-
The sampling time, location, and quantity at each sampling point were determined according to the Sampling Code for Monitoring and Monitoring of Hazardous Substances in the Air of Workplaces (GBZ 159-2004)[28]. The concentration of Hg in the air was determined by atomic fluorescence spectrometry as specified in the “Determination of Toxic substances in the air of the Workplace Part 18: Mercury and its Compounds” (GBZ/T 160.14-2004)[29].
-
Figure 1A presents the technical process of this study and, summarizes the research approach. In this study, both the population and in vitro cell studies were conducted separately, and the results were integrated for analysis and discussion.
Figure 1. Study design and differentially expressed genes (DEGs). (A) Study design and (B) Scatter plot of DEGs. Red indicates upregulation and blue indicates downregulation.
A total of 291 workers from a plant in Jiangsu Province, China in 2016 were included in this study. All the participants voluntarily participated and signed an informed consent form. This study was approved by the Ethics Committee of Jiangsu CDC (Center for Disease Control and Prevention). According to WS/T 265-2006 “Biological Exposure Limits of Occupational Mercury Exposure”[30], the subjects were divided into high-concentration Hg exposure group and a control group (low-concentration Hg exposure group). In the preliminary screening stage of the gene expression chip experiment, 10 individuals were selected, and in the population expansion validation stage, 30 individuals were selected from each group. Inclusion criteria for the high-concentration Hg exposure group were as follows: 1) Work experience involving Hg exposure for over 3 years; 2) high urine Hg levels [urine Hg value ≥ 200 μg/g creatinine (Cr)]; 3) no history of primary nervous system or kidney diseases; and 4) no prolonged use of neurotoxic or nephrotoxic drugs. The control group participants engaged in long-term Hg-related work, had increased urine Hg levels (urine Hg value > 35 μg/g Cr and < 200 μg/g Cr), and the remaining inclusion criteria matched those of the high-concentration Hg exposure group. The control group was selected based on a 1:1 matching principle, with the following matching factors: 1) age differences ≤ 5 years; 2) sex; and 3) similar work experience with Hg exposure (≤ 5 years). The investigator received standardized training, conducted a one-to-one questionnaire survey with the subjects, and informed them about the purpose of the study. The questionnaire mainly included the following: 1) basic information (sex, age, etc.); 2) informed consent; 3) occupation history (type of work, length of service in Hg-related industry); 4) smoking and alcohol consumption history; and 5) disease history (chronic, and liver, and kidney diseases). Informed consent was obtained from all participants included in the study.
In the morning, 4 mL of blood was drawn from each participant and placed in a collection tube containing separation gel (BD, USA). After blood stratification, centrifuge at 3,300 rpm for 3 min. After centrifugation, 1.5 mL supernatant was extracted into a 2 mL eppendorf (EP) tube and stored at –80 °C. The participants were instructed to wash their hands in advance and collect their urine in a 50 mL sterile centrifuge tube. WS/T 25-1996 “Cold atomic Absorption Spectrometric Determination of Mercury in Urine (II) Acid Stannous Chloride Reduction Method”[31] was used as the standard for the determination of Hg in urine, while WS/T 97-1996 “Spectrophotometric Determination of Creatinine in Urine”[32] was used as the standard for the determination of urine creatinine.
-
Serum samples were collected from 10 participants in each group, and total RNA was extracted using the miRNeasy Serum/Plasma Kit (no.217184, QIAGEN, Germany). The extracted RNA was analyzed using a Nanodrop One (Thermo Scientific, USA) to ensure OD260/OD280 values between 1.8–2.0 without contamination.
Serum samples were thawed at 4 °C and then centrifuged for 10 min at 12,000 rpm. After centrifugation, 200 μL of the supernatant was transferred to RNase EP tubes. Next, 1 mL of QIAzol Lysis was added and incubated for 5 min, followed by the addition of 200 μL of trichloromethane and incubation for another 3 min. The mixture was centrifuged for 15 min at 12,000 rpm. A total of 600 μL of the supernatant was carefully collected in a clean 1.5 mL RNase EP tube, and 900 μL of 100% ethanol was added. The resulting solution was loaded onto a spin column and centrifuged for 15 s at 12,000 rpm. Sequentially, RWT buffer, RPE buffer, and 80% ethanol were added, followed by centrifugation for 15 s at 12,000 rpm in each step. RNase-free water was added to the spin- column membrane, allowed to stand for 10 min, and then centrifuged for 1 min. The extracted RNA was stored at –80 °C.
-
This study was conducted by the Bohao Biological Company (Shanghai), and a Human circRNA 1.0 chip was used for initial screening. In this study, 10 serum total RNA samples were collected from both the workers exposed to high Hg concentrations and control workers (1:1 matching). These samples were then mixed into RNA pools and transported to Bohao for analysis at a low temperature. The screening criteria for gene expression microarray results were as follows: the Fragments Per Kilobase Million (FPKM) value of gene expression in the high-concentration Hg exposure group divided by the FPKM value of gene expression in the control group (FC) was required to be either ≥ 2 or ≤ 0.5.
