Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats

DENG Zhi Jie ZHAO Jing Fang HUANG Feng SUN Gui Li GAO Wei LU Li XIAO De Qiang

Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033
引用本文: Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats
[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033
DENG Zhi Jie, ZHAO Jing Fang, HUANG Feng, SUN Gui Li, GAO Wei, LU Li, XIAO De Qiang. Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033
Citation: DENG Zhi Jie, ZHAO Jing Fang, HUANG Feng, SUN Gui Li, GAO Wei, LU Li, XIAO De Qiang. Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033

Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats

doi: 10.3967/bes2020.033

Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats

Funds: This work was financially supported by National Natural Science Foundation of China [No. 31360383]
More Information
    Author Bio:

    DENG Zhi Jie, male, born in 1991, MD, majoring in clinical nutrition

    Corresponding author: LU Li, Tel: 86-771-5358259, E-mail: luligx@163.comXIAO De Qiang, Tel: 86-771-5358259, E-mail: dak407@189.cn
    • 关键词:
    •  / 
    •  / 
    •  / 
    •  / 
    •  
  • Figure  1.  The procedure of animal treatment. i.p., intraperitoneal injection; i.g., intragastric; AFB1, aflatoxin B1; PCB2, procyanidin B2; DMSO, dimethyl sulfoxide.

    Figure  2.  PCB2 reduced the abnormal AFB1-induced organ coefficient. (A) Total weight gain during the experiment, (B) liver coefficient, (C) kidney coefficient, and (D) spleen coefficient. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group. SD, standard deviation; AFB1, aflatoxin B1; PCB2, procyanidin B2.

    Figure  3.  Procyanidin B2 (PCB2) ameliorated aflatoxin B1 (AFB1)-induced hepatic histopathological damage and abnormal liver function. Hematoxylin and eosin staining of the liver in the (A) control group, (B) AFB1 group, (C) AFB1 + PCB2 group, and (D) PCB2 group. (E) Serum alanine aminotransferase (ALT), (F) aspartate aminotransferase (AST), (G) alkaline phosphatase (ALP) activities, (H) total bilirubin (TBIL), and (I) direct bilirubin (DBIL) were measured. Scale bars: 100 μm. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group.

    Figure  4.  Procyanidin B2 (PCB2) suppressed aflatoxin B1 (AFB1)-induced oxidative injury and inflammatory response. (A) Hepatic catalase (CAT) activity, (B) hepatic superoxide dismutase (SOD) activity, (C) hepatic glutathione (GSH) content, (D) hepatic 8-hydroxy-2′-deoxyguanosine (8-OHdG) content, (E) serum malondialdehyde (MDA) content, (F) relative mRNA expression of IL-6, and (G) serum interleukin-6 (IL-6) concentration. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group.

    Figure  5.  Procyanidin B2 (PCB2) decreased aflatoxin B1 (AFB1)-induced apoptosis of hepatocytes. Relative mRNA expression of (A) bcl-2, (B) bax, and (C) bcl-2/bax mRNA ratio were measured. Western blot analysis of (D) bcl-2, (E) bax, and (F) bcl-2/bax protein ratio were performed. (G) Protein strip of bax, bcl-2, and β-actin. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group.

