-
Omethoate is a highly toxic organophosphorus pesticide that is widely used in agricultural production because of its high efficiency, broad spectrum, and low residue. Organophosphorus pesticides, such as omethoate, can inhibit acetylcholinesterase activity, leading to the accumulation of the neurotransmitter acetylcholine at cholinergic synapses. Accumulation of acetylcholine continues to stimulate cholinergic receptors, causing central nervous effects. Studies have shown that organophosphorus pesticides can cause genotoxicity in a variety of organisms, resulting in chromosomal DNA damage[1].
Telomeres are DNA-protein structures consisting of tandem hexamer repeats (TTAGGGn) at the end of the chromosome. They play important roles in chromosomal location, replication, protection, and control of cell growth. Telomerase is a DNA polymerase that synthesizes the TTAGG sequence and uses internal RNA molecules as templates to lengthen the pre-existing 3'terminal telomeres in vertebrates. It is a complex system composed of telomerase reverse transcriptase (TERT), telomerase RNA component and telomerase-associated protein 1 (TEP1). TERT is an important factor in maintaining telomere DNA length and chromosome stability. TERT is silently expressed in normal somatic and non-proliferative cells. However, in many human cancers, the TERT promoter mutates, resulting in abnormal expression. TEP1, another component of the telomerase nucleoprotein complex, catalyzes the addition of new telomeres to chromosomes. TEP1 immunoprecipitation has revealed its telomerase activity and its relatedness to TERT and telomerase RNA components[2].
A study of American adults found that the environmental exposure levels to organophosphate pesticides is related to alteration in telomere length in the population[3]. We have previously studied the relationship between tankyrase (TNKS) gene polymorphism and telomere length in peripheral blood leukocytes. The results showed that the CG+CC genotypes in rs1055328 may affect omethoate-induced telomere length increase[4]. Additionally, in a study on the relationship between metabolizing enzyme gene polymorphisms and telomere length in omethoate-exposed workers, the extension of telomere length was related to glutathione S-transferase M1 (GSTM1) deletion, GG+AG genotypes, and interactions between smoking and GG+AG genotypes[5]. However, it is not clear whether the effect of omethoate on telomere length is related to the polymorphism of telomerase genes. Therefore, we investigated the effect of polymorphisms in TERT and TEP1 on the telomere length of workers exposed to omethoate.
A total of 180 workers exposed to omethoate for more than 8 years were selected as the exposure group and 115 healthy people who were not exposed to toxic substances were selected as the control group. Smokers were defined as those smoking more than one cigarette a day for over half a year; alcohol drinkers were defined as those drinking more than twice a week in the past half year. This study was approved by the Life Science and Ethics Review Committee. Ten polymorphic loci associated with these genes (TERT: rs2736109, rs2735940, rs3215401, and rs2736100; TEP1: rs1713449, rs1760897, rs1760903, rs938886, rs1760904, and rs4246977) were studied by NCBI-SNP or Hapmap databases. The AssayDesigner3.1 software was used to design PCRs and single-base extension primers. The primer sequences of each of the polymorphic loci are listed in Supplementary Table S1, available in www.besjournal.com. Real-time fluorescence quantitative PCR assay was used to detect the DNA telomere length in peripheral blood leukocytes, and each sample was tested twice. Telomere length was determined using reference and telomere primers. The reverse and forward primers for the reference gene were hbgd, 5'-GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT-3' and hbgu, 5'-CGGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG-3'. The reverse and forward primers for the telomere were 5'-TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA-3' and 5'-ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT-3'.