-
The qRT-PCR experiment was conducted using a custom kit (dye method) provided by Shanghai Genepharma Company, with GAPDH as the internal reference. The primer sequences are listed in Table 1. All experimental steps were performed on ice. For the pre-denaturation test, 1.2 μL of gene-specific RT primer and 2 μL RNA template were mixed in eight tubes. The mixture was heated in a PCR apparatus at 70 °C for 5 min, and immediately placed on ice after heating. For the reverse transcription experiment, 4 μL of MMLV RT Buffer, 0.75 μL dNTP, 0.2 μL MMLV reverse transcriptase, and 11.85 μL RNase-Free H2O were added to the same eight tubes. After sealing the lids, the eight tubes were placed in the PCR instrument for the reverse transcription (42 °C for 45 min, followed by 85 °C for 5 min). For the qRT-PCR, a premixed solution containing 2.5 μL of real-time PCR Master Mix, 0.1 μL of gene-specific primer set, 0.05 μL of Taq DNA polymerase, 1.85 μL sterile water was prepared. Subsequently, 0.5 μL of cDNA and 4.5 μL of the premixed solution was added to each well in a 384-well plate, to obtain total reaction volume of 5 μL per well (in triplicate). The plates were sealed with a transparent membrane and centrifuged for 5 min at 3,500 rpm before being placed in a Quant Studio 7 Flex instrument. The reaction conditions were as follows: 95 °C for 3 min (1 cycle), followed by 40 cycles of 95 °C for 12 s and 62 °C for 40 s. The reaction system was set to 5 μL, and the fluorescence signal was collected in the final step.
Table 1. List of primers for differentially expressed mRNAs of the candidates
Gene Sequence (5’→3’) Product size (bp) PTEN F:GCACTGTTGTTTCACAAGATGATG
R:GCAGACCACAAACTGAGGATTG81 SOX8 F:GAACGCATTCATGGTGTGGG
R:TAGTCGGGGTGGTCCTTCTT189 SOX6 F:AGGGAGTCTTGCCGATGTG
R:CAGGCTCTCAGGTGTACCTTTA181 KDM1A F:GTGCAGTACCTCAGCCCAAAG
R:TCTCCCGCAAAGAAGAGTCGT190 RNF2 F:TGCATCATCACAGCCCTTAGAAG
R:TTGTGCTTGTTGATCCTGGCT182 GAPDH F:CATGAGAAGTATGACAACAGCCT
R:AGTCCTTCCACGATACCAAAGT113 Note. PTEN, Phosphatase and tensin homolog; SOX8, SRY-box transcription factor 8; SOX6, SRY-box transcription factor 6; KDM1A, Lysine demethylase 1A; RNF2, ring finger protein 2; GAPDH,Glyceraldehyde-3-phosphate dehydrogenase. The qRT-PCR results for the candidate genes were analyzed, relative expression levels were calculated, and paired t-tests were performed for statistical analysis, with statistical significance set at P < 0.05. The relative expression of candidate genes was represented as –ΔCT = [CT (target gene) – CT (GAPDH)] × (–1). The expression levels of candidate genes were expressed as 2–ΔCT .
-
Human embryonic kidney cells HEK-293T (CL-0005) were obtained from Punosel Life Technology Co. Ltd. (Wuhan, China) and cultured according to the manufacturer’s instructions. Complete Dulbecco’s Modified Eagles Medium (DMEM) was prepared using DMEM high-glucose medium (GIBCO, USA), fetal bovine serum (GIBCO, USA), penicillin, and streptomycin (Hyclone, USA) in a ratio of 100:10:1. The cell cultures were maintained in 100 mm cell culture dishes (Corning, USA) in an incubator at 37 °C with a carbon dioxide concentration of 5%.
-
Cells were seeded into 96-well plates (Corning, USA), and 100 μL of complete culture medium and approximately 4 × 103 cells were placed in each well. Blank control wells contained 100 μL of cell culture medium but no cells. The plates were then placed in a constant-temperature incubator with 5% CO2 at 37 °C. After the cells achieved adherent growth, they were treated with various concentrations of HgCl2 (Shanghai Chemical Reagent Factory, China). Each concentration was tested in triplicate, resulting in final exposure concentrations of 100, 50, 40, 30, 20, 10, 5, and 0 μmol/L. After 24 h of exposure, 10 μL of CCK-8 solution (Beyotime, China) was added to each well. After incubation for 0.5, 1, 2, and 4 h, the absorbance was measured using a microplate reader to determine the exposure concentration.
-
The cells were seeded into 6-well plates (Corning, USA) and allowed to incubate for 24 h. Subsequently, the cells were exposed to HgCl2 at concentrations of 25, 10, and 0 μmol/L. RNA extraction was performed 24 h after exposure, and protein extraction was performed 48 h after exposure. The concentration was determined using literature references and CCK-8 analysis.
