Volume 34 Issue 10
Oct.  2021
Turn off MathJax
Article Contents

CHENG Shuai, LIU Bin, GUO Zhi Feng, DUAN Xiao Ran, LIU Su Xiang, LI Lei, YAO Wu, YANG Yong Li, WANG Wei. Relationship between TERT Polymorphism and Telomere Length in Workers Exposed to Omethoate[J]. Biomedical and Environmental Sciences, 2021, 34(10): 838-841. doi: 10.3967/bes2021.115
Citation: CHENG Shuai, LIU Bin, GUO Zhi Feng, DUAN Xiao Ran, LIU Su Xiang, LI Lei, YAO Wu, YANG Yong Li, WANG Wei. Relationship between TERT Polymorphism and Telomere Length in Workers Exposed to Omethoate[J]. Biomedical and Environmental Sciences, 2021, 34(10): 838-841. doi: 10.3967/bes2021.115

Relationship between TERT Polymorphism and Telomere Length in Workers Exposed to Omethoate

doi: 10.3967/bes2021.115
More Information
  • Author Bio:

    CHENG Shuai, male, born in 1993, MPH, majoring in occupational cancer and biomarkers

    LIU Bin, male, born in 1992, MPH, majoring in occupational cancer and biomarkers

  • Corresponding author: WANG Wei, Tel: 86-371-67781466, E-mail: ww375@zzu.edu.cn
  • Received Date: 2020-12-21
  • Accepted Date: 2021-03-22
  • 加载中
  • [1] Sharma S, Nagpure NS, Kumar R, et al. Studies on the genotoxicity of endosulfan in different tissues of fresh water fish Mystus vittatus using the comet assay. Arch Environ Contam Toxicol, 2007; 53, 617−23. doi:  10.1007/s00244-006-0228-7
    [2] Yan LF, Wu SM, Zhang SH, et al. Genetic variants in telomerase reverse transcriptase (TERT) and telomerase-associated protein 1 (TEP1) and the risk of male infertility. Gene, 2014; 534, 139−43. doi:  10.1016/j.gene.2013.11.008
    [3] Ock J, Kim J, Choi YH. Organophosphate insecticide exposure and telomere length in U.S. adults. Sci Total Environ, 2020; 709, 135990. doi:  10.1016/j.scitotenv.2019.135990
    [4] Yang YL, Tan JB, Duan XR, et al. The association between polymorphisms in tankyrase gene and telomere length in omethoate-exposed workers. Chemosphere, 2020; 238, 124863. doi:  10.1016/j.chemosphere.2019.124863
    [5] Wang W, Zhang H, Duan XR, et al. Telomere length in workers was effected by omethoate exposure, GSTM1 deletion, interaction between smoking and GSTP1 polymorphisms. J Occup Environ Med, 2019; 61, e19−e23. doi:  10.1097/JOM.0000000000001503
    [6] Xing YL, Liu F, Li JF, et al. Case-control study on impact of the telomerase reverse transcriptase gene polymorphism and additional single nucleotide polymorphism (SNP)- SNP interaction on non-small cell lung cancers risk in chinese han population. J Clin Lab Anal, 2016; 30, 1071−7. doi:  10.1002/jcla.21982
    [7] Gu YY, Yu CX, Miao LM, et al. Telomere length, genetic variants and risk of squamous cell carcinoma of the head and neck in Southeast Chinese. Sci Rep, 2016; 6, 20675. doi:  10.1038/srep20675
    [8] Zhao XY, Wang SM, Wu JJ, et al. Association of TERT polymorphisms with clinical outcome of non-small cell lung cancer patients. PLoS One, 2015; 10, e0129232. doi:  10.1371/journal.pone.0129232
    [9] Fujiwara T. GATA transcription factors: basic principles and related human disorders. Tohoku J Exp Med, 2017; 242, 83−91. doi:  10.1620/tjem.242.83
    [10] Shimizu R, Yamamoto M. GATA-related hematologic disorders. Exp Hematol, 2016; 44, 696−705. doi:  10.1016/j.exphem.2016.05.010
  • 20511Supplementary Materials.pdf
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Tables(4)

Article Metrics

Article views(1579) PDF downloads(72) Cited by()

Proportional views
Related

Relationship between TERT Polymorphism and Telomere Length in Workers Exposed to Omethoate

doi: 10.3967/bes2021.115
  • Author Bio:

