-
Wild-type embryos were derived from natural matings of Tübingen zebrafish. Embryos were raised at 28.5 °C in Holtfreter’s solution. The arhgef10−/− and arhgef10+/− mutants were identified by genotyping, as described below.
-
A MEGAscript kit (Ambion, Austin, Texas, USA) was used to synthesize digoxigenin-UTP-labeled RNA probes in vitro from linearized plasmids, according to the manufacturer’s instructions.
Embryos were fixed overnight at 4 °C using 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) for hybridization. After using PBS to wash PFA 4 times (5 min each), the embryos were twice-washed with 100% methanol (5 min each). WISH was performed, as previously described[30]. -
Cas9 mRNA was transcribed from pGH-T7-zCas9 in vitro using a protocol optimized for zebrafish, as previously described[31]. Cas9 mRNA (200 pg) was injected in zebrafish embryos at the one-cell stage. Then, arhgef10 (GenBank accession number NC_007128.7; Sangon Biotech, Shanghai, China) guide-RNA (gRNA) was synthesized, as previously described[31]. We designed 4 zebrafish arhgef10-specific gRNAs for gene-specific editing of arhgef10 exons 12 and 13 (Table 1).
gRNA Sequences (5’– 3′) ahgef10-exon12-1 GAAACACCACCTTACGCTTG ahgef10-exon12-2 ATCCCAGTCAGATACTCTGC ahgef10-exon13-1 AGCGTCCAACACCATAGACT ahgef10-exon13-2 GTCCAGGAAACAGGGTTTAG Table 1. gRNA for gene-specific editing of arhgef10 exons 12 and 13
To synthesize the gRNA template, oligos were amplified by PCR reactions. A MAXIscript T7 kit (Life Technologies, Grand Island, NY, USA) was used to transcribe gRNA in vitro. TURBO DNase (Life Technologies) was used to remove the DNA template. Phenol chloroform was used to purify the product after synthesis. gRNA and Cas9 mRNA were injected into zebrafish embryos at the one-cell stage.
-
To extract genomic DNA from zebrafish embryos or tail fin clips, samples were lysed in 50 mmol/L NaOH, then boiled at 95 °C for 30 min. To neutralize the lysates, a 10% volume of 1 mol/L Tris (pH = 8.0) was added to the solution after boiling. After neutralization, the lysates were used as templates in PCRs. The successful targeting of arhgef10 was validated by a PCR reaction. The primers for the region flanking the target site was as follows: arhgef10 fwd, 5′-GATGATTGGGATGCATGAGAGTT-3′; and arhgef10 rev, 5′-CGGGTCTACATGTAATTACTGCA-3′. The amplified fragments were identified by Sanger DNA sequencing for genotyping.
After identifying successful germline-transmitted mutant loci, the surviving embryos were raised to adulthood and screened for germ-line mutated founders. Next, the mutational founders were outcrossed with wild-type zebrafish to generate F1s. Zebrafish were genotyped by PCRs using the following primers: arhgef10 fwd, 5′-TGGCTCAGGTCTGTTTGTGA-3′; and arhgef10 rev, 5′-ACTGCTGTCATGCACAAAGG-3′. The PCR products were then run on a 10% TBE-PAGE gel to distinguish homozygous from heterozygous carriers. The amplified fragment of the wild-type was 261 bp and the amplified fragment of mutant was 140 bp. Finally, F1 was mated to screen for homozygous F2.
-
The heads of zebrafish 5 days post-fertilization (dpf) were ground into powder in grinding bowls with liquid nitrogen. Total RNA was prepared according to the manufacturer's instructions (Life Technologies), followed by clean-up using an RNeasy Mini-kit (Qiagen, Germantown, WI, USA). RNA abundance was measured after isolation using a Nanodrop Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) at an absorbance of 260 nm by calculating the A260/A230 and A260/A280 ratios. All isolated nucleic acids were stored at −80 °C. mRNA reverse transcription was generated using an Invitrogen SuperScript kit (Thermo Fisher Scientific) following the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed using a LightCycler 96 (Roche, Basel, Switzerland) with SYBR Premix (Takara Bio, Otsu, Japan). Zebrafish were genotyped by qRT-PCR reactions using the following primers for the arhgef10 gene: fwd, 5'-TGGCTCAGGTCTGTTTGTGA-3'; and rev, 5'-ACTGCTGTCATGCACAAAGG-3'. The PCRs were performed under the following conditions: initiation at 95 ˚C for 30 s; an d40 cycles of amplification at 95 ˚C for 5 s and at 60 ˚C for 30 s. The experiments were performed in triplicate and repeated three times. Data were normalized to beta-action using the ΔΔCt method.
