0.388 phosphoglycerate transport regulatory protein, histidine kinase
    VPA1045 3.486 response regulator
    VPA1162 0.405 response regulator
    VPA1423 2.961 AraC family transcriptional regulator
    VPA1562 2.684 TetR/AcrR family transcriptional regulator
    VPA1729 0.407 helix-turn-helix transcriptional regulator
    Antioxidative genes
    VPA1418 katE1 2.095 catalase
    VPA1683 ahpC1 2.349 alkyl hydroperoxide reductase subunit C
    Outer membrane proteins
    VP1008 0.059 porin
    VP1454 0.424 porin family protein
    VP1634 2.687 TolC family outer membrane protein
    VP2176 aqpZ 2.701 aquaporin Z
    VP2362 0.344 outer membrane protein OmpK
    VP2385 2.115 aquaporin
    VP2467 3.833 porin
    VPA0222 2.670 porin

    Table S1.  Selected genes from the CpsQ regulon

    Target Primers (forward/reverse, 5'-3')
    Construction of mutant
    cpsQ GTGACTGCAGGGTTCTCCAAGGCGATATG/CTTGTGGCTTGCGTCCTATGCTTTTCCGTGTACTGTTC
    GAACAGTACACGGAAAAGCATAGGACGCAAGCCACAAG/GTGAGCATGCCACCAGTTAGACGATCATTG
    GTGACTGCAGGGTTCTCCAAGGCGATATG/GTGAGCATGCCACCAGTTAGACGATCATTG
    qPCR
    VP0785 GCCGTCAGTCAGTGATTC/GTAGAGGACAGGTTGAGTTC
    VP0788 AATAAAGCGACCAACGAGCTG/TGCCACATCAAGACCACGAGA
    VP1469 GACAGGTCGTGATGCCATTC/GGCGATGATGACCGAAGTG
    VPA1027 TAAAGGTGAAGCGACAGCG/AATCATATAGGCGTGTTGC
    VPA1043 TGACCATAACGAGTTTCCAC/TTTAATCAATTCGCCGTGAG
    VPA1044 ATAGCAGCGATAGCGGAG/TTTGAGACAGTTTTGTATCC
    VPA1327 ATAGCAGCGATAGCGGAG/TTTGAGACAGTTTTGTATCC
    VP1255 GTAAGCTCGTCATCACACCTG/GCCGTACTTAGCCCACCTTCG
    VP1483 TCAAAGTGATCGACGGACCA/AATTACCTCGTCACCCGTTG
    VP1979 TTAAAGCCAGCGATGTAAACCC/GGCGAATCTGTTCTAACGCAAA
    VPA0360 TCGTTCTTTACCTACGCCTTA/TGCCAATAACACTCGATAGAGC
    VPA0518 GAAACATTAACGCAGCAAGCC/TCACCAATGTAGTTCCCGTTG
    VP1906 AAAGCTGAGCAAAGAGTCGGG/GTTGCTTGACTCATATTGGTG
    VPA0663 AGGCGATTCAGTTATGCGAAA/GTGGCTTCCAGTTTTTGGGTC
    VPA0717 CTATATTTAACCCAACCAGCC/GATCGAAGACTTCAGCCCCTA
    VPA1418 GATTTAGTCGGCAACAACAC/ATCCCAGTTGTTTGTCGAGC
    VPA1683 AGACCACTACGAAGAGCTAC/GTACTGGATCTTGCCGATTG
    VP1071 TCAGAACAATGGCATCTCGAC/ATGGCTTGCGTAAGTTTGGTG
    VP1008 AGGCAACATCTACGACAACGG/AGCCCAAAGGTCAACGTCTAC
    VP2362 ACCTAGCGTCAGACAAAGGC/TGAACTGGACCGAAAGACAGG
    LacZ fusion
    VPA1027 GCGCGTCGACTATTACCTTACTTGCCTCTCGG/GCGCGAATTCTGCTTCACGGTCCATTGC
    VPA1043 GCGCGTCGACTTTGTTGATAGGTGGTATTGTG/ATATGAATTCTGAGCGTCCGAAGGTTAC

    Table S2.  Primers used in this study

Reference (10)
Supplements:
23444+Supplementary Materials.pdf

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return