Gene SNP Primer orientation and name Primer sequence (5’-3’) TERT rs2736109 Forward ACGTTGGATGAAGACACACTAACTGCACCC Reverse ACGTTGGATGATGTGCATGGCGAGGAAACG UEP-SEQ CCCGGCATTCAATGAAGAT rs2735940 Forward ACGTTGGATGTGGAGGTTAGCCTCGTCTTG Reverse ACGTTGGATGAGGCTTAGGGATCACTAAGG UEP-SEQ TTTCTAGAAGAGCGACC rs3215401 Forward ACGTTGGATGTCCGGGTTGCTCAAGTTTGG Reverse ACGTTGGATGTTTCAGTGTTTGCCGACCTC UEP-SEQ CCCCGAAGTTTCTCGCCCC rs2736100 Forward ACGTTGGATGACAAAGGAGGAAAAGCAGGG Reverse ACGTTGGATGTGACACCCCCACAAGCTAAG UEP-SEQ AATTTTTTTCCGTGTTGAGTGTTTCT TEP1 rs1713449 Forward ACGTTGGATGAAGAGTGGATGCCATAACCG Reverse ACGTTGGATGCTCTGTGTCTTATCAGCTGG UEP-SEQ GAGGGGTCAGAGCTTCTGGTGGTAACC rs1760897 Forward ACGTTGGATGTGTAGACTCTGGAACAAGGG Reverse ACGTTGGATGACATCCTCTCCTTGGAGAAC UEP-SEQ CCCCGTGCCTGGCCACCCTC rs1760903 Forward ACGTTGGATGGTCTGCTTAGGTAGCTCTTC Reverse ACGTTGGATGCAGATGCCTGGAAATCTGAC UEP-SEQ TCTGAAGAGGCCGCA rs938886 Forward ACGTTGGATGCCTCATTTTTGTGTGCCAGC Reverse ACGTTGGATGTTACCTGTGGTCCATTCTCC UEP-SEQ GGGTCTGCATTTGGCCAGGTTCCATAG rs1760904 Forward ACGTTGGATGATGCAGGCATCTCTTGTGTC Reverse ACGTTGGATGCCCCAGAAAAGTGGAAGAAG UEP-SEQ CAAGAAAAGTGGAAGAAGACTAATG rs4246977 Forward ACGTTGGATGCTCCATGACCTAATGACCTC Reverse ACGTTGGATGGAAACCCTAATCCCAATGCG UEP-SEQ ACCCAATGCGATGGTA Table S1. Primer sequences for polymorphic loci of genes
Statistical software (SPSS 21.0) was used for data analysis. In this study, data on telomere length were non-normally distributed. The telomere length data of the exposed and control groups were converted to normal distribution data using the Ln(X)+3 logarithmic transformation method. The t-test was used to compare the differences in telomere length between the two groups. The covariance method was used to analyze the relationship between variables and telomere length. The factors influencing telomere length in omethoate workers were analyzed using generalized linear models. All statistical tests were two-sided, with a statistical significance level of α = 0.05.
The telomere length in the exposed group (3.52 ± 0.62) was longer than that in the controls (3.00 ± 0.36) (t = 9.108, P < 0.001). Additionally, we analyzed the effects of sex, age, smoking, alcohol consumption, and omethoate exposure on telomere length. The results showed that, except in smokers, the telomere length in the exposed group was significantly longer than that in the control group (P < 0.05) (Supplementary Table S2, available in www.besjournal.com). After the Hardy-Weinberg equilibrium test, the genotype distribution of each genetic polymorphism did not deviate (P > 0.05), indicating that the control group was representative. Covariance analysis was used to analyze differences in telomere length between different genotypes of the TERT and TEP1 polymorphisms (Table 1). At the TERT rs2736109 polymorphism, the telomere length of the GG genotype was close to that of the AG genotype, thus leading to their fusion. The results showed that the telomere length of the AG+GG genotype was significantly longer than that of the AA genotype in the exposed group (P = 0.029). In the control group, the telomere length of the TT genotype of the TERT rs2736100 polymorphism was shorter than that of the GT genotype (P = 0.037). There were no significant differences in genotypes between the other loci. The rs2736100 genetic variation is associated with a range of cancers and related disorders. A case-control study of 828 people suggested that individuals with TG or GG had a higher risk of non-small-cell lung cancer compared to individuals with TT in the rs2736100 genotype[6]. Gu et al.[7] reported that the G allele of rs2736100 is significantly associated with a decrease in telomere length in Caucasians. However, we found that the telomere length of the TERT rs2736100 TT genotype was significantly lower than that of the GT genotype in the normal control population (P = 0.037), this could be due to ethnic differences.