-
The cells were seeded into 6-well plates (Corning, USA) one day prior to the experiment. For transfection, the (Genepharma, China) dried siRNA product (1.00 OD260/ tube) was centrifuged, and 125 μL of DEPC water was added. OPTI-MEM serum-free medium (1,600 μL) was placed in each well of the 6-well plate. The EP tubes were numbered, and 200 μL of OPTI-MEM and 10 μL of siRNA were placed in one tube. The mixture was stirred and allowed to stand for 5 min. In another tube, 200 μL of OPTI-MEM and 5 μL lip2000 were added, and the mixture was stirred and allowed to stand for 5 min. Medium mixed with lip2000 was then added to the medium mixed with siRNA, and after 20 min, the transfection complex was formed. Next, 400 μL of the transfection complex was added to each well and mixed. After 5 h, the medium was replaced with complete DMEM, and transfection was examined using a fluorescence inverted microscope (Olympus, Japan) after 6 h. RNA and protein extraction was performed 24 and 48 h after transfection.
-
The cells were washed twice with PBS, and then 1 mL of RIPA buffer supplemented with 10 μL of PMSF was applied for cell lysis. The protein concentration was determined using a BCA protein concentration assay kit (Beyotime, China). Protein samples were prepared by mixing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) protein loading buffer (5x) and RNase-free water.
-
Protein samples were separated using 10% SDS-PAGE (Beyotime, China) and subsequently transferred to a PVDF membrane (Millipore, USA). The PVDF membranes were then immersed in a blocking solution (Solarbio, USA) at room temperature for 1 h. The primary antibody (Abcam, UK) was prepared in the blocking solution and incubated with the PVDF membrane overnight at 4 °C. Next, the secondary antibody (Abcam, UK) was diluted and used to incubate the PVDF membrane for 1 h. Finally, a mixture of components A and B from the Clarity Max Western ECL Substrate (Bio-Rad, UK) was applied to the membrane, which was then placed in a Bio-Rad gel system for imaging.
Primary antibodies against PTEN, PI3K, AKT, and GAPDH were used. All antibodies were rabbit monoclonal. The antibodies were diluted to the following concentrations: PTEN, at 1/2,000; PI3K, at 1/1,000; AKT, at 1/1,000; and GAPDH, at 1/2,500. The secondary antibody was a goat anti-rabbit antibody, which was used at a dilution of 1/10,000.
-
An IL-6 ELISA kit (Nanjing Jiancheng Bioengineering Institute, China), was used. The cell culture medium was collected in sterile EP tubes and centrifuged at 2,500 rpm for 20 min. The resulting supernatant was transferred to a new sterile EP tube. Standard solutions were prepared by diluting 150 μL of standard dry powder to achieve concentrations of 480, 240, 120, 60, 30, and 0 ng/L. Subsequently, 50 μL of standard and cell culture solutions were added to the designated standard and sample wells, respectively, with each setup performed in triplicate. Following completion of the experiment, absorbance was measured at 450 nm using an enzyme-labeled instrument. The results were calculated using ELISAcalc.
-
EpiData (version 3.1) was used for demographic data, and verification. SPSS (version 22.0) was used for data organization and analysis. Genes meeting the screening criteria from the gene expression microarray results were subjected to Gene Ontology (GO) and Kyoto encyclopedia of Genes and Genomes (KEGG) enrichment analysis using the Metascape website (http://metascape.org/gp/index.html#/main/step1). Differentially expressed genes (DEGs) with the highest enrichment fractions were selected as candidate genes for this experiment.
A relative quantitative method was used for qRT-PCR analysis of candidate genes. The relative expression of candidate genes was represented as –ΔCT, where –ΔCT = (CT (target gene) – CT (GAPDH)) × (–1). The expression of candidate genes was further expressed as 2–ΔCT. SPSS (version 22.0) was used to analyze the expression levels of candidate genes in the exposure (high-concentration Hg) and control groups, and the relative expression levels were visualized using GraphPad Prism (version 6.0). GraphPad Prism was used for Spearman’s correlation analysis between urinary Hg values (log10 converted) and the relative expression of candidate genes.
-
Table 2 shows the test results for Hg vapor concentrations in the workplace. The Hg vapor concentration in the working environment exceeded 0.02 mg/m3 (PC-TWA) in seven job categories (sealed tube, fixed point, semicolon, assembly, sealing the head, inspection, and packaging).
Table 2. Mercury vapor concentration range in an internal scale thermometer workshop
Type of work Sources of occupational hazards Mode of operation Mercury vapor concentration in the workplace (mg/m3) Sealed tube Centrifuge Mechanization 0.032 Fixed point Floating mercury Artificialization 0.021 Semicolon Floating mercury Artificialization 0.021 Assembly Floating mercury Artificialization 0.030 Sealing the head Heading machine Mechanization 0.032 Inspection Floating mercury Artificialization 0.022 Packaging Floating mercury Artificialization 0.031 -
At the preliminary screening stage, there were no significant differences in sex, age, working years, alcohol consumption, or smoking between the two groups (P > 0.05). However, the mean urinary Hg levels were 1024.7 μg/g creatinine (Cr) in the exposed group and 55.7 μg/g Cr in the control group (P < 0.001, Table 3).
