-
The standard strain C. albicans SC5314 was cultured in YPD (1% yeast extract, 2% peptone, and 2% glucose) liquid medium and incubated overnight in an orbital shaker at 200 rpm and 35 ℃. Fungal cells were harvested through centrifugation and washed twice prior to use in experiments. The egg yolk agar plate used in the phospholipase activity assay consisted of 1% glucose, 1% peptone, 2% agar, 10% sterile yolk, 1 mol/L NaCl, and 0.005 mol/L CaCl2[29]. Itraconazole was purchased from Sigma, and BDSF was synthesized in accordance with a previous report[30]. BDSF stock solution (0.3 mol/L) was prepared in an ethanol/water mixture (1:1), and itraconazole was suspended in DMSO. BDSF and itraconazole stock solutions were diluted to the concentration of 250 μmol/L using the corresponding medium and suspended in 0.3% Noble agar. The vehicle was added as the control. Each dilution was administered separately through intravaginal instillation.
-
TR146 oral epithelial cells and VK2/E6E7 vaginal epithelial cells were cultured in six-well plates until reaching 95% confluence and used to evaluate the adhesive ability of C. albicans cells. The cells were infected with C. albicans at the rate of 2 × 102 yeast cells per well in DMEM and treated with 0, 3, 30, or 300 μmol/L BDSF. The number of adherent cells was verified through colony counting. After 0.5 and 1 h of incubation, dissociative yeast cells were removed by thrice rinsing the wells gently with 3 mL of PBS. The wells were then covered with YPD agar, and the number of adherent cells was quantified through colony counting. Adhesion efficiency was expressed as the ratio of the number of adherent cells treated with BDSF to that of the cells cultured in DMEM only[31].
-
Candida cells were suspended and diluted in fresh YPD after overnight culture to obtain a 103 CFU/mL suspension for use in the agar invasion assay. Aliquots (20 µL) of yeast suspension was spread on YPD plates supplemented with 0, 3, 30, 100, 200, or 300 μmol/L BDSF. After 72 h of incubation at 37 ℃, the plates were then rinsed under running water to discard noninvasive cells. The washed plates were then incubated for an additional 8 h at 37 ℃ for the observation of the invasive ability of Candida cells.
The epithelial cell invasion assay was performed as previously described[32]. Briefly, TR146 and VK2/E6E7 cells were cultured on circular coverslips with diameters of 12 mm. After 2 days of culture, the cell monolayer was infected with 1 × 105 CFU yeast cells suspended in DMEM medium containing 0, 3, 30, 100, 200, or 300 μmol/L BDSF and placed for 3 h in a humidified incubator. The supernatant was discarded, and cells were rinsed three times with PBS to remove dissociative fungal cells. The cells were fixed with 4% paraformaldehyde. Any fungal cells that remained attached to epithelial cells were incubated for 1 h with rabbit anti-C. albicans antibodies (ab53891), rinsed thrice with PBS, and stained again with Cy3-tagged anti-rabbit IgG antibodies (ab97075). Fungal cells that did not invade epithelial tissue were labeled with red (Cy3) fluorescence. Next, epithelial cells were washed with PBS, and 0.5% Triton X-100 in PBS was added to the wells to permeabilize epithelial cells. Fungal cells were then incubated with FITC-tagged anti-C. albicans antibodies (ab21164) and labeled with green (FITC) fluorescence. Finally, the prepared coverslips were rinsed with PBS and visualized under fluorescence microscopy (Olympus X71).
-
The phospholipase activity of C. albicans was evaluated on egg yolk agar plates[29]. In brief, freshly cultured cells were diluted with PBS to an optical density of 0.6 at 600 nm. Next, 4 µL aliquots of fungal solution were spotted onto egg yolk plates supplemented with 0, 3, 30, 100, 200, or 300 μmol/L BDSF. After 5 days of incubation at 37 ℃, the diameters of colonies and the dense white precipitation zone on each plate were measured. Phospholipase activity (Pz value) was calculated as the colony diameter divided by the total diameter of the colony and precipitation zone.