Variables Exposure Control Pb n $ \bar{\mathrm{x}}\pm \mathrm{s} $ Pa n $ \bar{\mathrm{x}}\pm \mathrm{s} $ Pa Age > 40 127 3.52 ± 0.64 0.388 48 2.97 ± 0.37 0.036 < 0.001 ≤ 40 53 3.52 ± 0.56 67 3.03 ± 0.35 < 0.001 Gender Female 43 3.60 ± 0.64 0.683 61 3.06 ± 0.41 0.384 < 0.001 Male 137 3.49 ± 0.61 54 2.93 ± 0.29 < 0.001 Drinking No 117 3.54 ± 0.59 0.880 85 3.01 ± 0.38 0.092 0.026 Yes 63 3.49 ± 0.68 30 2.97 ± 0.29 < 0.001 Smoking No 164 3.52 ± 0.63 0.778 103 2.99 ± 0.37 0.848 0.071 Yes 16 3.53 ± 0.52 12 3.11 ± 0.22 < 0.001 Working duration > 30 37 3.42 ± 0.58 < 0.001 15–30 117 3.54 ± 0.63 < 15 26 3.56 ± 0.64 Note. length was determined via Ln(X)+3 conversion; aThe effect of different variables on telomere length was compared by covariance and adjusted for age, sex, drinking, smoking and working duration. bThe comparison results between the exposure group and control group; covariance was applied and adjusted for age, sex, drinking, and smoking. Table S2. Effects of age, sex, drinking, smoking, and working duration on telomere length
SNPs Exposure Control na $ \bar{\mathrm{x}}\pm \mathrm{s} $ Pb na $ \bar{\mathrm{x}}\pm \mathrm{s} $ Pb TERT rs2736109 AA 13 3.17 ± 0.42 Ref 12 2.95 ± 0.43 Ref GG+AG 161 3.55 ± 0.63 0.029 101 3.00 ± 0.35 0.602 TERT rs2735940 TT 35 3.48 ± 0.55 Ref 25 2.97 ± 0.37 Ref CT 90 3.57 ± 0.67 0.397 59 2.98 ± 0.35 0.790 CC 54 3.47 ± 0.57 0.964 30 3.03 ± 0.37 0.934 TERT rs3215401 -/- 76 3.51 ± 0.55 Ref 46 3.00 ± 0.38 Ref -/C 82 3.56 ± 0.71 0.711 51 2.99 ± 0.33 0.676 CC 20 3.37 ± 0.44 0.299 16 2.98 ± 0.37 0.885 TERT rs2736100 TT 52 3.45 ± 0.60 Ref 35 2.92 ± 0.31 Ref GT 85 3.56 ± 0.66 0.315 62 3.05 ± 0.38 0.037 GG 25 3.47 ± 0.55 0.976 12 2.95 ± 0.32 0.688 TEP1 rs1713449 TT 27 3.60 ± 0.65 Ref 16 2.90 ± 0.31 Ref CT 59 3.53 ± 0.57 0.732 48 2.98 ± 0.35 0.539 CC 92 3.48 ± 0.65 0.483 49 3.04 ± 0.38 0.214 TEP1 rs1760897 CC 10 3.84 ± 0.54 Ref 6 3.16 ± 0.24 Ref CT 62 3.49 ± 0.61 0.180 38 2.93 ± 0.37 0.247 TT 106 3.50 ± 0.63 0.114 67 3.02 ± 0.35 0.554 TEP1 rs1760903 TT 64 3.51 ± 0.59 Ref 48 2.96 ± 0.37 Ref CT 79 3.50 ± 0.68 0.920 44 3.00 ± 0.34 0.402 CC 36 3.60 ± 0.54 0.414 21 3.09 ± 0.35 0.130 TEP1 rs938886 CC 24 3.50 ± 0.59 Ref 12 2.98 ± 0.26 Ref CG 60 3.56 ± 0.60 0.617 48 2.97 ± 0.36 0.814 GG 90 3.53 ± 0.59 0.790 50 3.04 ± 0.38 0.613 TEP1 rs1760904 CC 64 3.50 ± 0.58 Ref 46 2.95 ± 0.37 Ref CT 76 3.51 ± 0.70 0.920 46 3.02 ± 0.36 0.305 TT 37 3.58 ± 0.54 0.451 21 3.02 ± 0.33 0.331 TEP1 rs4246977 TT 75 3.49 ± 0.59 Ref 59 2.95 ± 0.37 Ref CT 81 3.59 ± 0.59 0.309 50 3.05 ± 0.33 0.177 CC 20 3.37 ± 0.86 0.521 5 3.02 ± 0.38 0.383 Note. aSome samples were missing due to limitations of detection methods. bCovariance analysis compares differences in telomere length between genotypes, adjusted for sex, age, smoking, drinking, and working period. Ref: The reference group of the two comparisons, using the LSD method. Table 1. Telomere length for polymorphisms in the genes TERT and TEP1
In the generalized linear model, telomere length was used as the dependent variable; exposure, TERT rs2736109, and TERT rs2736100 were used as independent variables; and sex, age, smoking, drinking, and working period were used as covariates to enter the model. Generalized linear model analysis showed that exposure (b = 0.568, P < 0.001) and TERT rs2736109 (GG+AG) (b = 0.240, P = 0.045) affected telomere length, and no other factors were found to affect telomere length (Table 2). The polymorphism rs2736109 is located in the specific promoter region of TERT. The specific binding of the TERT promoter and the transcription