-
Huh7 (RRID:CVCL_0336) and HepG2 (RRID:CVCL_0027) cells were maintained in our lab. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% foetal bovine serum (FBS, Gibco) at 37 °C in a humidified incubator with 5% CO2 (Thermo Fisher Scientific).
-
The PPP2R3A overexpression vector and its empty vector (PEX-3), as well as siRNA against PPP2R3A (si-PPP2R3A) and its matched negative control (si-NC) were purchased from GenePharma. Cells were seeded in 6-well plates at a density of 1 × 106 and incubated overnight. The transfection reagent and overexpression plasmids or PPP2R3A siRNA were premixed for 15 min before transfection. PPP2R3A-overexpressing plasmids (2.5 µg) were transfected into the cells using 4 µL of Lipo8000 transfection reagent (Beyotime, China) in serum-free medium. PPP2R3A siRNA was transiently transfected into HepG2 and Huh7 cells at concentrations of 20 nmol/L by using 5 µL of Lipo8000 transfection reagent in serum-free medium. SiRNA against HK1 (si-HK1) were purchased from Mijia Biotech. Twenty nmol/L si-HK1 was added to the overexpressing PPP2R3A cell line by using 5 µL of Lipo8000 transfection reagent in serum-free medium. After 12 h, the medium was changed to complete medium.
-
Total RNA from the cultured cells was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) based on the instructions. Subsequently, the RNA was reverse transcribed into first-strand cDNA with a miScript Reverse Transcription Kit (Qiagen, Hilden, Germany). The expression of PPP2R3A and HK1 was quantified by real-time PCR using the miScript SYBR Green PCR Kit according to the manufacturer’s protocol. HACTB was used as an internal normalized reference. Real-time PCR was carried out in the Bio–Rad IQ5 amplification system (Bio–Rad, USA), and the results were calculated using the delta CT method. The sequences of the PCR primers are shown in Table 1.
Genes Primer Sequence (5′–3′) HACTB Forward CGTGGACATCCGCAAAGA Reverse GAAGGTGGACAGCGAGGC PPP2R3A Forward AGAGAAGACAGGATTTGTGACAGCA Reverse CAGTTGGGCTTTGCTAGAAGACAG HK1 Forward TGCCATGCGGCTCTCTGATG Reverse CTTGACGGAGGCCGTTGGGTT Table 1. The Sequences of the PCR Primers
-
Total RNA from the HepG2 cells was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) based on the instructions. RNA samples were treated with 20 units of RNase-Free DNase (Ambion, Shanghai, China) to remove residual genomic DNA, according to the manufacturer’s recommendations. The integrity and quantity of RNA samples were confirmed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and Nanodrop 2000 (Thermo Scientific, Wilmington, DE, USA), respectively. Five micrograms of RNA from each sample were to construct transcriptome libraries using an IlluminaTruSeqTM RNA Sample Preparation Kit (Illumina, San Diego, CA, USA) and sequenced using the IlluminaHiSeqTM 2500, according to the manufactures’ instructions. Raw reads were filtered with Q20 quality trimming, adaptors were removed, and clean reads were aligned to the human genome (GRCh38) using an HISAT2 and GTF annotation data file. Two or fewer mismatches were allowed in the alignment.
-
Total protein from cultured cells was obtained by using radio‐immunoprecipitation assay (RIPA, Beyotime, China):proteinase inhibitor (Beyotime, China):phosphatase inhibitor (Beyotime, China) = 100:1:1. Total protein from cells was subjected to 10% SDS‐PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Sigma-Aldrich), followed by blocking with 5% nonfat milk for 1 h. The blots were probed with the primary antibody anti‐HK1 (Abnova Cat# MAB10683, RRID:AB_11188071, 1:1,000 dilution, mouse source) and anti‐PPP2R3A (Sigma-Aldrich Cat# HPA035829, RRID:AB_10696513, 1:1,000 dilution, rabbit source) overnight at 4 °C. After washing, the sections were incubated with secondary antibody (1:5,000 dilution) for 1 h. The chemiluminescent signals were visualized using ECL‐Spray (Santa Cruz) and a chemiluminescence imaging analysis system (GE A1680).
-
A total of 1 × 104 cells were taken from each group for protein extraction and measured with an ELISA kit (Cloud-Clone, China) according to the protocol provided by the supplier.