    Table  1.   Polymerase chain reaction primers and the amplified product length

    GenePrimer sequences (5′-3′)Product length (bp)
    IL-6Forward: AGTTGCCTTCTTGGGACTGA126
    Reverse: CCTCCGACTTGTGAAGTGGT
    bcl-2Forward: GACTGAGTACCTGAACCGGCATC135
    Reverse: CTGAGCAGCGTCTTCAGAGACA
    baxForward: AGACACCTGAGCTGACCTTGGA196
    Reverse: TTGAAGTTGCCATCAGCAAACA
    β-actinForward: GGAGATTACTGCCCTGGCTCCTA150
    Reverse: GACTCATCGTACTCCTGCTTGCTG
    下载: 导出CSV
  • [1] Kowalska A, Walkiewicz K, Koziel P, et al. Aflatoxins: characteristics and impact on human health. Postepy Hig Med Dosw (Online), 2017; 71, 315−27.
    [2] Medina A, Rodriguez A, Magan N. Effect of climate change on Aspergillus flavus and aflatoxin B1 production. Front Microbiol, 2014; 5, 348.
    [3] Rushing BR, Selim MI. Aflatoxin B1: a review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem Toxicol, 2019; 124, 81−100. doi:  10.1016/j.fct.2018.11.047
    [4] Nugraha A, Khotimah K, Rietjens I. Risk assessment of aflatoxin B1 exposure from maize and peanut consumption in Indonesia using the margin of exposure and liver cancer risk estimation approaches. Food Chem Toxicol, 2018; 113, 134−44. doi:  10.1016/j.fct.2018.01.036
    [5] Bbosa GS, Kitya D, Odda J, et al. Aflatoxins metabolism, effects on epigenetic mechanisms and their role in carcinogenesis. Health, 2013; 10, 720−6.
    [6] Eaton DL, Gallagher EP. Mechanisms of aflatoxin carcinogenesis. Annu Rev Pharmacol Toxicol, 1994; 34, 135−72. doi:  10.1146/annurev.pa.34.040194.001031
    [7] Engin AB, Engin A. DNA damage checkpoint response to aflatoxin B1. Environ Toxicol Pharmacol, 2019; 65, 90−6. doi:  10.1016/j.etap.2018.12.006
    [8] Shen HM, Shi CY, Lee HP, et al. Aflatoxin B1-induced lipid peroxidation in rat liver. Toxicol Appl Pharmacol, 1994; 127, 145−50. doi:  10.1006/taap.1994.1148
    [9] Qiu T, Shen X, Li X, et al. Egg yolk immunoglobulin supplementation prevents rat liver from aflatoxin b1-induced oxidative damage and genotoxicity. J Agric Food Chem, 2018; 66, 13260−7. doi:  10.1021/acs.jafc.8b04659
    [10] El-Nekeety AA, Salman AS, Hathout AS, et al. Evaluation of the bioactive extract of actinomyces isolated from the Egyptian environment against aflatoxin B1-induce cytotoxicity, genotoxicity and oxidative stress in the liver of rats. Food Chem Toxicol, 2017; 105, 241−55. doi:  10.1016/j.fct.2017.04.024
    [11] Ma Q, Li Y, Fan Y, et al. Molecular mechanisms of lipoic acid protection against aflatoxin b1-induced liver oxidative damage and inflammatory responses in broilers. Toxins (Basel), 2015; 7, 5435−47. doi:  10.3390/toxins7124879
    [12] Mughal MJ, Xi P, Yi Z, et al. Aflatoxin B1 invokes apoptosis via death receptor pathway in hepatocytes. Oncotarget, 2017; 8, 8239−49.
    [13] Ali Rajput S, Sun L, Zhang N, et al. Ameliorative effects of grape seed proanthocyanidin extract on growth performance, immune function, antioxidant capacity, biochemical constituents, liver histopathology and aflatoxin residues in broilers exposed to aflatoxin b1 [published correction appears in Toxins (Basel). 2018 Sep 10;10(9)]. Toxins (Basel), 2017; 9, 371. doi:  10.3390/toxins9110371
    [14] Yang D, Jiang H, Lu J, et al. Dietary grape seed proanthocyanidin extract regulates metabolic disturbance in rat liver exposed to lead associated with PPARα signaling pathway. Environ Pollut, 2018; 237, 377−87. doi:  10.1016/j.envpol.2018.02.035