-
The swimming behavior 120 h post-fertilization (hpf) larvae was assessed in 48-well plates. Twenty larvae in wild-type, arhgef10+/−, and arhgef10−/− groups were placed individually in each well with 2 mL of Holtfreter’s solution. All larvae were prepared 30 min before the beginning of observation. Zebrafish larvae were placed in a DanioVision Observation Chamber (EthoVision®, Noldus Information Technology, Wageningen, Netherlands), and videos were recorded for 60 min to measure the distance traveled by the larvae. All of the swimming behavior recordings took place between 11:00 am and 12:30 pm.
-
Zebrafish larvae were placed in 48-well plates, as described above. All larvae were prepared 30 min before the beginning of observation. Each larva was recorded for a total of 30 min with 2.5 light/dark cycles (each consisting of 5 min of light and 5 min of dark). The light intensity for photomotor responses was 100 lx and the frame rate was 25/s.
-
Human SH-SY5Y cells were purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA) and cultured in Dulbecco’s Modified Eagle’s Medium (Invitrogen, Carlsbad, CA, USA) enhanced with 10% heat-inactivated fetal bovine serum in a humidified incubator at 37 °C containing 5% CO2. Cell transfections were carried out using Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions.
-
SH-SY5Y cell total protein was extracted using 2 × SDS lysis buffer at 4 °C, and quantified using the Bradford assay. Equivalent measures of protein were isolated on SDS-PAGE gels. The gels were transferred onto PVDF membranes (BioRad, Hercules, CA, USA). The membranes were blocked with 5% bovine serum albumin (11021037; Thermo Fisher) and probed with primary antibodies, including anti-ARHGEF10 (Proteintech, Hubei, China) and anti-GAPDH (Proteintech) overnight at 4 °C. Membranes were washed with TBS and 0.1% Tween 20, then incubated with HRP-conjugated secondary antibodies, stained with chemiluminescence (Millipore, MA, USA) reagent and visualized. GAPDH served as a loading control. Protein levels were quantified using NIH ImageJ software (NIH, Bethesda, MD, USA)(version 1.8.0).
-
Cell viability was determined with a Cell Counting Kit-8 (Vazyme, Nanjing, China) at 24, 48, and 72 h. Then, after adding 10 μL of CCK-8 solution to each well, the cells were cultured in an incubator for 1 h in the dark. A Multiskan SkyHigh Microplate reader (Thermo Fisher) was used to measure the absorbance of each sample at 450 nm. Each sample was analyzed in triplicate. -
SH-SY5Y cells were collected and seeded into 6-cm dishes. Cells were digested with 0.25% trypsin after 48 h of growth and collected with PBS on ice. Annexin V-fluorescein isothiocyanate (FITC; Becton Dickinson, Franklin Lakes, New Jersey, USA) was added to cells for 10 min at 25 °C, then propidium iodide (PI) was added for 3 min at 25 °C in the dark. Fluorescence intensity was analyzed with a FACScan flow cytometer (Becton Dickinson) and data were processed with FlowJo software (FlowJo LLC; Becton Dickinson, Franklin Lakes, New Jersey, USA). Each sample was analyzed in triplicate.
-
Statistical analyses were performed using GraphPad Prism software. Analysis of variance (ANOVA) was utilized to compare the locomotor experimental data of three genotypes. All the experiments were performed three times. P values < 0.05 were considered statistically significant. Values are presented as the mean ± SEM.
Single-copy Loss of Rho Guanine Nucleotide Exchange Factor 10 (arhgef10) Causes Locomotor Abnormalities in Zebrafish Larvae
doi: 10.3967/bes2022.005
- Received Date: 2021-05-21
- Accepted Date: 2021-09-10
-
Key words:
- arhgef10 /
- Zebrafish /
- CRISPR/Cas9 /
- Haploinsufficiency /
- Copy loss
Abstract:
Citation: | ZHANG Yi, AN Ming Xing, GONG Chen, LI Yang Yang, WANG Yu Tong, LIN Meng, LI Rong, TIAN Chan. Single-copy Loss of Rho Guanine Nucleotide Exchange Factor 10 (arhgef10) Causes Locomotor Abnormalities in Zebrafish Larvae[J]. Biomedical and Environmental Sciences, 2022, 35(1): 35-44. doi: 10.3967/bes2022.005 |