-
The ability of C. albicans to cause cell damage was determined on the basis of lactate dehydrogenase (LDH) release. LDH release was quantified by using a commercial LDH cytotoxicity detection kit (Roche Applied Science). TR146 cells were seeded in 96-well tissue plates and cultured to 95% confluence. Each well was then infected with 2 × 104 fungal cells suspended in DMEM medium containing 0, 3, 30, 100, 200, or 300 μmol/L BDSF and cultured overnight in a humidified incubator. TR146 cells incubated with DMEM medium were considered as the low control and DMEM containing 0.5% Trion X-100 were considered as the high control. C. albicans cells were also seeded in the absence of epithelial cells. The damage incurred by epithelial cells infected with C. albicans cells was calculated in accordance with the following formula: (test sample release − low control release of TR146 and Candida cells)/(maximum cell release − low control release). The final result was expressed as (damage observed in the BDSF treatment sample)/(cells infected only with C. albicans) × 100[33].
-
A total of 110 female ICR mice (SLAR laboratory animal, Shanghai) aged 8-10 weeks were randomly assigned to four groups. The mouse model was constructed in accordance with a previous report[34, 35]. Mice were subcutaneously injected with 0.5 mg of estradiol valerate at 3 days before infection to induce transient pseudoestrus. On infection day, animals were inoculated intravaginally with 20 μL of yeast cell suspension containing 108 cells/mL. Animals in the negative control group were inoculated with sterile PBS. Mice in the positive control group were infected and received 0.3% Noble agar intravaginally, whereas those in the negative control group were reared without any treatment save for subcutaneous injections of estradiol valerate. The mice then received drug treatment at 24 h after infection. All animal experiments were performed in accordance with the guidelines of the National Institutes of Health on animal care. The study protocol was approved by the Animal Ethics Committees of Fudan University.
-
BDSF and itraconazole (250 μmol/L) were dispersed in 0.3% Noble agar and given intravaginally twice a day at the volume of 20 μL on 1-6 days postinfection. On days 1, 2, 4, and 7, the vaginas of the mouse models were swabbed with 200 μL of PBS. Next, 100 μL aliquots of each dilution (10−1 to 10−5) were inoculated on SDA plates for the quantification of fungal load (CFU/mL). Mice were then sacrificed, and blood was taken from the ventral vein and centrifuged to collect serum, which was then stored at −25 ℃. Serum was used to test the activity of superoxide dismutase (SOD) with a SOD testing kit (Jiancheng bioengineering institute). Vaginal tissue was also used for RNA extraction and histopathological examination (Boyuan biotechnology Co.). Vaginal inflammation was scored as follows: 0- normal; 1- slight inflammatory infiltration and swelling; 2- grade 1 changes involving 50% of the specimen; 3- obvious inflammatory infiltration, swelling, and mild ulceration; 4- grade 3 changes involving 50% of the specimen; and 5- extensive ulceration and necrosis[36].
-
The primers used in this study are shown in Table 1. RNA was obtained from murine vaginal tissue and C. albicans cells by using an RNA fast extracting kit (Tiangen Biotech Co.) and EASY spin yeast kit (Aidlab), respectively. DNA was degraded with DNase (Tiangen Biotech Co.). TevertAid first-strand cDNA synthesis kit (Fermentas) was used to synthesize cDNA, which was then diluted (1:16) with sterile Milli-Q water (Millipore) for real-time RT-PCR. Real-time RT-PCR was performed using SYBR Premix Ex Tag kit (TaKaRa) with a Stratagene Mx3000p System. A series (1:22 to 1:27) of cDNA dilutions were used to construct a standard curve for each primer pair. The reaction procedure consisted of 5 min of incubation at 95 ℃, 40 cycles of amplification (95 ℃ for 15 s, 55 ℃ for 20 s, and 72 ℃ for 30 s), and melting curve construction (95 ℃ for 15 s, 55 ℃ for 30 s, and 95 ℃ for 30 s). Then, the expression of target genes was normalized to that of the housekeeping gene ACT1 and calculated through comparative Ct method (ΔΔCt). Data were expressed as fold changes in the expression of target genes relative to that of the untreated control.