factor GATA-2 can initiate the TERT transcription process. All members of the GATA transcription factor family bind to a specific nucleotide sequence (T/A (GATA) A/G). Instead of the G-allele in TERT promoter, the mutant A allele in rs2736109 generates a new GATA-1 binding locus[8], which decreases the transcription efficiency of TERT by competitive inhibition. GATA-1 encodes two zinc finger structure motifs, c-terminal zinc finger (c-znf) and N-terminal zinc finger (n-znf). N-znf, interacts with the nuclear protein transcription factor FOG1[9]. Studies have shown that FOG1 can inhibit the activity of GATA-1[10]. This may result in lower transcriptional activity of GATA-1 than for GATA-2. Therefore, the combination of the TERT promoter and GATA-1 can reduce the expression of the TERT mRNA. Finally, the mutant A allele of rs2736109 may lead to shorter telomere lengths. The telomere length in the AA genotype was significantly lesser than that in the GG+AG genotype, which is consistent with the results of this study.
Parameter β (95% CI) Standard Error χ2 Pa Intercept 2.836 (2.435, 3.238) 0.2047 191.997 < 0.001 Exposure 0.568 (0.415, 0.721) 0.0781 52.868 < 0.001 TERTrs2736109 (GG+AG) 0.240 (0.005, 0.476) 0.1200 4.014 0.045 Note. aThe generalized linear model was used to analyze telomere length, and adjusted for sex, age, smoking and drinking. Table 2. Factors influencing telomere length
To our knowledge, this is the first study to investigate the relationship between TERT and TEP1 polymorphisms and telomere length in workers exposed to omethoate. Our study has several limitations. First, it is a cross-sectional design and therefore does not address the temporal or causal relationship between omethoate exposure and telomere length decrease. Further follow-up is required to confirm these relationships. Second, the molecular mechanisms of the selected SNPs in telomere length shortening remain unclear, and cell-base experiments are required to elucidate these mechanisms. Finally, factors that might affect telomere length, such as chronic diseases and inflammatory conditions, were not considered due to limited information.
In summary, we explored the relationship between telomerase gene (TERT and TEP1) polymorphisms and telomere length in long-term low-level omethoate-exposed workers. The TERT rs2736109 polymorphism is the main factor affecting telomere length. Through this study, the molecular mechanism of organophosphorus pesticides that cause telomere prolongation was further explored. Our study provides a basis to screen for workers susceptible to occupational exposure. This is conducive to improving workers' health protection and reducing occupational contact damage.
Conflicts of Interest None.
Author Contributions CHENG Shuai and LIU Bin wrote the manuscript; YANG Yong Li and GUO Zhi Feng analyzed the data; DUAN Xiao Ran performed the experiments; LIU Su Xiang and LI Lei contributed to specimen collection; YAO Wu and WANG Wei contributed constructs; WANG Wei designed the experiments. All authors commented on the article before submission.
Acknowledgments The authors are grateful to all the individuals who volunteered for the study.
Ethical Conduct of Research The authors state that they have obtained appropriate institutional review board approval or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. In addition, for investigations involving human subjects, informed consent was obtained from the participants involved.
HTML
Reference
20511Supplementary Materials.pdf
|
|
Quick Links
DownLoad: