-
The screw-type titanium implants were manufactured by WeGo Group Co., Ltd (Yantai, Shandong, China). The implant size (3.0 mm in diameter and 12.0 mm in length) was specifically designed to match the length and diameter of the rabbit mandibular incisors. The implant was a screw-type implant with micro threads and a smooth neck of 2 mm (Figure 1C). The implant surface was treated with sand-blasting with large grit and acid-etching (SLA) technology. Afterward, the implants were sterilized by gamma radiation and double parked with a special design to ensure safe implant handling and placement, avoiding any hand contact.
Figure 1. The effects of high +Gz environment on osseointegration after tooth implant surgery. (A) Experiment design and protocol. (B) Immediate implant placement surgery in rabbits. (C) View of the implant. (D) An X-ray film of the dental implant after immediate implantation. (E) The +Gz exposure protocol. wk, week.
-
Forty-eight adult, male New Zealand White rabbits (Oryctolagus cuniculus) weighing 2,485 (± 248) g were obtained from Beijing Vital River Laboratories. The animals were housed under appropriate environmental conditions, were exposed to 12-h light-dark cycles, and had access to standard food and water ad libitum. The protocol was approved by the Committee for Animal Experiments Ethics at the Air Force General Hospital, PLA, China (Protocol # kz2016006). All surgeries were performed under pentobarbital sodium anesthesia, and all necessary efforts to minimize animal discomfort were made.
The experimental scheme is illustrated in Figure 1A. The rabbits were randomly distributed into 6 equal groups (3 experimental groups and 3 control groups, 8 rabbits in each group). After one week of acclimation, the rabbits were anesthetized by an intraperitoneal injection of 3% pentobarbital sodium (1.2 mL/kg weight) (Sinopharm Chemical Reagent, Beijing, China) and were locally anesthetized with primacaine adrenaline (Produits Dentaires Pierre Rolland, Merignac, France). Bilateral mandibular incisors were extracted with minimal trauma to preserve the cortical bone. The implants were immediately placed into each tooth socket, and primary stability of the implants was achieved manually at about 15 N·cm. The gingiva was then closely sutured (Figure 1B, 1D). After surgery, all the rabbits had an intramuscular injection of penicillin (4 × 105 U/d) (North China Pharm, Shijiazhuang, Hebei, China) every day for 3 days.
-
One week after surgery, the experimental rabbits were exposed to high +Gz environment 3 times a week for 2 or 4 weeks in an animal centrifuge, while the control rabbits were raised in a common environment. The rabbits in one experimental group were exposed to +Gz for 2 weeks, and then sacrificed along with those in a control group. The rabbits in the other two experimental groups were exposed to +Gz for 4 weeks. Then the rabbits in one experimental group and one control group were killed at the end of 4 weeks. The rabbits in the 3rd experimental group were raised in a common environment for another 7 weeks after +Gz exposure, and then sacrificed along with those in the 3rd control group.
+Gz exposure was accomplished by using a specially designed animal centrifuge provided by the Air Force Aeromedicine Institute (Beijing, China). The animal centrifuge had an arm length of 1 m and an acceleration range of 1-15 G. Each rabbit was placed inside a cuboid restraint device, which was mounted in the centrifuge arm with the head of the rabbit facing the axis of the centrifuge for +Gz orientation. During the intervals between centrifuge runs, each rabbit was allowed to move freely in the cage.
The +Gz exposure protocol (Figure 1E) was designed according to the national[23] and international[24] military standards. The growth rate of +Gz was 1 G/s, the peak value was 4-9 G, the peak duration was 10-45 s, and the interval time was 1 min. The experimental rabbits were exposed to +Gz 3 times a week (every Monday, Wednesday, and Friday).
-
To monitor new bone formation around the implants, the rabbits were subcutaneously injected with calcein (10 mg/kg body weight) (Sigma Chemical Co., St. Louis, MO, USA) 14 days before being sacrificed and with tetracycline hydrochloride (30 mg/kg body weight) (Sigma Chemical Co., St. Louis, MO, USA) 4 days before being euthanized[25, 26].
The rabbits were sacrificed by an intravenous injection of pentobarbital sodium (Sinopharm Chemical Reagent, Beijing, China). Then, the soft tissues were stripped off and both sides of the jaw were harvested. The left-sided implants and the surrounding bone were fixed in 70% ethanol for micro-CT examination and histological observation. The right-sided implants and the surrounding bone were carefully collected using a Φ5 mm trephine bur (GC Dental, Tokyo, Japan); afterward, the surrounding 1 mm bone was scraped from the implant and frozen at −80 °C until analysis.
-
To evaluate the mass and microarchitecture of the bone surrounding the implants, micro-CT was performed using the Inveon MM system (Siemens, Munich, Germany). Images were acquired with an effective pixel size of 8.99 μm, voltage of 80 kV, current of 500 μA, and exposure time of 1,500 ms during each of the 360 rotational steps. The bone histomorphometric parameters were calculated using the Inveon Research Workplace (Siemens) as follows: bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp) in the area of 1 mm around the middle and lower 2/3rds of the implant.