    [15] Liu B, Jiang H, Lu J, et al. Grape seed procyanidin extract ameliorates lead-induced liver injury via miRNA153 and AKT/GSK-3β/Fyn-mediated Nrf2 activation. J Nutr Biochem, 2018; 52, 115−23. doi:  10.1016/j.jnutbio.2017.09.025
    [16] Niu Q, He P, Xu S, et al. Fluoride-induced iron overload contributes to hepatic oxidative damage in mouse and the protective role of grape seed proanthocyanidin extract. J Toxicol Sci, 2018; 43, 311−9. doi:  10.2131/jts.43.311
    [17] Yang BY, Zhang XY, Guan SW, et al. Protective effect of procyanidin B2 against CCl4-induced acute liver injury in mice. Molecules, 2015; 20, 12250−65. doi:  10.3390/molecules200712250
    [18] Wang Z, Zhang Z, Du N, et al. Hepatoprotective effects of grape seed Procyanidin B2 in rats with carbon tetrachloride-induced hepatic fibrosis. Altern Ther Health Med, 2015; 21(Suppl 2), 12−21.
    [19] Su H, Li Y, Hu D, et al. Procyanidin B2 ameliorates free fatty acids-induced hepatic steatosis through regulating TFEB-mediated lysosomal pathway and redox state. Free Radic Biol Med, 2018; 126, 269−86. doi:  10.1016/j.freeradbiomed.2018.08.024
    [20] Xing YW, Lei GT, Wu QH, et al. Procyanidin B2 protects against diet-induced obesity and non-alcoholic fatty liver disease via the modulation of the gut microbiota in rabbits. World J Gastroenterol, 2019; 25, 955−66. doi:  10.3748/wjg.v25.i8.955
    [21] Cui Y, Ling JG, Yao WR, et al. Protective Effect of Aloe vera against Aflatoxin B1-Induced Acute Hepatotoxicity in Rats. Food Sci, 2016; 37, 175−81. (In Chinese)
    [22] Wang HJ, Wu ZB. Histological, histochemical and ultrastructural studies on acute hepatic injury induced by aflatoxin b1 in rats. J Tongji Med Univ, 1992; 153−5, 211. (In Chinese)
    [23] Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods, 2012; 9, 671−5. doi:  10.1038/nmeth.2089
    [24] IARC monographs preamble–preamble to the IARC ponographs (amended January 2019). WHO. https://monographs.iarc.fr/iarc-monographs-preamble-preamble-to-the-iarc-monographs/. [2019-9-11]
    [25] Muhammad I, Wang X, Li S, et al. Curcumin confers hepatoprotection against AFB1-induced toxicity via activating autophagy and ameliorating inflammation involving Nrf2/HO-1 signaling pathway. Mol Biol Rep, 2018; 45, 1775−85. doi:  10.1007/s11033-018-4323-4
    [26] Yılmaz S, Kaya E, Comakli S. Vitamin E (α tocopherol) attenuates toxicity and oxidative stress induced by aflatoxin in rats. Adv Clin Exp Med, 2017; 26, 907−17. doi:  10.17219/acem/66347
    [27] Qian G, Tang L, Lin S, et al. Sequential dietary exposure to aflatoxin B1 and fumonisin B1 in F344 rats increases liver preneoplastic changes indicative of a synergistic interaction. Food Chem Toxicol, 2016; 95, 188−95. doi:  10.1016/j.fct.2016.07.017
    [28] Amaya-Farfan J. Aflatoxin B1-induced hepatic steatosis: role of carbonyl compounds and active diols on steatogenesis. Lancet, 1999; 353, 747−8. doi:  10.1016/S0140-6736(98)09261-7
    [29] Solis-Cruz B, Hernandez-Patlan D, Petrone VM, et al. Evaluation of a bacillus-based direct-fed microbial on aflatoxin b1 toxic effects, performance, immunologic status, and serum biochemical parameters in broiler chickens. Avian Dis, 2019; 63, 659−69. doi:  10.1637/aviandiseases-D-19-00100
    [30] Kleiner DE. Histopathological challenges in suspected drug-induced liver injury. Liver Int, 2018; 38, 198−209. doi:  10.1111/liv.13584