Table 3. Demographic characteristics of the subjects in the initial screening stage
Variables High concentration mercury exposure group (n = 10) Control group (n = 10) P Gender (female%) 80 80 − Age (years) 41.90 ± 5.90 41.90 ± 6.54 0.871 Working-age (years) 19.10 ± 8.19 18.40 ± 8.83 0.954 Drinking (yes/no) 0/10 0/10 − Smoking (yes/no) 0/10 0/10 − Urine mercury (μg/g Cr) 1024.7
(477.03–2060.15)55.7
(47.98–73.48)< 0.001 Note. The age and working years in the table are expressed as mean ± SE, and the urine mercury value is expressed as the median (upper and lower quartile). The difference was statistically significant (P < 0.05). -
The results of the gene expression chip showed that there were 269 DEGs in the exposure group compared to the control group. Among them, 203 genes were upregulated, and 66 genes were downregulated (Figure 1B).
Based on the screening criteria [a gene expression FPKM value in the Hg exposure or control group (FC) ≥ 2 or (FC) ≤ 0.5], the DEGs were subjected to GO and KEGG bioinformatic enrichment analysis. Figure 2A shows the top 30 biological functions with the highest scores in the GO enrichment analysis. Figure 2B shows the top 30 regulatory pathways with the highest scores in the KEGG enrichment analysis. Figure 2C shows the relationships between the enriched items in the form of a network diagram.
Figure 2. Results of bioinformatics enrichment analysis gene expression was upregulated with a fold change ≥ 2, or gene expression was downregulated with a fold change ≤ 0.5 in high-concentration Hg exposure group). (A) Enrichment analysis of Gene Ontology (GO) biological regulation pathway. (B) Enrichment analysis of Kyoto encyclopedia of Genes and Genomes (KEGG) biological regulation pathway. (C) Network diagram of cluster analysis of enriched items.
Building on these results, the following candidate genes were selected for further population expansion and verification: 1. PTEN and ring finger protein 2 (RNF2) are involved in the PTEN and PIP3/AKT pathways; 2. SOX6 is associated with the WNT and PTEN pathways; 3. Lysine demethylase 1A (KDM1A) is linked to the PTEN pathway and P53 mediated intrinsic apoptosis signaling pathways; 4. SOX8 plays a role in the regulation of cell development and differentiation. These five genes were selected for population-based validation and verification (Supplementary Table S1, available in www.besjournal.com).
Table S1. Related information of differentially expressed genes
Input ID Gene ID Tax ID Homologene gene ID Homologene gene tax ID Gene symbol Description RNF2 6045 H. sapiens 6045 H. sapiens RNF2 ring finger protein 2 SOX6 55553 H. sapiens 55553 H. sapiens SOX6 SRY-box 6 KDM1A 23028 H. sapiens 23028 H. sapiens KDM1A lysine demethylase 1A SOX8 30812 H. sapiens 30812 H. sapiens SOX8 SRY-box 8 Note. RNF2, ring finger protein 2; SOX6, SRY-box transcription factor 6; KDM1A, Lysine demethylase 1A; SOX8, SRY-box transcription factor 8. -
The five candidate genes were verified in an expanded population study. There were no significant differences in sex, age, working years, alcohol consumption, and smoking between the two groups (P > 0.05). However, the mean urinary Hg levels were 988.50 μg/g creatinine (Cr) in the high-Hg-exposure group and 135.63 μg/g Cr in the control group. The urinary Hg level in the exposure group was 7.29 times that in the control group, and this difference was statistically significant (P < 0.001; Table 4).
Table 4. Demographic data of subjects in the extended validation phase
Variables High concentration mercury exposure group (n = 30) Control group (n = 30) P Gender (female%) 86.7 86.7 − Age (years) 40.63 ± 7.65 40.40 ± 7.58 0.893 Working-age (years) 11.73 ± 9.09 11.67 ± 8.70 0.881 Drinking (yes/no) 2/28 2/28 − Smoking (yes/no) 2/28 2/28 − Urine mercury (μg/g Cr) 988.50 (817.49–1159.51) 135.63 (112.62–148.65) < 0.001 Note. The age and working years in the table are expressed as mean ± SE, and the urine mercury value is expressed as the median (upper and lower quartile). The difference was statistically significant (P < 0.05). Figure 3A shows the qRT-PCR results for candidate genes in the expanded validation experiment. In comparison to the control group, the expression of PTEN was downregulated in the high-concentration Hg exposure group, with an expression level 0.22 times that of the control group. This difference was statistically significant (P < 0.05). Correlation analysis revealed a negative correlation between the relative expression of PTEN (r = –0.36, P = 0.005) and RNF2 (r = –0.37, P = 0.005) and urine Hg levels, as shown in Figure 3B.
-
The survival rate of 293T cells was observed at concentrations of 0, 5, 10, 20, 30, 40, 50, and 100 μmol/L HgCl2, as shown in Figure 4. Subsequent experiments were performed using drug concentrations that resulted in approximately 80% cell survival, which were determined to be 0, 10, and 25 μmol/L.
Figure 4. In vitro Hg exposure test results. (A) CCK-8 kit was used to determine the survival rate of 293T cells exposed to different concentrations of Hg. (B) Expression levels of PTEN gene and the PTEN, PI3K, AKT proteins in 293T cells exposed to Hg. (C) Transfection of fluorescent modified siRNA into 293T cells. (D) Expression of PTEN, PI3K and AKT in 293T cells after PTEN gene silencing. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Compared to the control group, exposure to HgCl2 (25 μmol/L and 10 μmol/L) led to a significant decrease in the expression of PTEN protein and a significant increase in the expression of PI3K and AKT proteins in 293T cells (P < 0.001).