-
After micro-CT analysis, the specimens were dehydrated in an ascending series of ethanol, cleared in chloroform, embedded in methyl methacrylate, sliced into sections of approximately 200 μm along the buccal-lingual axis of the implant by using a rotary diamond saw (SP1600, Leica, Nussloch, Germany), and then ground to a final thickness of approximately 30 μm. The slices were observed under a fluorescence microscope (BX61, Olympus, Tokyo, Japan), and the mineral apposition ratio (MAR, the ratio of the mean vertical distance between the two fluorescence lines and the time interval) at different time points was quantitatively analyzed using Image-Pro Plus (Media Cybernetics, Silver Spring, MD, USA).
-
After fluorescence observation, the slices were stained with methylene blue (Sinopharm Chemical Reagent, Beijing, China) and acid magenta (Sinopharm Chemical Reagent, Beijing, China) and observed under a microscope (BX61, Olympus). The bone implant contact (BIC, the percentage of the linear surface of the implant in direct contact with the mineralized bone) was quantitatively analyzed using Image-Pro Plus. BIC was measured as a range covering the mesial and distal sides of the middle and lower 2/3rds of the long axis of the implant, excluding the bottom of the implant.
-
Total cellular RNA was extracted from the frozen bone tissue around the implants using the Ultrapure RNA Kit (CoWin Bioscience, Beijing, China) following the manufacturer’s instructions. The concentration of RNAs was analyzed by Nanodrop ND-2000 (Thermo, Wilmington, DE, USA) at a wavelength of 260 nm. The purity of RNAs was also determined by the ratio of RNA OD260/OD280. Isolated RNA (2 μg) was reverse-transcribed into cDNA in a reaction mixture containing 4 μL of 5× RT buffer, 4 μL of dNTP mixture (2.5 mmol/L), 2 μL of primer mix, and 1 μL of SuperRT (200 U/μL) in a total volume of 20 μL using the SuperRT One-Step RT-PCR Kit (CoWin Bioscience, Beijing, China). The reaction mixture was incubated at 50 °C for 50 min and at 85 °C for 5 min in a Veriti 96-well Fast Thermal Cycler (Applied Biosystems, Foster City, CA, USA).
Real-time PCR was performed on the Roche LightCyler 480 PCR system (Roche, Basel, Switzerland) using the Power SYBR green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). Primer sequences (forward and reverse) of the detected genes and the control gene GAPDH (Table 1) were designed according to the published sequences by using Primer Premier 5.0 (Premier Biosoft, Palo Alto, CA, USA) and synthesized by Applygen Technologies Inc (Beijing, China). The PCR amplification reaction mixture (in a final volume of 25 μL) contained 12.5 μL of PCR Master Mix, 1 μL of cDNA, 1 μL of forward primers, and 1 μL of reverse primers for the detected genes and GAPDH. PCR conditions used were as follows: pre-denaturation for 10 min at 95 °C, denaturation for 15 s at 95 °C, and annealing for 15 s at 60 °C and extension for 35 s at 72 °C for a total of 40 cycles. Each individual cDNA sample for each gene was assayed in triplicate. A control sample without cDNA was used in each run to exclude genomic DNA contamination. After performing PCR, the Ct values of each sample were collected using MxPro-Mx3005p QPCR Software (Agilent, Santa Clara, CA, USA).
Target gene Forward primer (5’→3’) Reverse primer (5’→3’) BMP-2 TGAGGATTAGCAGGTCTTT GCTGGATTTGAGGCGTTT OPN GCTAAACCCTGACCCATCT CGTCGGATTCATTGGAGT TGF-β1 AGGACCTGGGCTGGAAGTG GCGCACGATCATGTTGGA RANKL AATGCCCGATTCATGTAGGAG AGATCGAACCATGAACCTTCC OPG GATCCAGAAACCTCTCGTCAG TGTGCCAAGTGTCTGTGTAG GAPDH GGTCGGAGTGAACGGATTT CTCGCTCCTGGAAGATGG Note. BMP-2, bone morphogenenetic protein-2; OPN, osteopontin; TGF-β1, transforming growth factor-β1; RANKL, receptor activator of nuclear factor κB ligand; OPG, osteoprotegerin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Table 1. Primer sequence of the detected genes
-
Statistical evaluation of the data was performed using the SPSS 19.0 software (IBM, Armonk, NY, USA). Mean values and standard deviations were calculated. The differences between the two groups were analyzed using two independent samples t-test, and the differences within groups were first analyzed using one-way ANOVA, followed by the Fisher’s Least Significant Difference (LSD) tests. Differences were considered statistically significant at P < 0.05.
Effect of High Positive Acceleration (+Gz) Environment on Dental Implant Osseointegration:A Preliminary Animal Study
doi: 10.3967/bes2019.087
- Received Date: 2019-02-09
- Accepted Date: 2019-07-12
-
Key words:
- Positive acceleration /
- Osseointegration /
- Dental implant /
- Micro-CT /
- Real-time polymerase chain reaction /
- Osteoblast
Abstract:
Citation: | ZHU Xiao Ru, DENG Tian Zheng, PANG Jian Liang, LIU Bing, KE Jie. Effect of High Positive Acceleration (+Gz) Environment on Dental Implant Osseointegration:A Preliminary Animal Study[J]. Biomedical and Environmental Sciences, 2019, 32(9): 687-698. doi: 10.3967/bes2019.087 |