  • Corresponding author: WANG Wei, Tel: 86-371-67781466, E-mail: ww375@zzu.edu.cn
&These authors contributed equally to this work.
CHENG Shuai, LIU Bin, GUO Zhi Feng, DUAN Xiao Ran, LIU Su Xiang, LI Lei, YAO Wu, YANG Yong Li, WANG Wei. Relationship between TERT Polymorphism and Telomere Length in Workers Exposed to Omethoate[J]. Biomedical and Environmental Sciences, 2021, 34(10): 838-841. doi: 10.3967/bes2021.115
Citation: CHENG Shuai, LIU Bin, GUO Zhi Feng, DUAN Xiao Ran, LIU Su Xiang, LI Lei, YAO Wu, YANG Yong Li, WANG Wei. Relationship between TERT Polymorphism and Telomere Length in Workers Exposed to Omethoate[J]. Biomedical and Environmental Sciences, 2021, 34(10): 838-841. doi: 10.3967/bes2021.115
  • Omethoate is a highly toxic organophosphorus pesticide that is widely used in agricultural production because of its high efficiency, broad spectrum, and low residue. Organophosphorus pesticides, such as omethoate, can inhibit acetylcholinesterase activity, leading to the accumulation of the neurotransmitter acetylcholine at cholinergic synapses. Accumulation of acetylcholine continues to stimulate cholinergic receptors, causing central nervous effects. Studies have shown that organophosphorus pesticides can cause genotoxicity in a variety of organisms, resulting in chromosomal DNA damage[1].

    Telomeres are DNA-protein structures consisting of tandem hexamer repeats (TTAGGGn) at the end of the chromosome. They play important roles in chromosomal location, replication, protection, and control of cell growth. Telomerase is a DNA polymerase that synthesizes the TTAGG sequence and uses internal RNA molecules as templates to lengthen the pre-existing 3'terminal telomeres in vertebrates. It is a complex system composed of telomerase reverse transcriptase (TERT), telomerase RNA component and telomerase-associated protein 1 (TEP1). TERT is an important factor in maintaining telomere DNA length and chromosome stability. TERT is silently expressed in normal somatic and non-proliferative cells. However, in many human cancers, the TERT promoter mutates, resulting in abnormal expression. TEP1, another component of the telomerase nucleoprotein complex, catalyzes the addition of new telomeres to chromosomes. TEP1 immunoprecipitation has revealed its telomerase activity and its relatedness to TERT and telomerase RNA components[2].

    A study of American adults found that the environmental exposure levels to organophosphate pesticides is related to alteration in telomere length in the population[3]. We have previously studied the relationship between tankyrase (TNKS) gene polymorphism and telomere length in peripheral blood leukocytes. The results showed that the CG+CC genotypes in rs1055328 may affect omethoate-induced telomere length increase[4]. Additionally, in a study on the relationship between metabolizing enzyme gene polymorphisms and telomere length in omethoate-exposed workers, the extension of telomere length was related to glutathione S-transferase M1 (GSTM1) deletion, GG+AG genotypes, and interactions between smoking and GG+AG genotypes[5]. However, it is not clear whether the effect of omethoate on telomere length is related to the polymorphism of telomerase genes. Therefore, we investigated the effect of polymorphisms in TERT and TEP1 on the telomere length of workers exposed to omethoate.

    A total of 180 workers exposed to omethoate for more than 8 years were selected as the exposure group and 115 healthy people who were not exposed to toxic substances were selected as the control group. Smokers were defined as those smoking more than one cigarette a day for over half a year; alcohol drinkers were defined as those drinking more than twice a week in the past half year. This study was approved by the Life Science and Ethics Review Committee. Ten polymorphic loci associated with these genes (TERT: rs2736109, rs2735940, rs3215401, and rs2736100; TEP1: rs1713449, rs1760897, rs1760903, rs938886, rs1760904, and rs4246977) were studied by NCBI-SNP or Hapmap databases. The AssayDesigner3.1 software was used to design PCRs and single-base extension primers. The primer sequences of each of the polymorphic loci are listed in Supplementary Table S1, available in www.besjournal.com. Real-time fluorescence quantitative PCR assay was used to detect the DNA telomere length in peripheral blood leukocytes, and each sample was tested twice. Telomere length was determined using reference and telomere primers. The reverse and forward primers for the reference gene were hbgd, 5'-GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT-3' and hbgu, 5'-CGGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG-3'. The reverse and forward primers for the telomere were 5'-TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA-3' and 5'-ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT-3'.