    [31] Shyamal S, Latha PG, Suja SR, et al. Hepatoprotective effect of three herbal extracts on aflatoxin B1-intoxicated rat liver. Singapore Med J, 2010; 51, 326−31.
    [32] Dufour DR, Lott JA, Nolte FS, et al. Diagnosis and monitoring of hepatic injury. I. Performance characteristics of laboratory tests. Clin Chem, 2000; 46, 2027−49. doi:  10.1093/clinchem/46.12.2027
    [33] Dufour DR, Lott JA, Nolte FS, et al. Diagnosis and monitoring of hepatic injury. II. Recommendations for use of laboratory tests in screening, diagnosis, and monitoring. Clin Chem, 2000; 46, 2050−68. doi:  10.1093/clinchem/46.12.2050
    [34] Brinda R, Vijayanandraj S, Uma D, et al. Role of Adhatoda vasica (L.) Nees leaf extract in the prevention of aflatoxin-induced toxicity in Wistar rats. J Sci Food Agric, 2013; 93, 2743−8. doi:  10.1002/jsfa.6093
    [35] Ajiboye TO, Yakubu MT, Oladiji AT. Lophirones B and C prevent aflatoxin B1-induced oxidative stress and DNA fragmentation in rat hepatocytes. Pharm Biol, 2016; 54, 1962−70. doi:  10.3109/13880209.2015.1137603
    [36] Berndt C, Lillig CH. Glutathione, glutaredoxins, and iron. Antioxid Redox Signal, 2017; 27, 1235−51. doi:  10.1089/ars.2017.7132
    [37] Bowling AC, Schulz JB, Brown RH Jr, et al. Superoxide dismutase activity, oxidative damage, and mitochondrial energy metabolism in familial and sporadic amyotrophic lateral sclerosis. J Neurochem, 1993; 61, 2322−5. doi:  10.1111/j.1471-4159.1993.tb07478.x
    [38] Heck DE, Shakarjian M, Kim HD, et al. Mechanisms of oxidant generation by catalase. Ann N Y Acad Sci, 2010; 1203, 120−5. doi:  10.1111/j.1749-6632.2010.05603.x
    [39] Tsikas D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal Biochem, 2017; 524, 13−30. doi:  10.1016/j.ab.2016.10.021
    [40] Kasai H. What causes human cancer? Approaches from the chemistry of DNA damage. Genes Environ, 2016; 38, 19. doi:  10.1186/s41021-016-0046-8
    [41] Kim YS, Kim YH, Noh JR, et al. Protective effect of korean red ginseng against aflatoxin b1-Induced hepatotoxicity in rat. J Ginseng Res, 2011; 35, 243−9. doi:  10.5142/jgr.2011.35.2.243
    [42] Shen HM, Ong CN, Lee BL, et al. Aflatoxin B1-induced 8-hydroxydeoxyguanosine formation in rat hepatic DNA. Carcinogenesis, 1995; 16, 419−22. doi:  10.1093/carcin/16.2.419
    [43] Yao X, Huang J, Zhong H, et al. Targeting interleukin-6 in inflammatory autoimmune diseases and cancers. Pharmacol Ther, 2014; 141, 125−39. doi:  10.1016/j.pharmthera.2013.09.004
    [44] Rose-John S. IL-6 trans-signaling via the soluble IL-6 receptor: importance for the pro-inflammatory activities of IL-6. Int J Biol Sci, 2012; 8, 1237−47. doi:  10.7150/ijbs.4989
    [45] Huang L, Zhao Z, Duan C, et al. Lactobacillus plantarum C88 protects against aflatoxin B1-induced liver injury in mice via inhibition of NF-κB-mediated inflammatory responses and excessive apoptosis. BMC Microbiol, 2019; 19, 170. doi:  10.1186/s12866-019-1525-4
    [46] Rajput SA, Sun L, Zhang NY, et al. Grape seed proanthocyanidin extract alleviates aflatoxin b1-induced immunotoxicity and oxidative stress via modulation of NF-κB and Nrf2 signaling pathways in broilers. Toxins (Basel), 2019; 11, 23. doi:  10.3390/toxins11010023
    [47] Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat Rev Immunol, 2008; 8, 958−69. doi:  10.1038/nri2448
    [48] Long M, Zhang Y, Li P, et al. Intervention of grape seed Proanthocyanidin extract on the subchronic immune injury in mice induced by aflatoxin b1. Int J Mol Sci, 2016; 17, 516. doi:  10.3390/ijms17040516