-
Sterile cover slips were added to 24-well plates. HepG2 and Huh7 cells digestion counts were seeded in 24-well plates (3 × 105) and gently shaken overnight. The supernatant was discarded 72 h after transfection, and the cells were washed three times with PBS. Cells were fixed with freshly prepared 4% paraformaldehyde for 15 min and lysed with 0.1% Triton-X-100-PBS for 15 min. The proteins were probed with the primary antibody anti‐HK1 (Abnova Cat# MAB10683, RRID:AB_11188071, 1:500 dilution, mouse source) overnight at 4 °C. After washing, 1:400 proportion-diluted donkey anti-mouse fluorescent secondary antibody was added. Finally, nuclei were stained with 4,6-diacetyl-acetyl-2-phenylindindex (4,6-diamidino-2-phenylindole, DAPI) in a 1:500 ratio added for 3 min. Analysis was performed after sheet sealing with a fluorescent sealer.
-
Liver cancer tissue samples were obtained from the Department of Organ Transplantation, The Third Medical Center of PLA General Hospital. Briefly, HCC tissues were formalin-fixed, paraffin embedded, and serially sectioned to 4-μm thickness. After 1 h of dewaxing, the sections were repaired with an antigen repair solution of pH = 9 for 20 min. The primary antibodies against PPP2R3A (Sigma-Aldrich Cat# HPA035829, RRID:AB_10696513, 1:500 dilution, rabbit source) and HK1 (Abnova Cat# MAB10683, RRID:AB_11188071, 1:500 dilution, mouse source) were incubated at 4 °C overnight. After washing, the plate was incubated with HRP-conjugated secondary antibodies. Analysis was performed after sheet sealing with a fluorescent sealer.
-
The Glucose Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) and Lactate Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) were used according to the manufacturer's protocols to detect glucose uptake and lactate production HCC cells. All values were normalized to cell number (1 × 106 cells).
-
A sterile 8-µm perforated chamber was placed in 6-well plates, 3 mL of DMEM with 10% FBS was added to the lower chamber, and the transfected cells were plated into the upper chamber at a density of 1 × 106 cells/well in 1.5 mL of serum-free medium. Cells were cultured in a 37 °C humidified incubator with 5% CO2 for 48 h. The upper chamber residual cells were wiped off with a wet cotton stick. The cells that migrated through the 8-µm pores and adhered to the lower surface of the membranes were stained with 4% crystal violet dye solution containing paraformaldehyde for 30 min. PBS was used to wash the cells three times, and cell migration was recorded in each group under a light microscope.
-
The Matrigel was diluted with serum-free medium (1:7). A sterile 8-µm perforated chamber was placed in 6-well plates, and 400 µL of diluted Matrigel was added to the upper chamber overnight at 37 °C. The transfected cells were plated into the upper chamber at a density of 1 × 106 cells/well and cultured in a 37 °C humidified incubator with 5% CO2 for 72 h. The upper chamber residual cells were wiped off with a wet cotton stick. The lower surface of the membranes was stained with 4% crystal violet dye solution containing paraformaldehyde for 30 min. PBS was used to wash the cells three times, and cell invasion was recorded in each group under a light microscope.
-
Cell proliferative capacity was determined by the Cell Counting Kit‐8 reagent (CCK‐8, Engreen). Cells were seeded (1 × 103 cells/well in 100 μL of medium) in 96‐well plates containing DMEM with 10% FBS. The proliferative activity of cells was measured by CCK-8 at 0 h, 24 h, 48 h, 72 h, and 96 h. Briefly, 100 µL of CCK-8 dilution (CCK-8 to complete medium ratio = 1:10) was added, the plates were reacted at 37 °C for 120 min, and an M5 multifunctional microplate reader (Bio‐Rad) was used to detect the absorbance value at 450 nm.
-
Statistical graphs were generated by GraphPad Prism 9 (GraphPad Prism, RRID:SCR_002798). The correlation between PPP2R3A expression and HK1 was determined by Fishers exact test. The statistical significance of differences between two groups was determined by the t test. Measurement data are expressed as the mean ± SE. Significance was assumed at P < 0.05.
Overexpression of Protein Phosphatase 2 Regulatory Subunit B"Alpha Promotes Glycolysis by Regulating Hexokinase 1 in Hepatocellular Carcinoma
doi: 10.3967/bes2022.082
- Received Date: 2022-02-22
- Accepted Date: 2022-04-14
-
Key words:
- Hepatocellular carcinoma /
- PPP2R3A /
- Hexokinase 1 /
- Glycolysis
Abstract:
Citation: | JIAO Ning, JI Wan Sheng, ZHANG Biao, SHANG Yu Kui, ZHANG Yu Chen, YU Wei Qun, JIN Hai Long, LI Chao, ZHANG Cheng Ying, YAN Cheng, YUE Wen, ZHANG Qing. Overexpression of Protein Phosphatase 2 Regulatory Subunit B"Alpha Promotes Glycolysis by Regulating Hexokinase 1 in Hepatocellular Carcinoma[J]. Biomedical and Environmental Sciences, 2022, 35(7): 622-632. doi: 10.3967/bes2022.082 |