    GeneSNPPrimer orientation and namePrimer sequence (5’-3’)
    TERTrs2736109ForwardACGTTGGATGAAGACACACTAACTGCACCC
    ReverseACGTTGGATGATGTGCATGGCGAGGAAACG
    UEP-SEQCCCGGCATTCAATGAAGAT
    rs2735940ForwardACGTTGGATGTGGAGGTTAGCCTCGTCTTG
    ReverseACGTTGGATGAGGCTTAGGGATCACTAAGG
    UEP-SEQTTTCTAGAAGAGCGACC
    rs3215401ForwardACGTTGGATGTCCGGGTTGCTCAAGTTTGG
    ReverseACGTTGGATGTTTCAGTGTTTGCCGACCTC
    UEP-SEQCCCCGAAGTTTCTCGCCCC
    rs2736100ForwardACGTTGGATGACAAAGGAGGAAAAGCAGGG
    ReverseACGTTGGATGTGACACCCCCACAAGCTAAG
    UEP-SEQAATTTTTTTCCGTGTTGAGTGTTTCT
    TEP1rs1713449ForwardACGTTGGATGAAGAGTGGATGCCATAACCG
    ReverseACGTTGGATGCTCTGTGTCTTATCAGCTGG
    UEP-SEQGAGGGGTCAGAGCTTCTGGTGGTAACC
    rs1760897ForwardACGTTGGATGTGTAGACTCTGGAACAAGGG
    ReverseACGTTGGATGACATCCTCTCCTTGGAGAAC
    UEP-SEQCCCCGTGCCTGGCCACCCTC
    rs1760903ForwardACGTTGGATGGTCTGCTTAGGTAGCTCTTC
    ReverseACGTTGGATGCAGATGCCTGGAAATCTGAC
    UEP-SEQTCTGAAGAGGCCGCA
    rs938886ForwardACGTTGGATGCCTCATTTTTGTGTGCCAGC
    ReverseACGTTGGATGTTACCTGTGGTCCATTCTCC
    UEP-SEQGGGTCTGCATTTGGCCAGGTTCCATAG
    rs1760904ForwardACGTTGGATGATGCAGGCATCTCTTGTGTC
    ReverseACGTTGGATGCCCCAGAAAAGTGGAAGAAG
    UEP-SEQCAAGAAAAGTGGAAGAAGACTAATG
    rs4246977ForwardACGTTGGATGCTCCATGACCTAATGACCTC
    ReverseACGTTGGATGGAAACCCTAATCCCAATGCG
    UEP-SEQACCCAATGCGATGGTA

    Table S1.  Primer sequences for polymorphic loci of genes

    Statistical software (SPSS 21.0) was used for data analysis. In this study, data on telomere length were non-normally distributed. The telomere length data of the exposed and control groups were converted to normal distribution data using the Ln(X)+3 logarithmic transformation method. The t-test was used to compare the differences in telomere length between the two groups. The covariance method was used to analyze the relationship between variables and telomere length. The factors influencing telomere length in omethoate workers were analyzed using generalized linear models. All statistical tests were two-sided, with a statistical significance level of α = 0.05.

    The telomere length in the exposed group (3.52 ± 0.62) was longer than that in the controls (3.00 ± 0.36) (t = 9.108, P < 0.001). Additionally, we analyzed the effects of sex, age, smoking, alcohol consumption, and omethoate exposure on telomere length. The results showed that, except in smokers, the telomere length in the exposed group was significantly longer than that in the control group (P < 0.05) (Supplementary Table S2, available in www.besjournal.com). After the Hardy-Weinberg equilibrium test, the genotype distribution of each genetic polymorphism did not deviate (P > 0.05), indicating that the control group was representative. Covariance analysis was used to analyze differences in telomere length between different genotypes of the TERT and TEP1 polymorphisms (Table 1). At the TERT rs2736109 polymorphism, the telomere length of the GG genotype was close to that of the AG genotype, thus leading to their fusion. The results showed that the telomere length of the AG+GG genotype was significantly longer than that of the AA genotype in the exposed group (P = 0.029). In the control group, the telomere length of the TT genotype of the TERT rs2736100 polymorphism was shorter than that of the GT genotype (P = 0.037). There were no significant differences in genotypes between the other loci. The rs2736100 genetic variation is associated with a range of cancers and related disorders. A case-control study of 828 people suggested that individuals with TG or GG had a higher risk of non-small-cell lung cancer compared to individuals with TT in the rs2736100 genotype[6]. Gu et al.[7] reported that the G allele of rs2736100 is significantly associated with a decrease in telomere length in Caucasians. However, we found that the telomere length of the TERT rs2736100 TT genotype was significantly lower than that of the GT genotype in the normal control population (P = 0.037), this could be due to ethnic differences.

    VariablesExposureControlPb
    n$ \bar{\mathrm{x}}\pm \mathrm{s} $Pan$ \bar{\mathrm{x}}\pm \mathrm{s} $Pa
    Age
     > 401273.52 ± 0.640.388482.97 ± 0.370.036< 0.001
     ≤ 40533.52 ± 0.56673.03 ± 0.35< 0.001
    Gender
     Female433.60 ± 0.640.683613.06 ± 0.410.384< 0.001
     Male1373.49 ± 0.61542.93 ± 0.29< 0.001
    Drinking
     No1173.54 ± 0.590.880853.01 ± 0.380.0920.026
     Yes633.49 ± 0.68302.97 ± 0.29< 0.001
    Smoking
     No1643.52 ± 0.630.7781032.99 ± 0.370.8480.071
     Yes163.53 ± 0.52123.11 ± 0.22< 0.001
    Working duration
     > 30373.42 ± 0.58< 0.001
     15–301173.54 ± 0.63
     < 15263.56 ± 0.64
      Note. length was determined via Ln(X)+3 conversion; aThe effect of different variables on telomere length was compared by covariance and adjusted for age, sex, drinking, smoking and working duration. bThe comparison results between the exposure group and control group; covariance was applied and adjusted for age, sex, drinking, and smoking.

    Table S2.  Effects of age, sex, drinking, smoking, and working duration on telomere length

    SNPsExposureControl
    na$ \bar{\mathrm{x}}\pm \mathrm{s} $Pbna$ \bar{\mathrm{x}}\pm \mathrm{s} $Pb
    TERT rs2736109
     AA133.17 ± 0.42Ref122.95 ± 0.43Ref
     GG+AG1613.55 ± 0.630.0291013.00 ± 0.350.602
    TERT rs2735940
     TT353.48 ± 0.55Ref252.97 ± 0.37Ref
     CT903.57 ± 0.670.397592.98 ± 0.350.790
     CC543.47 ± 0.570.964303.03 ± 0.370.934
    TERT rs3215401
     -/-763.51 ± 0.55Ref463.00 ± 0.38Ref
     -/C823.56 ± 0.710.711512.99 ± 0.330.676
     CC203.37 ± 0.440.299162.98 ± 0.370.885
    TERT rs2736100
     TT523.45 ± 0.60Ref352.92 ± 0.31Ref
     GT853.56 ± 0.660.315623.05 ± 0.380.037
     GG253.47 ± 0.550.976122.95 ± 0.320.688
    TEP1 rs1713449
     TT273.60 ± 0.65Ref162.90 ± 0.31Ref
     CT593.53 ± 0.570.732482.98 ± 0.350.539
     CC923.48 ± 0.650.483493.04 ± 0.380.214
    TEP1 rs1760897
     CC103.84 ± 0.54Ref63.16 ± 0.24Ref
     CT623.49 ± 0.610.180382.93 ± 0.370.247
     TT1063.50 ± 0.630.114673.02 ± 0.350.554
    TEP1 rs1760903
     TT643.51 ± 0.59Ref482.96 ± 0.37Ref
     CT793.50 ± 0.680.920443.00 ± 0.340.402
     CC363.60 ± 0.540.414213.09 ± 0.350.130
    TEP1 rs938886
     CC243.50 ± 0.59Ref122.98 ± 0.26Ref
     CG603.56 ± 0.600.617482.97 ± 0.360.814
     GG903.53 ± 0.590.790503.04 ± 0.380.613
    TEP1 rs1760904
     CC643.50 ± 0.58Ref462.95 ± 0.37Ref
     CT763.51 ± 0.700.920463.02 ± 0.360.305
     TT373.58 ± 0.540.451213.02 ± 0.330.331
    TEP1 rs4246977
     TT753.49 ± 0.59Ref592.95 ± 0.37Ref
     CT813.59 ± 0.590.309503.05 ± 0.330.177
     CC203.37 ± 0.860.52153.02 ± 0.380.383
      Note. aSome samples were missing due to limitations of detection methods. bCovariance analysis compares differences in telomere length between genotypes, adjusted for sex, age, smoking, drinking, and working period. Ref: The reference group of the two comparisons, using the LSD method.