    [49] Hinton DM, Myers MJ, Raybourne RA, et al. Immunotoxicity of aflatoxin B1 in rats: effects on lymphocytes and the inflammatory response in a chronic intermittent dosing study. Toxicol Sci, 2003; 73, 362−77. doi:  10.1093/toxsci/kfg074
    [50] Reed JC. Proapoptotic multidomain Bcl-2/Bax-family proteins: mechanisms, physiological roles, and therapeutic opportunities. Cell Death Differ, 2006; 13, 1378−86. doi:  10.1038/sj.cdd.4401975
    [51] Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol, 2007; 35, 495−516. doi:  10.1080/01926230701320337
    [52] Wang X, Muhammad I, Sun X, et al. Protective role of curcumin in ameliorating AFB1-induced apoptosis via mitochondrial pathway in liver cells. Mol Biol Rep, 2018; 45, 881−91. doi:  10.1007/s11033-018-4234-4
    [53] Liu Y, Wang W. Aflatoxin B1 impairs mitochondrial functions, activates ROS generation, induces apoptosis and involves Nrf2 signal pathway in primary broiler hepatocytes. Anim Sci J, 2016; 87, 1490−500. doi:  10.1111/asj.12550
    [54] Majtnerová P, Roušar T. An overview of apoptosis assays detecting DNA fragmentation. Mol Biol Rep, 2018; 45, 1469−78. doi:  10.1007/s11033-018-4258-9
    [55] Loo DT. In situ detection of apoptosis by the TUNEL assay: an overview of techniques. Methods Mol Biol, 2011; 682, 3−13.
  • [1] Shuiqing Qu, Yan Liang, Shuoqiu Deng, Yu Li, Yue Dai, Chengcheng Liu, Tuo Liu, Luqi Wang, Lina Chen, Yujie Li.  Shenlian Extract Protects against Ultrafine Particulate Matter-Aggravated Myocardial Ischemic Injury by Inhibiting Inflammation and Cell Apoptosis . Biomedical and Environmental Sciences, 2025, 38(2): 206-218. doi: 10.3967/bes2024.137
    [2] CAO Wei Hua, JIANG Ting Ting, SHEN Ge, DENG Wen, WANG Shi Yu, ZHANG Zi Yu, LI Xin Xin, LU Yao, ZHANG Lu, LIU Ru Yu, CHANG Min, WU Shu Ling, GAO Yuan Jiao, HAO Hong Xiao, CHEN Xiao Xue, HU Lei Ping, XU Meng Jiao, YI Wei, XIE Yao, LI Ming Hui.  Association of Cytokines with Clinical Indicators in Patients with Drug-Induced Liver Injury . Biomedical and Environmental Sciences, 2024, 37(5): 494-502. doi: 10.3967/bes2024.054
    [3] LI Xiao Hong, LIU Yu Mei, SHAN Hui, TAN Jin Feng, ZHOU Jian, SONG Yuan Jin, LI Si Qi, LIU Chen, XU Dong Qun, YU Li, LI Wan Wei.  Salidroside Ameliorates Lung Injury Induced by PM2.5 by Regulating SIRT1-PGC-1α in Mice . Biomedical and Environmental Sciences, 2024, 37(4): 367-376. doi: 10.3967/bes2024.041
    [4] ZHAO Hui, QIU Xia, LI Hua Zi, CUI Jia Jia, SUN Yong Ye.  Association between Serum Uric Acid to HDL-Cholesterol Ratio and Nonalcoholic Fatty Liver Disease Risk among Chinese Adults . Biomedical and Environmental Sciences, 2023, 36(1): 1-9. doi: 10.3967/bes2022.111
    [5] LIU Miao Qing, CHEN Hai Qiong, DAI Hai Peng, LI Jing Jing, TIAN Fu Hong, WANG Yi Yan, CHEN Cong De, LI Xiao Heng, LI Jun Wei, LI Zhong Rong, GE Ren Shan.  Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats . Biomedical and Environmental Sciences, 2023, 36(1): 60-75. doi: 10.3967/bes2023.006
    [6] Shikha Sharma, Ritu Gupta, Sonu Chand Thakur.  Attenuation of Collagen Induced Arthritis by Centella asiatica Methanol Fraction via Modulation of Cytokines and Oxidative Stress . Biomedical and Environmental Sciences, 2014, 27(12): 926-938. doi: 10.3967/bes2014.133