Table 1. Primers Used in This Study
Gene Primer Direction Sequence (5′-3′) C. albicans ALS3 Forward TCCACTTCACAATCCCCATC Reverse CAGTAGTAGTAACAGTAGTAGTTTCATC ALS9 Forward AATGTTCCTGCTGGGTATCG Reverse GATCACATCCCCGCTAGAGT MNT2 Forward CCACCACAATCACCTTCATC Reverse TTGTTTCTCTTGTTGCTGTGG PLB4 Forward AAAGCTCATGAAGATGTGGCT Reverse CCAATCCCGCCATCTATAAC LIP1 Forward ACTGACAATTTGCGTCAAGG Reverse TCCATAACCTCCAGGGAAAG ECE1 Forward AAGAGAGATGTTGCTCCAGCTG Reverse AATGGCATATCAGCAATGATAC ACT1 Forward TTGACCAAACCACTTTCAACTC Reverse AGAAGATGGAGCCAAAGCAG Mouse IGFBP3-1 Forward GGAACTGTGGGAGAGGATATG Reverse ACCATTATTTGCGACATCTCTG MCP-1 Forward ATTCACATGGAAAGCCCCC Reverse TTGAACACAAAGAGTACCAGAG ACT1 Forward TGTTACTGAGCTGCGTTTTAC Reverse CACCGTTCCAGTTTTTAAATCC -
All experiments were performed in triplicate, and results were expressed as means ± SD. One-way ANOVA was applied for the comparison of all groups. Student's t-test was used to compare paired groups. Differences were considered significant when P ≤ 0.05 and nonsignificant when P ≥ 0.05.
doi: 10.3967/bes2018.109
Protective Effects of cis-2-Dodecenoic Acid in an Experimental Mouse Model of Vaginal Candidiasis
-
Abstract:
Objective To evaluate the efficacy of cis-2-dodecenoic acid (BDSF) in the treatment and prevention of vaginal candidiasis in vivo. Methods The activities of different concentrations of BDSF against the virulence factors of Candida albicans (C. albicans) were determined in vitro. An experimental mouse model of Candida vaginitis was treated with 250 μmol/L BDSF. Treatment efficiency was evaluated in accordance with vaginal fungal burden and inflammation symptoms. Results In vitro experiments indicated that BDSF attenuated the adhesion and damage of C. albicans to epithelial cells by decreasing phospholipase secretion and blocking filament formation. Treatment with 30 μmol/L BDSF reduced the adhesion and damage of C. albicans to epithelial cells by 36.9% and 42.3%, respectively. Treatment with 200 μmol/L BDSF completely inhibited phospholipase activity. In vivo mouse experiments demonstrated that BDSF could effectively eliminate vaginal infection and relieve inflammatory symptoms. Four days of treatment with 250 μmol/L BDSF reduced vaginal fungal loads by 6-fold and depressed inflammation. Moreover, BDSF treatment decreased the expression levels of the inflammatory chemokine-associated genes MCP-1 and IGFBP3 by 2.5-and 2-fold, respectively. Conclusion BDSF is a novel alternative drug that can efficiently control vaginal candidiasis by inhibiting the virulence factors of C. albicans. -
Key words:
- C. albicans /
- cis-2-dodecenoic acid /
- Virulence factor /
- Candidiasis
-
Figure 1. Effect of BDSF on the adherence of C. albicans to mammalian cells and six-well plates after 0.5 (A) and 1 h (B) of incubation in DMEM medium. (C) Comparison of the expression levels of adhesion-related genes after treatment with 100 μmol/L BDSF. The expression levels of target genes were normalized relative to those of the housekeeping gene ACT1. The change in expression level was calculated as the ratio of the expression of a gene in cells treated with 100 μmol/L BDSF to those in untreated cells. Results are expressed as the average and standard errors of three independent replicates. *P < 0.05.
Figure 3. Representative fluorescent images of the invasion of C. albicans into VK2/E6E7 (A) and TR146 (B) epithelial cells under treatment with 0, 3, 30, 100, or 300 μmol/L BDSF. Differential staining of C. albicans hyphae: a (stained red fluorochrome Cy3), extracellular components of C. albicans hyphae and yeast; b (stained green fluorochrome FITC), intact C. albicans hyphae; c (extracellular parts appear pink), merged image of A and B; d, bright-field images. Arrows mark internalized hyphae.
Figure 4. (A) In vitro viability of TR146 cells exposed for 24 h to different concentrations of BDSF; (B) Suppression of TR146 epithelial cell damage by BDSF. Inset shows the morphology of C. albicans coincubated with TR146 after 12 h of treatment with 100 μmol/L BDSF; (C) Expression levels of ECE1 in C. albicans treated with 100 μmol/L BDSF relative to that of housekeeping gene ACT1. Changes in expression levels were calculated as the ratio of the expression of a gene in cells treated with 100 μmol/L BDSF to those in untreated cells. Results are expressed as the average and standard errors of three independent replicates. *P < 0.05.