    Table 1.  Telomere length for polymorphisms in the genes TERT and TEP1

    In the generalized linear model, telomere length was used as the dependent variable; exposure, TERT rs2736109, and TERT rs2736100 were used as independent variables; and sex, age, smoking, drinking, and working period were used as covariates to enter the model. Generalized linear model analysis showed that exposure (b = 0.568, P < 0.001) and TERT rs2736109 (GG+AG) (b = 0.240, P = 0.045) affected telomere length, and no other factors were found to affect telomere length (Table 2). The polymorphism rs2736109 is located in the specific promoter region of TERT. The specific binding of the TERT promoter and the transcription factor GATA-2 can initiate the TERT transcription process. All members of the GATA transcription factor family bind to a specific nucleotide sequence (T/A (GATA) A/G). Instead of the G-allele in TERT promoter, the mutant A allele in rs2736109 generates a new GATA-1 binding locus[8], which decreases the transcription efficiency of TERT by competitive inhibition. GATA-1 encodes two zinc finger structure motifs, c-terminal zinc finger (c-znf) and N-terminal zinc finger (n-znf). N-znf, interacts with the nuclear protein transcription factor FOG1[9]. Studies have shown that FOG1 can inhibit the activity of GATA-1[10]. This may result in lower transcriptional activity of GATA-1 than for GATA-2. Therefore, the combination of the TERT promoter and GATA-1 can reduce the expression of the TERT mRNA. Finally, the mutant A allele of rs2736109 may lead to shorter telomere lengths. The telomere length in the AA genotype was significantly lesser than that in the GG+AG genotype, which is consistent with the results of this study.

    Parameterβ (95% CI)Standard Errorχ2Pa
    Intercept2.836 (2.435, 3.238)0.2047191.997< 0.001
    Exposure0.568 (0.415, 0.721)0.078152.868< 0.001
    TERTrs2736109 (GG+AG)0.240 (0.005, 0.476)0.12004.0140.045
      Note. aThe generalized linear model was used to analyze telomere length, and adjusted for sex, age, smoking and drinking.

    Table 2.  Factors influencing telomere length

    To our knowledge, this is the first study to investigate the relationship between TERT and TEP1 polymorphisms and telomere length in workers exposed to omethoate. Our study has several limitations. First, it is a cross-sectional design and therefore does not address the temporal or causal relationship between omethoate exposure and telomere length decrease. Further follow-up is required to confirm these relationships. Second, the molecular mechanisms of the selected SNPs in telomere length shortening remain unclear, and cell-base experiments are required to elucidate these mechanisms. Finally, factors that might affect telomere length, such as chronic diseases and inflammatory conditions, were not considered due to limited information.

    In summary, we explored the relationship between telomerase gene (TERT and TEP1) polymorphisms and telomere length in long-term low-level omethoate-exposed workers. The TERT rs2736109 polymorphism is the main factor affecting telomere length. Through this study, the molecular mechanism of organophosphorus pesticides that cause telomere prolongation was further explored. Our study provides a basis to screen for workers susceptible to occupational exposure. This is conducive to improving workers' health protection and reducing occupational contact damage.

    Conflicts of Interest None.

    Author Contributions CHENG Shuai and LIU Bin wrote the manuscript; YANG Yong Li and GUO Zhi Feng analyzed the data; DUAN Xiao Ran performed the experiments; LIU Su Xiang and LI Lei contributed to specimen collection; YAO Wu and WANG Wei contributed constructs; WANG Wei designed the experiments. All authors commented on the article before submission.

    Acknowledgments The authors are grateful to all the individuals who volunteered for the study.

    Ethical Conduct of Research The authors state that they have obtained appropriate institutional review board approval or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. In addition, for investigations involving human subjects, informed consent was obtained from the participants involved.

Funds:  This project was supported by the Programs for Science and Technology Development of Zhengzhou [131PPTGG376] and the Outstanding Youth Grant of Zhengzhou University [1521329035] for their support
&These authors contributed equally to this work.
Reference (10)
Supplements:
20511Supplementary Materials.pdf

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return