    [7] MAO Gen Xiang, LAN Xiao Guang, CAO Yong Bao, CHEN Zhuo Mei, HE Zhi Hua, LV Yuan Dong, WANG Ya Zhen, HU Xi Lian, WANG Guo Fu, YAN Jing.  Effects of Short-Term Forest Bathing on Human Health in a Broad-Leaved Evergreen Forest in Zhejiang Province, China . Biomedical and Environmental Sciences, 2012, 25(3): 317-324. doi: 10.3967/0895-3988.2012.03.010
    [8] LING WANG, JIE LI, YAN XIE, XUE-GUANG ZHANG.  Association between Serum Homocysteine and Oxidative Stress in Elderly Patients with Obstructive Sleep Apnea/hypopnea Syndrome1 . Biomedical and Environmental Sciences, 2010, 23(1): 42-47.
    [9] MILENA KATARANOVSKI, SRDJA JANKOVI(C), DRAGAN KATARANOVSKI, JELENA (S)TOSI(C), DESA BOGOJEVI(C).  Gender Differences in Acute Cadmium-Induced Systemic Inflammation in Rats . Biomedical and Environmental Sciences, 2009, 22(1): 1-7.
    [10] NING-HUA HUANG, QIN WANG, DONG-QUN XU.  Immunological Effect of PM2.5 on Cytokine Production in Female Wistar Rats1 . Biomedical and Environmental Sciences, 2008, 21(1): 63-68.
    [11] YOU-GEN ZHU, SHU-MEI ZHANG, JI-YUE WANG, WEI-QIANG XIAO, XIN-YU WANG, JUN-FU ZHOU.  Overweight and Obesity-Induced Oxidative Stress in Children . Biomedical and Environmental Sciences, 2006, 19(5): 353-359.
    [12] JIAN-GUO LOU, JIE DONG, YI-CHUN ZHENG, SHU-MEI ZHANG, WEI-QIANG XIAO, JUN-FU ZHOU.  Increased Oxidative Stress and Damage in Patients With Chronic Bacterial Prostatitis . Biomedical and Environmental Sciences, 2006, 19(6): 481-486.
    [13] JUN-FU ZHOU, XIN-YU WANG, XUE-JUN SHANGGUAN, ZU-MING GAO, SHU-MEI ZHANG, WEI-QIANG XIAO, CHANG-GUI CHEN.  Increased Oxidative Stress in Women With Pregnancy-induced Hypertension . Biomedical and Environmental Sciences, 2005, 18(6): 419-426.
    [14] YOU-GEN ZHU, JUN-FU ZHOU, WEI-YING SHAN, PEI-SU ZHOU, GUI-ZHONG TONG.  Potential Oxidative Stress in the Bodies of Electric Arc Welding Operators:Effect of Photochemical Smog . Biomedical and Environmental Sciences, 2004, 17(4): 381-389.
    [15] JUN-FU ZHOU, WEN ZHOU, SHU-MEI ZHANG, YAN-ER LUO, Huai-Hong Chen.  Oxidative Stress and Free Radical Damage in Patients With Acute Dipterex Poisoning . Biomedical and Environmental Sciences, 2004, 17(2): 223-233.
    [16] JUN-FU ZHOU, YE-HUA ZHOU, Liang Zhang, Huai-Hong Chen, DONG CAI.  3,4-Methylenedioxymethamphetamine (MDMA) Abuse Markedly Inhibits Acetylcholinesterase Activity and Induces Severe Oxidative Damage and Liperoxidative Damage . Biomedical and Environmental Sciences, 2003, 16(1): 53-61.
    [17] JUN-FU ZHOU, WEI-WEI CHEN, GUI-ZHONG TONG.  Ozone Emitted During Copying Process -A Potential Cause of Pathological Oxidative Stress and Potential Oxidative Damage in the Bodies of Operators . Biomedical and Environmental Sciences, 2003, 16(2): 95-104.
    [18] ZHOU JUN-FU, CHEN Jia-xi, SHEN Han-chao, CAI DONG.  Abnormal Reactions of Free Radicals and Oxidative Damages in the Bodies of Patients With Chronic Glomerulonephritis . Biomedical and Environmental Sciences, 2002, 15(3): 233-244.
    [19] XIE Bo, ZHOU JUN-FU, LU Qun, LI Chong-jian, CHEN PENG.  Oxidative Stress in Patients With Acute Coxsackie Virus Myocarditis . Biomedical and Environmental Sciences, 2002, 15(1): 48-57.
    [20] ZHOU JUN-FU, CHEN PENG.  Studies on the Oxidative Stress in Alcohol Abusers in China . Biomedical and Environmental Sciences, 2001, 14(3): 180-188.
  • 加载中
图(5) / 表ll (1)
计量
  • 文章访问数:  3616
  • HTML全文浏览量:  1462
  • PDF下载量:  174
  • 被引次数: 0
出版历程
  • 收稿日期:  2019-10-24
  • 录用日期:  2020-02-05
  • 刊出日期:  2020-04-20

Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats

doi: 10.3967/bes2020.033
    基金项目:  This work was financially supported by National Natural Science Foundation of China [No. 31360383]
    作者简介:

    DENG Zhi Jie, male, born in 1991, MD, majoring in clinical nutrition

    通讯作者: LU Li, Tel: 86-771-5358259, E-mail: luligx@163.comXIAO De Qiang, Tel: 86-771-5358259, E-mail: dak407@189.cn

English Abstract

Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033
引用本文: Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats
[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033
DENG Zhi Jie, ZHAO Jing Fang, HUANG Feng, SUN Gui Li, GAO Wei, LU Li, XIAO De Qiang. Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033
Citation: DENG Zhi Jie, ZHAO Jing Fang, HUANG Feng, SUN Gui Li, GAO Wei, LU Li, XIAO De Qiang. Protective Effect of Procyanidin B2 on Acute Liver Injury Induced by Aflatoxin B1 in Rats[J]. Biomedical and Environmental Sciences, 2020, 33(4): 238-247. doi: 10.3967/bes2020.033
    • Aflatoxin B1 (AFB1), a secondary metabolite produced mainly by fungi, Aspergillus flavus and Aspergillus parasiticus, is one of the most toxic carcinogens known to date[1]. Areas with warm, humid climates and abundant rain provide optimal growth conditions for these molds. Improper storage of food leads to AFB1 contamination easily, and foods such as peanuts, corn, rice, sorghum, milk, and oil are susceptible to AFB1 contamination[2]. Once the food is contaminated by AFB1, it is difficult to remove it[3]. The exposure of AFB1 due to contamination is difficult to be realized, resulting in hepatocellular carcinoma after a long-term process[4]. Therefore, it is necessary to develop effective methods to prevent AFB1-induced hepatotoxicity.

      In the mammalian body, the liver is the main target organ for AFB1 toxicity. AFB1 can be absorbed into the body through the skin, digestive tract, and respiratory tract. Upon entering the body, AFB1 is mainly metabolized to AFB1-exo-8, 9-epoxide (AFBO), aflatoxin M1, and aflatoxicol by the cytochrome P450 enzyme system and cytoplasmic reductase enzymes in the liver[5]. AFBO, which binds to DNA resulting in the formation of AFB1-DNA adducts, leads to mutations and carcinogenesis[6, 7]. It has also been reported that AFB1 can lead to liver injury via oxidative damage[8-10], inflammation[11], apoptosis[12].

      Natural phytochemicals have gained great attraction for properties of chemical toxicity resistance by exerting multiple biological activities in recent years. Grape seed procyanidin extract (GSPE), rich in polyphenols, plays a protective role in liver injury induced by environmental toxicants, such as AFB1[13], lead[14, 15], and fluoride[16]. As one of the main components of GSPE, procyanidin B2 (PCB2) shows a similar positive impact on the liver. It is reported that PCB2 ameliorates acute hepatic injury and liver fibrosis caused by carbon tetrachloride (CCl4)[17, 18]. PCB2 has also been shown to reduce hepatic steatosis through transcription factor EB-mediated lysosomal and redox state[19]. Moreover, PCB2 protects against nonalcoholic fatty liver disease by modulating gut microbiota[20]. Taken together, these findings suggest that PCB2 exhibits a hepatoprotective effect, but whether PCB2 has a protective effect on AFB1-induced acute liver injury remains unknown.