Figure 5. Effect of BDSF on degradative enzyme production. (A) Inhibition of phospholipase production on egg yolk plates supplemented with different concentrations of BDSF; (B) Phospholipase and proteinase activity under different concentrations of BDSF; a high Pz indicates low enzyme production. (C) Expression level ratios of phospholipase-related genes after treatment with 100 μmol/L BDSF. Changes in expression levels were calculated as the ratio of the expression of a gene in cells treated with 100 μmol/L BDSF to that in untreated yeast cells. Results are expressed as the average and standard errors of 3 independent replicates. *P < 0.05.
Figure 6. Efficacy of BDSF and itraconazole in the treatment of experimental vaginal candidiasis, (A) fungal burden of lavage fluid from different groups of mice; (B) Superoxide dismutase activity in serum; (C) inflammation score of vaginal tissue; (D) Expression levels of MCP-1 and IGFBP3 in mouse vaginal tissue; (E) H & E staining of vaginal tissues for the examination of the extent of inflammatory infiltration. PAS staining for the examination of C. albicans. All pictures were magnified 200×.
Table 1. Primers Used in This Study
Gene Primer Direction Sequence (5′-3′) C. albicans ALS3 Forward TCCACTTCACAATCCCCATC Reverse CAGTAGTAGTAACAGTAGTAGTTTCATC ALS9 Forward AATGTTCCTGCTGGGTATCG Reverse GATCACATCCCCGCTAGAGT MNT2 Forward CCACCACAATCACCTTCATC Reverse TTGTTTCTCTTGTTGCTGTGG PLB4 Forward AAAGCTCATGAAGATGTGGCT Reverse CCAATCCCGCCATCTATAAC LIP1 Forward ACTGACAATTTGCGTCAAGG Reverse TCCATAACCTCCAGGGAAAG ECE1 Forward AAGAGAGATGTTGCTCCAGCTG Reverse AATGGCATATCAGCAATGATAC ACT1 Forward TTGACCAAACCACTTTCAACTC Reverse AGAAGATGGAGCCAAAGCAG Mouse IGFBP3-1 Forward GGAACTGTGGGAGAGGATATG Reverse ACCATTATTTGCGACATCTCTG MCP-1 Forward ATTCACATGGAAAGCCCCC Reverse TTGAACACAAAGAGTACCAGAG ACT1 Forward TGTTACTGAGCTGCGTTTTAC Reverse CACCGTTCCAGTTTTTAAATCC -
[1] Eggimann P, Garbino J, Pittet D, et al. Epidemiology of Candida species infections in critically ill non-immunosuppressed patients. Lancet Infect Dis, 2003; 3, 685-702. doi: 10.1016/S1473-3099(03)00801-6 [2] Lass-Floerl C. The changing face of epidemiology of invasive fungal disease in Europe. Mycoses, 2009; 52, 197-205. doi: 10.1111/myc.2009.52.issue-3 [3] Wilson D, Naglik JR, Hube B, et al. The missing link between Candida albicans hyphal morphogenesis and host cell damage. PLoS Pathog, 2016; 12, e1005867. doi: 10.1371/journal.ppat.1005867 [4] Consolaro MEL, Albertoni TA, Svidzinski AE, et al. Vulvovaginal candidiasis is associated with the production of germ tubes by Candida albicans. Mycopathologia, 2005; 159, 501-7. doi: 10.1007/s11046-005-1149-0 [5] Chaffin WL, Lopez-Ribot JL, Casanova M, et al. Cell wall and secreted proteins of Candida albicans: identification, function, and expression. Microb Mol Biol Rev, 1998; 62, 130-80. http://pubmedcentralcanada.ca/pmcc/articles/PMC98909/ [6] Kruppa M. Quorum sensing and Candida albicans. Mycoses, 2009; 52, 1-10. http://d.old.wanfangdata.com.cn/Periodical/spaqzljcjs201703022 [7] Nikawa H, Egusa H, Makihira S, et al. An in vitro evaluation of the adhesion of Candida species to oral and lung tissue cells. Mycoses, 2006; 49, 14-7. http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=3bba96c7c5658a007611dec0cd51161d [8] Mayer FL, Wilson D, Hube B, et al. Candida albicans pathogenicity mechanisms. Virulence, 2013; 4, 119-28. doi: 10.4161/viru.22913 [9] Munro CA, Bates S, Buurman ET, et al. Mnt1p and Mnt2p of Candida albicans are partially redundant alpha-1, 2-mannosyltransferases that participate in O-linked mannosylation and are required for adhesion and virulence. J Biol Chem, 2005; 280, 1051-60. doi: 10.1074/jbc.M411413200 [10] Calderone RA, Fonzi WA. Virulence factors of Candida albicans. Trends Microbiol, 2001; 9, 327-35. doi: 10.1016/S0966-842X(01)02094-7 [11] Tian J, Weng LX, Zhang YQ, et al. BDSF inhibits Candida albicans adherence to urinary catheters. Microb Pathog, 2013; 64, 33-8. doi: 10.1016/j.micpath.2013.07.003 [12] Murciano C, Moyes DL, Runglall M, et al. Evaluation of the role of Candida albicans agglutinin-like sequence (Als) proteins in human oral epithelial cell interactions. PLoS One, 2012; 7, e33362. doi: 10.1371/journal.pone.0033362 [13] Moyes DL, Wilson D, Richardson JP, et al. Candidalysin is a fungal peptide toxin critical for mucosal infection. Nature, 2016; 532, 64-8. doi: 10.1038/nature17625 [14] Theiss S, Ishdorj G, Brenot A, et al. Inactivation of the phospholipase B gene PLB5 in wild-type Candida albicans reduces cell-associated phospholipase A2 activity and attenuates virulence. Int J Med Microbiol, 2006; 296, 405-20. doi: 10.1016/j.ijmm.2006.03.003 [15] Fu Y, Ibrahim AS, Fonzi W, et al. Cloning and characterization of a gene (LIP1) which encodes a lipase from the pathogenic yeast Candida albicans. Microbiology, 1997; 143 (Pt2), 331-40. http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=64be4ed0f6700f33eb3ce8739b88bb6e [16] Schaller M, Borelli C, Korting HC, et al. Hydrolytic enzymes as virulence factors of Candida albicans. Mycoses, 2005; 48, 365-77. doi: 10.1111/myc.2005.48.issue-6 [17] Sudbery PE. Growth of Candida albicans hyphae. Nat Rev Micro, 2011; 9, 737-48. doi: 10.1038/nrmicro2636 [18] Wachtler B, Citiulo F, Jablonowski N, et al. Candida albicans-epithelial interactions: dissecting the roles of active penetration, induced endocytosis and host factors on the infection process. PLoS One, 2012; 7, e36952. doi: 10.1371/journal.pone.0036952 [19] Phan QT, Myers CL, Fu Y, et al. Als3 is a Candida albicans invasin that binds to cadherins and induces endocytosis by host cells. PLoS Biol, 2007; 5, e64. doi: 10.1371/journal.pbio.0050064 [20] Khosravi AR, Shokri H, Nikaein D, et al. Yeasts as important agents of onychomycosis: In vitro activity of propolis against yeasts isolated from patients with nail infection. J Altern Complem Med, 2013; 19, 57-62. doi: 10.1089/acm.2011.0722 [21] Masood A, Faisal S, Haque W, et al. Immunomodulator tuftsin augments anti-fungal activity of amphotericin B against experimental murine candidiasis. J Drug Target, 2002; 10, 185-92. doi: 10.1080/10611860290022615 [22] Khan MA, Khan A, Owais M, et al. Prophylactic use of liposomized tuftsin enhances the susceptibility of Candida albicans to fluconazole in leukopenic mice. FEMS Immun Med Microbiol, 2005; 46, 63-9. http://europepmc.org/abstract/MED/16420598 [23] De Bernardis F, Liu H, O'Mahony R, et al. Human domain antibodies against virulence traits of Candida albicans inhibit fungus adherence to vaginal epithelium and protect against experimental vaginal candidiasis. J Infect Dis, 2007; 195, 149-57. doi: 10.1086/jid.2007.195.issue-1 [24] De Bernardis F, Arancia S, Tringali G, et al. Evaluation of efficacy, pharmacokinetics and tolerability of peptidomimetic aspartic proteinase inhibitors as cream formulation in experimental vaginal candidiasis. J Pharm Pharmacol, 2014; 66, 1094-101. http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=fd1a38426d6d8bd6b227cceefa4611b8 [25] Hisajima T, Maruyama N, Tanabe Y, et al. Protective effects of farnesol against oral candidiasis in mice. Microbiol Immunol, 2008; 52, 327-33. doi: 10.1111/mim.2008.52.issue-7 [26] Arendrup MC. Epidemiology