Figure 4C shows the transfection efficiency of the cells, with transfection rates of 88.82, 76.19, and 80.76% for the siRNA1, siRNA2, and NC groups, respectively. After transfection, the expression level of PTEN significantly decreased, whereas the expression levels of PI3K and AKT significantly increased (P < 0.001).
In comparison to the control group, exposure to 25 and 10 μmol/L HgCl2 significantly increased the expression of IL-6 by 3.16 and 3.14 times that of the control group, respectively. After transfection, the expression level of IL-6 increased significantly to 3.56 times that of the control group (P < 0.001; Figure 5).
Figure 5. The expression levels of IL-6 and schematic diagram of the biological mechanism. (A) Expression of IL-6 in 293T cells cultured with Hg. (B) Expression levels of IL-6 in 293T cell culture medium after PTEN gene silencing. (C) Schematic diagram of biological mechanism. **, P < 0.01; ***, P < 0.001.
doi: 10.3967/bes2024.040
Downregulation of Serum PTEN Expression in Mercury-Exposed Population and PI3K/AKT Pathway-Induced Inflammation
-
Abstract:
Objective This study investigated the impact of occupational mercury (Hg) exposure on human gene transcription and expression, and its potential biological mechanisms. Methods Differentially expressed genes related to Hg exposure were identified and validated using gene expression microarray analysis and extended validation. Hg-exposed cell models and PTEN low-expression models were established in vitro using 293T cells. PTEN gene expression was assessed using qRT-PCR, and Western blotting was used to measure PTEN, AKT, and PI3K protein levels. IL-6 expression was determined by ELISA. Results Combined findings from gene expression microarray analysis, bioinformatics, and population expansion validation indicated significant downregulation of the PTEN gene in the high-concentration Hg exposure group. In the Hg-exposed cell model (25 and 10 μmol/L), a significant decrease in PTEN expression was observed, accompanied by a significant increase in PI3K, AKT, and IL-6 expression. Similarly, a low-expression cell model demonstrated that PTEN gene knockdown led to a significant decrease in PTEN protein expression and a substantial increase in PI3K, AKT, and IL-6 levels. Conclusion This is the first study to report that Hg exposure downregulates the PTEN gene, activates the PI3K/AKT regulatory pathway, and increases the expression of inflammatory factors, ultimately resulting in kidney inflammation. -
Key words:
- PTEN /
- Occupational mercury exposure /
- Occupational health /
- PI3K/AKT pathway /
- 293T cell /
- IL-6
&These authors contributed equally to this work.
注释:1) COMPETING INTERESTS: -
Figure 2. Results of bioinformatics enrichment analysis gene expression was upregulated with a fold change ≥ 2, or gene expression was downregulated with a fold change ≤ 0.5 in high-concentration Hg exposure group). (A) Enrichment analysis of Gene Ontology (GO) biological regulation pathway. (B) Enrichment analysis of Kyoto encyclopedia of Genes and Genomes (KEGG) biological regulation pathway. (C) Network diagram of cluster analysis of enriched items.
Figure 4. In vitro Hg exposure test results. (A) CCK-8 kit was used to determine the survival rate of 293T cells exposed to different concentrations of Hg. (B) Expression levels of PTEN gene and the PTEN, PI3K, AKT proteins in 293T cells exposed to Hg. (C) Transfection of fluorescent modified siRNA into 293T cells. (D) Expression of PTEN, PI3K and AKT in 293T cells after PTEN gene silencing. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Figure 5. The expression levels of IL-6 and schematic diagram of the biological mechanism. (A) Expression of IL-6 in 293T cells cultured with Hg. (B) Expression levels of IL-6 in 293T cell culture medium after PTEN gene silencing. (C) Schematic diagram of biological mechanism. **, P < 0.01; ***, P < 0.001.
Table 1. List of primers for differentially expressed mRNAs of the candidates
Gene Sequence (5’→3’) Product size (bp) PTEN F:GCACTGTTGTTTCACAAGATGATG
R:GCAGACCACAAACTGAGGATTG81 SOX8 F:GAACGCATTCATGGTGTGGG
R:TAGTCGGGGTGGTCCTTCTT189 SOX6 F:AGGGAGTCTTGCCGATGTG
R:CAGGCTCTCAGGTGTACCTTTA181 KDM1A F:GTGCAGTACCTCAGCCCAAAG
R:TCTCCCGCAAAGAAGAGTCGT190 RNF2 F:TGCATCATCACAGCCCTTAGAAG
R:TTGTGCTTGTTGATCCTGGCT182 GAPDH F:CATGAGAAGTATGACAACAGCCT
R:AGTCCTTCCACGATACCAAAGT113 Note. PTEN, Phosphatase and tensin homolog; SOX8, SRY-box transcription factor 8; SOX6, SRY-box transcription factor 6; KDM1A, Lysine demethylase 1A; RNF2, ring finger protein 2; GAPDH,Glyceraldehyde-3-phosphate dehydrogenase. Table 2. Mercury vapor concentration range in an internal scale thermometer workshop
Type of work Sources of occupational hazards Mode of operation Mercury vapor concentration in the workplace (mg/m3) Sealed tube Centrifuge Mechanization 0.032 Fixed point Floating mercury Artificialization 0.021 Semicolon Floating mercury Artificialization 0.021 Assembly Floating mercury Artificialization 0.030 Sealing the head Heading machine Mechanization 0.032 Inspection Floating mercury Artificialization 0.022 Packaging Floating mercury Artificialization 0.031 Table 3. Demographic characteristics of the subjects in the initial screening stage
Variables High concentration mercury exposure group (n = 10) Control group (n = 10) P Gender (female%) 80 80 − Age (years) 41.90 ± 5.90 41.90 ± 6.54 0.871 Working-age (years) 19.10 ± 8.19 18.40 ± 8.83 0.954 Drinking (yes/no) 0/10 0/10 − Smoking (yes/no) 0/10 0/10 − Urine mercury (μg/g Cr) 1024.7
(477.03–2060.15)55.7
(47.98–73.48)< 0.001 Note. The age and working years in the table are expressed as mean ± SE, and the urine mercury value is expressed as the median (upper and lower quartile). The difference was statistically significant (P < 0.05). S1. Related information of differentially expressed genes
Input ID Gene ID Tax ID Homologene gene ID Homologene gene tax ID Gene symbol Description RNF2 6045 H. sapiens 6045 H. sapiens RNF2 ring finger protein 2 SOX6 55553 H. sapiens 55553 H. sapiens SOX6 SRY-box 6 KDM1A 23028 H. sapiens 23028 H. sapiens KDM1A lysine demethylase 1A SOX8 30812 H. sapiens 30812 H. sapiens SOX8 SRY-box 8 Note. RNF2, ring finger protein 2; SOX6, SRY-box transcription factor 6; KDM1A, Lysine demethylase 1A; SOX8, SRY-box transcription factor 8. Table 4. Demographic data of subjects in the extended validation phase
Variables High concentration mercury exposure group (n = 30) Control group (n = 30) P Gender (female%) 86.7 86.7 − Age (years) 40.63 ± 7.65 40.40 ± 7.58 0.893 Working-age (years) 11.73 ± 9.09 11.67 ± 8.70 0.881 Drinking (yes/no) 2/28 2/28 − Smoking (yes/no) 2/28 2/28 − Urine mercury (μg/g Cr) 988.50 (817.49–1159.51) 135.63 (112.62–148.65) < 0.001 Note. The age and working years in the table are expressed as mean ± SE, and the urine mercury value is expressed as the median (upper and lower quartile). The difference was statistically significant (P < 0.05). -
[1] Clarkson TW, Vyas JB, Ballatori N. Mechanisms of mercury disposition in the body. Am J Ind Med, 2007; 50, 757−64. doi: 10.1002/ajim.20476 [2] Risher JF. Concise International Chemical Assessment Document 50: Elemental mercury and inorganic mercury compounds: human health aspects. Concise International Chemical Assessment Document 50. 2003; 678-81. [3] Yang LX, Zhang YY, Wang FF, et al. Toxicity of mercury: Molecular evidence. Chemosphere, 2020; 245, 125586. doi: 10.1016/j.chemosphere.2019.125586 [4] He K, Xun PC, Liu K, et al. Mercury exposure in young adulthood and incidence of diabetes later in life: the CARDIA trace element study. Diabetes Care, 2013; 36, 1584−9. doi: 10.2337/dc12-1842 [5] Chen YW, Huang CF, Tsai KS, et al. Methylmercury induces pancreatic β-cell apoptosis and dysfunction. Chem Res Toxicol, 2006; 19, 1080−5. doi: 10.1021/tx0600705 [6] Chen YW, Huang CF, Tsai KS, et al. The role of phosphoinositide 3-kinase/Akt signaling in low-dose mercury-induced mouse pancreatic β-cell dysfunction in vitro and in vivo. Diabetes, 2006; 55, 1614−24. doi: 10.2337/db06-0029 [7] Othman MS, Safwat G, Aboulkhair M, et al. The potential effect of berberine in mercury-induced hepatorenal toxicity in albino rats. Food Chem Toxicol, 2014; 69, 175−81. doi: 10.1016/j.fct.2014.04.012 [8] Ansar S, Iqbal M. Protective effect of diallylsulphide against mercuric chloride-induced hepatic injury in rats. Hum Exp Toxicol, 2016; 35, 1305−11. doi: 10.1177/0960327116629723 [9] Zalups RK. Molecular interactions with mercury in the kidney. Pharmacol Rev, 2000; 52, 113−43. [10] Zalups RK, Joshee L, Bridges CC. Novel Hg2+-induced nephropathy in rats and mice lacking Mrp2: evidence of axial heterogeneity in the handling of Hg2+ along the proximal tubule. Toxicol Sci, 2014; 142, 250−60. doi: 10.1093/toxsci/kfu171 [11] Oliveira VA, Favero G, Stacchiotti A, et al. Acute mercury exposition of virgin, pregnant, and lactating rats: Histopathological kidney and liver evaluations. Environ Toxicol, 2017; 32, 1500−12. doi: 10.1002/tox.22370 [12] Berlin M, Zalups RK, Fowler BA. Mercury. In: Nordberg GF, Fowler BA, Nordberg M, et al. Handbook on the Toxicology of Metals. 3rd ed. Academic Press. 2007, 675-729. [13] Vas J, Monestier M. Immunology of mercury. Ann N Y Acad Sci, 2008; 1143, 240−67. doi: 10.1196/annals.1443.022 [14] Schiraldi M, Monestier M. How can a chemical element elicit complex immunopathology? Lessons from mercury-induced autoimmunity. Trends Immunol, 2009; 30, 502−9. doi: 10.1016/j.it.2009.07.005 [15] Nakashima I, Pu MY, Nishizaki A, et al. Redox mechanism as alternative to ligand binding for receptor activation delivering disregulated cellular signals. J Immunol, 1994; 152, 1064−71. doi: 10.4049/jimmunol.152.3.1064 [16] Whitekus MJ, Santini RP, Rosenspire AJ, et al. Protection against CD95-mediated apoptosis by inorganic mercury in Jurkat T cells. J Immunol, 1999; 162, 7162−70. doi: 10.4049/jimmunol.162.12.7162 [17] McCabe MJ Jr, Whitekus MJ, Hyun J, et al. Inorganic mercury attenuates CD95-mediated apoptosis by interfering with formation of the death inducing signaling complex. Toxicol Appl Pharmacol, 2003; 190, 146−56. doi: 10.1016/S0041-008X(03)00159-5 [18] Cariccio VL, Samà A, Bramanti P, et al. Mercury involvement in neuronal damage and in neurodegenerative diseases. Biol Trace Elem Res, 2019; 187, 341−56. doi: 10.1007/s12011-018-1380-4 [19] Liu HH, Zhang CC, Wen FL, et al. Effects of low-dose mercury exposure in newborns on mRNA expression profiles. Bull Environ Contam Toxicol, 2021; 107, 975−81. doi: 10.1007/s00128-021-03249-w [20] Stratakis N, Conti DV, Borras E, et al. Association of fish consumption and mercury exposure during pregnancy with metabolic health and inflammatory biomarkers in children. JAMA Netw Open, 2020; 3, e201007. doi: 10.1001/jamanetworkopen.2020.1007 [21] Li J, Yen C, Liaw D, et al. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science, 1997; 275, 1943−7. doi: 10.1126/science.275.5308.1943 [22] Chen CY, Chen JY, He LN, et al. PTEN: tumor suppressor and metabolic regulator. Front Endocrinol, 2018; 9, 338. doi: 10.3389/fendo.2018.00338 [23] Worby CA, Dixon JE. PTEN. Annu Rev Biochem, 2014; 83, 641−69. doi: 10.1146/annurev-biochem-082411-113907 [24] Downes CP, Ross S, Maccario H, et al. Stimulation of PI 3-kinase signaling via inhibition of the tumor suppressor phosphatase, PTEN. Adv Enzyme Regul, 2007; 47, 184−94. doi: 10.1016/j.advenzreg.2006.12.018 [25] Xu F, Na LX, Li YF, et al. RETRACTED ARTICLE: Roles of the PI3K/AKT/mTOR signalling pathways in neurodegenerative diseases and tumours. Cell Biosci, 2020; 10, 54. doi: 10.1186/s13578-020-00416-0 [26] Tanaka T, Narazaki M, Kishimoto T. IL-6 in inflammation, immunity, and disease. Cold Spring Harb Perspect Biol, 2014; 6, a016295. doi: 10.1101/cshperspect.a016295 [27] Kang SJ, Tanaka T, Kishimoto T. Therapeutic uses of anti-interleukin-6 receptor antibody. Int Immunol, 2015; 27, 21−9. doi: 10.1093/intimm/dxu081 [28] Ministry of Health of the People's Republic of China. Specifications of air sampling for hazardous substances monitoring in the workplace, GBZ 159-2004. Beijing: People's Medical Publishing House, 2006. (In Chinese [29] Ministry of Health of the People's Republic of China. Workplace air - Determination of toxic substances - Part 18: Mercury and its compounds, GBZ/T 160.14-2004. Beijing, 2004. (In Chinese [30] Ministry of Health of the People's Republic of China. Biological limit value for occupational exposure to mercury, WS/T 265-2006. Beijing: People's Medical Publishing House, 2007. (In Chinese [31] Ministry of Health of the People's Republic of China. Urine—Determination of mercury—Cold atomic absorption spectrometric method-Ⅱ—Acidic stannous chloride reduction method, WS/T 26-1996. Beijing: Standards Press of China, 1997. (In Chinese [32] Ministry of Health of the People's Republic of China. Urine—determination of creatinine—spectrophotometric method, WS/T 97-1996. Beijing: Standards Press of China, 1997. (In Chinese [33] Vimalraj S. A concise review of VEGF, PDGF, FGF, Notch, angiopoietin, and HGF signalling in tumor angiogenesis with a focus on alternative approaches and future directions. Int J Biol Macromol, 2022; 221, 1428−38. doi: 10.1016/j.ijbiomac.2022.09.129 [34] Elinder CG, Barregard L. Renal effects of exposure to metals. In: Nordberg GF, Costa M. Handbook on the Toxicology of Metals. 5th ed. Academic Press. 2022, 485-506. [35] Vanholder RC, Praet MM, Pattyn PA, et al. Dissociation of glomerular filtration and renal blood flow in HgCl2-induced acute renal failure. Kidney Int, 1982; 22, 162−70. doi: 10.1038/ki.1982.148 [36] McDowell EM, Nagle RB, Zalme RC, et al. Studies on the pathophysiology of acute renal failure. I. Correlation of ultrastructure and function in the proximal tubule of the rat following administration of mercuric chloride. Virchows Arch B Cell Pathol, 1976; 22, 173−96. doi: 10.1007/BF02889215 [37] Suzuki A, De La Pompa JL, Stambolic V, et al. High cancer susceptibility and embryonic lethality associated with mutation of the PTEN tumor suppressor gene in mice. Curr Biol, 1998; 8, 1169−78. doi: 10.1016/S0960-9822(07)00488-5 [38] Hao LS, Zhang XL, An JY, et al. PTEN expression is down-regulated in liver tissues of rats with hepatic fibrosis induced by biliary stenosis. APMIS, 2009; 117, 681−91. doi: 10.1111/j.1600-0463.2009.02515.x [39] Horie Y, Suzuki A, Kataoka E, et al. Hepatocyte-specific Pten deficiency results in steatohepatitis and hepatocellular carcinomas. J Clin Invest, 2004; 113, 1774−83. doi: 10.1172/JCI20513 [40] Mahimainathan L, Das F, Venkatesan B, et al. Mesangial cell hypertrophy by high glucose is mediated by downregulation of the tumor suppressor PTEN. Diabetes, 2006; 55, 2115−25. doi: 10.2337/db05-1326 [41] Peyrou M, Bourgoin L, Foti M. PTEN in liver diseases and cancer. World J Gastroenterol, 2010; 16, 4627−33. doi: 10.3748/wjg.v16.i37.4627 [42] Stiles B, Wang Y, Stahl A, et al. Liver-specific deletion of negative regulator Pten results in fatty liver and insulin hypersensitivity. Proc Natl Acad Sci USA, 2004; 101, 2082−7. doi: 10.1073/pnas.0308617100 [43] Wang QL, Tao YY, Xie HD, et al. Fuzheng Huayu recipe, a traditional Chinese compound herbal medicine, attenuates renal interstitial fibrosis via targeting the miR-21/PTEN/AKT axis. J Integr Med, 2020; 18, 505−13. doi: 10.1016/j.joim.2020.08.006 [44] Lin JS, Shi YY, Peng H, et al. Loss of PTEN promotes podocyte cytoskeletal rearrangement, aggravating diabetic nephropathy. J Pathol, 2015; 236, 30−40. doi: 10.1002/path.4508 [45] Samarakoon R, Helo S, Dobberfuhl AD, et al. Loss of tumour suppressor PTEN expression in renal injury initiates SMAD3‐and p53‐dependent fibrotic responses. J Pathol, 2015; 236, 421−32. doi: 10.1002/path.4538 [46] Wang YF, Wang X, Wang HZ, et al. PTEN protects kidney against acute kidney injury by alleviating apoptosis and promoting autophagy via regulating HIF1-α and mTOR through PI3K/Akt pathway. Exp Cell Res, 2021; 406, 112729. doi: 10.1016/j.yexcr.2021.112729 [47] Chen JK, Nagai K, Chen JC, et al. Phosphatidylinositol 3-kinase signaling determines kidney size. J Clin Invest, 2015; 125, 2429−44. doi: 10.1172/JCI78945 [48] Myers MP, Pass I, Batty IH, et al. The lipid phosphatase activity of PTEN is critical for its tumor supressor function. Proc Natl Acad Sci USA, 1998; 95, 13513−8. doi: 10.1073/pnas.95.23.13513 [49] Sun H, Lesche R, Li DM, et al. PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3, 4, 5, -trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci USA, 1999; 96, 6199−204. doi: 10.1073/pnas.96.11.6199 [50] Stambolic V, Suzuki A, De La Pompa JL, et al. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell, 1998; 95, 29−39. doi: 10.1016/S0092-8674(00)81780-8 [51] Tanaka T, Narazaki M, Masuda K, et al. Regulation of IL-6 in Immunity and Diseases. Adv Exp Med Biol, 2016; 941, 79−88. [52] Tong YL, Wang RL, Liu X, et al. Zuojin Pill ameliorates chronic atrophic gastritis induced by MNNG through TGF-β1/PI3K/Akt axis. J Ethnopharmacol, 2021; 271, 113893. doi: 10.1016/j.jep.2021.113893 [53] Zhou J, Zhong JY, Lin S, et al. Inhibition of PTEN activity aggravates post renal fibrosis in mice with ischemia reperfusion-induced acute kidney injury. Cell Physiol Biochem, 2017; 43, 1841−54. doi: 10.1159/000484070 [54] Dou L, Wang SY, Sui XF, et al. MiR-301a mediates the effect of IL-6 on the AKT/GSK pathway and hepatic glycogenesis by regulating PTEN expression. Cell Physiol Biochem, 2015; 35, 1413−24. doi: 10.1159/000373962 -
23204+Supplementary Materials.pdf