of invasive candidiasis. Curr Opin Crit Care, 2010; 16, 445-52. doi: 10.1097/MCC.0b013e32833e84d2 [27] Boon C, Deng Y, Wang L, et al. A novel DSF-like signal from Burkholderia cenocepacia interferes with Candida albicans morphological transition. ISME J, 2007; 2, 27-36. http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=a700f6389186779e928cff2f7d66ab20 [28] Zhang Y, Cai C, Yang Y, et al. Blocking of Candida albicans biofilm formation by cis-2-dodecenoic acid and trans-2-dodecenoic acid. J Med Microbiol, 2011; 60, 1643-50. doi: 10.1099/jmm.0.029058-0 [29] Price MF, Wilkinson ID, Gentry LO, et al. Plate method for detection of phospholipase activity in Candida albicans. Sabouraudia, 1982; 20, 7-14. doi: 10.1080/00362178285380031 [30] Wang L, Zhang L. Inhibitors of yeast filamentous growth and method of their manufacture. United State Patent No.8748486. http://www.researchgate.net/publication/302745045_Inhibitors_of_yeast_filamentous_growth_and_method_of_their_manufacture [31] Galgiani JN. Susceptibility of Candida albicans and other yeasts to fluconazole: relation between in vitro and in vivo studies. Rev Infec Dis, 1990; 12, S272-S5. doi: 10.1093/clinids/12.Supplement_3.S272 [32] Park H, Myers CL, Sheppard DC, et al. Role of the fungal Ras-protein kinase a pathway in governing epithelial cell interactions during oropharyngeal candidiasis. Cell Microbiol, 2005; 7, 499-510. http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=2c0ba8f74698bab70e3314b4ea8ec536 [33] Wächtler B, Wilson D, Hube B, et al. Candida albicans adhesion to and invasion and damage of vaginal epithelial cells: stage-specific inhibition by clotrimazole and bifonazole. Antimicrob Agents Chemother, 2011; 55, 4436-9. doi: 10.1128/AAC.00144-11 [34] Hamad M, Muta'eb E, Abu‐Shaqra Q, et al. Utility of the oestrogen-dependent vaginal candidosis murine model in evaluating the efficacy of various therapies against vaginal Candida albicans infection. Mycoses, 2006; 49, 104-8. doi: 10.1111/myc.2006.49.issue-2 [35] González GM, Portillo OJ, Uscanga GI, et al. Therapeutic efficacy of voriconazole against a fluconazole-resistant Candida albicans isolate in a vaginal model. J Antimicrob Chemoth, 2009; 64, 571-3. doi: 10.1093/jac/dkp228 [36] Gill N, Rosenthal KL, Ashkar AA, et al. NK and NKT cell-independent contribution of interleukin-15 to innate protection against mucosal viral infection. J Virol, 2005; 79, 4470-8. doi: 10.1128/JVI.79.7.4470-4478.2005 [37] Dalle F, Wächtler B, L'Ollivier C, et al. Cellular interactions of Candida albicans with human oral epithelial cells and enterocytes. Cell Microbiol, 2010; 12, 248-71. doi: 10.1111/cmi.2010.12.issue-2 [38] Zheng H, Yu YS. TOP2 gene is involved in the pathogenicity of Candida albicans. Mol Cell Biochem, 2012; 364, 45-52. doi: 10.1007/s11010-011-1203-9 [39] Kovachev SM, Vatcheva-Dobrevska RS. Local probiotic therapy for vaginal Candida albicans infections. Probiotics antimicro, 2015; 7, 38-44. doi: 10.1007/s12602-014-9176-0 [40] Newman SL, Holly A. Candida albicans is phagocytosed, killed, and processed for antigen presentation by human dendritic cells. Infect Immun, 2001; 69, 6813-22. doi: 10.1128/IAI.69.11.6813-6822.2001 [41] Poyart C, Pellegrini E, Gaillot O, et al. Contribution of Mn-cofactored superoxide dismutase (SODA) to the virulence of Streptococcus agalactiae. Infect immun, 2001; 69, 5098-106. doi: 10.1128/IAI.69.8.5098-5106.2001 [42] Guo N, Wu S, Shen Y, et al. Protective effect of glycyrrhizine in mice with systemic Candida albicans infection and its mechanism. Acta Academiae Medicinae Sinicae, 1991; 13, 380-3. http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=QK000004132202 [43] Saavedra M, Taylor B, Lukacs N, et al. Local production of chemokines during experimental vaginal candidiasis. Infect Immun, 1999; 67, 5820-6. http://d.old.wanfangdata.com.cn/OAPaper/oai_pubmedcentral.nih.gov_96961 [44] Chen R, Fɑn Y, Lin Y, et al. Expression of IGFBP-3 and caspase-3 in murine vaginal mucosa with experimental candidiasis. J Guangdong Medical, 2009; 5. (In Chinese) http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=gdyxyxb200905004 [45] Zheng CJ, Yoo J-S, Lee T-G, et al. Fatty acid synthesis is a target for antibacterial activity of unsaturated fatty acids. FEBS Lett, 2005; 579, 5157-62. doi: 10.1016/j.febslet.2005.08.028 [46] Laskar K, Faisal SM, Rauf A, et al. Undec-10-enoic acid functionalized chitosan based novel nano-conjugate: An enhanced anti-bacterial/biofilm and anti-cancer potential. Carbohydr Polym, 2017; 166, 14-23. doi: 10.1016/j.carbpol.2017.02.082 [47] Khan AA, Alam M, Tufail S, et al. Synthesis and characterization of novel PUFA esters exhibiting potential anticancer activities: an in vitro study. Eur J Med Chem, 2011; 46, 4878-86. doi: 10.1016/j.ejmech.2011.07.044 [48] Ahmad N, Alam M, Shehbaz A, et al. Antimicrobial activity of clove oil and its potential in the treatment of vaginal candidiasis. J Drug Target, 2005; 13, 555-61. doi: 10.1080/10611860500422958 [49] Clement M, Tremblay J, Lange M, et al. Whey-derived free fatty acids suppress the germination of Candida albicans in vitro. FEMS Yeast Res, 2007; 7, 276-85. doi: 10.1111/fyr.2007.7.issue-2 [50] Noverr MC, Huffnagle GB. Regulation of Candida albicans morphogenesis by fatty acid metabolites. Infect Immun, 2004; 72, 6206-10. doi: 10.1128/IAI.72.11.6206-6210.2004 [51] McLain N, Ascanio R, Baker C, et al. Undecylenic acid inhibits morphogenesis of Candida albicans. Antimicrob Agents Chemother, 2000; 44, 2873-5. doi: 10.1128/AAC.44.10.2873-2875.2000 [52] Goncalves LM, Del Bel Cury AA, Sartoratto A, et al. Effects of undecylenic acid released from denture liner on Candida biofilms. J Dent Res, 2012; 91, 985-9. doi: 10.1177/0022034512458689 [53] Oh KB, Miyazawa H, Naito T, et al. Purification and characterization of an autoregulatory substance capable of regulating the morphological transition in Candida albicans. Proc Natl Acad Sci U S A, 2001; 98, 4664-8. doi: 10.1073/pnas.071404698 [54] K Weber BSaMR. The quorum-sensing molecule E, E-farnesol-ts variable secretion and its impact on the growth and metabolism of Candida species. Yeast, 2010; 27, 727-39. doi: 10.1002/yea.1769 [55] Lo HJ, Köhler JR, DiDomenico B, et al. Nonfilamentous C. albicans mutants are avirulent. Cell, 1997; 90, 939-49. doi: 10.1016/S0092-8674(00)80358-X [56] Ghannoum MA, Filler SG, Ibrahim AS, et al. Modulation of interactions of Candida albicans and endothelial cells by fluconazole and amphotericin B. Antimicrob Agents Chemother, 1992; 36, 2239-44. doi: 10.1128/AAC.36.10.2239 [57] Filler SG, Swerdloff JN, Hobbs C, et al. Penetration and damage of endothelial cells by Candida albicans. Infect Immun, 1995; 63, 976-83. http://d.old.wanfangdata.com.cn/OAPaper/oai_pubmedcentral.nih.gov_173098 [58] Ghannoum MA. Potential role of phospholipases in virulence and fungal pathogenesis. Clin Microbiol Rev, 2000; 13, 122-43. doi: 10.1128/CMR.13.1.122 [59] Souza JL, da Silva AF, Carvalho PH, et al. Aliphatic fatty acids and esters: inhibition of growth and exoenzyme production of Candida, and their cytotoxicity in vitro: anti-Candida effect and cytotoxicity of fatty acids and esters. Arch Oral Biol, 2014; 59, 880-6. doi: 10.1016/j.archoralbio.2014.05.017