      The present study aimed to determine the protective effect of PCB2 on acute liver injury induced by AFB1 through in vivo experiments. The results of this study would lay a foundation for further research on the prevention of hepatocellular carcinoma and provide a theoretical basis for future dietary guidance to prevent the negative effects of AFB1.

    • PCB2 [purity > 98.0% high-performance liquid chromatography (HPLC)] was purchased from Chengdu Biopurify Phytochemicals Ltd. (Chengdu, China). AFB1 (purity > 98.0% HPLC) was purchased from Sigma Aldrich (USA). Dimethyl sulfoxide (DMSO, purity ≥ 99.9%) was purchased from MP Biomedicals (USA). Superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), and malondialdehyde (MDA) assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Bicinchoninic acid (BCA) protein assay kit was purchased from MULTI SCIENCES (Hangzhou, China). Eastep® Super Total RNA Extraction Kit, GoScript™ Reverse Transcription Mix, and GoTaq® quantitative polymerase chain reaction (qPCR) Master Mix were purchased from Promega Corporation (USA). Interleukin-6 (IL-6) and 8-hydroxy-2′-deoxyguanosine (8-OHdG) enzyme-linked immunosorbent assay (ELISA) kits were purchased from Jiangsu Meimian Industrial Co., Ltd. (Jiangsu, China). Primary antibodies against bcl-2 and bax were purchased from Cell Santa Cruz Biotechnology (USA); the β-actin antibody was purchased from Cell Signaling Technology Inc. (USA). The secondary goat anti-rabbit and goat anti-mouse horseradish peroxidase-conjugated antibodies were purchased from Cell Signaling Technology Inc. Western Lightning Plus enhanced chemiluminescence (ECL) was purchased from PerkinElmer Inc. (USA).

    • Six week-aged male Sprague Dawley (SD) rats were purchased from Guangxi Medical University Laboratory Animal Center (Nanning, China). All rats were housed in standard animal cages with free access to food and water under a strict 12 h light-dark cycle. They were acclimated to the animal facility environment for 1 week before experiments. SD rats were randomly divided into four groups (n = 10 each). The control and AFB1 groups were given double distilled water by gavage for 5 d consecutively. The AFB1 + PCB2 and PCB2 groups were administered PBC2 by gavage for 5 consecutive days (30 mg/kg, dissolved in double distilled water). After 5 d of gavage, the AFB1 and AFB1 + PCB2 groups were given single intraperitoneal injections of AFB1 (2 mg/kg, dissolved in DMSO) on the sixth day, whereas the control and PCB2 groups intraperitoneally received equal volume of DMSO. The AFB1 + PCB2 and PCB2 groups received daily intragastric administration of PCB2, whereas the other two groups received daily intragastric administration of double distilled water continually until the end of experiment. On the eighth day, the animals were euthanized. Blood samples were collected, and the serum was separated immediately. The liver tissue was isolated from each rat, washed in ice-cold saline, and stored at −80 °C for further experimental analyses. The dose, administration way, and exposure time of AFB1 mentioned earlier were based on study of Cui et al.[21] and Wang[22]. All experimental procedures were approved by the Animal Ethics Committee of Guangxi Medical University (Nanning, China). The whole procedure of animal treatment can be seen in Figure 1.

      Figure 1.  The procedure of animal treatment. i.p., intraperitoneal injection; i.g., intragastric; AFB1, aflatoxin B1; PCB2, procyanidin B2; DMSO, dimethyl sulfoxide.

    • The body mass of all rats were weighed at a fixed time every morning. The whole liver, spleen, and kidney were weighed after being isolated from body, rinsed by ice-cold saline, and dried by filter paper. Weight gain was calculated as body weight after experiment minus the body weight before experiment. Liver coefficient, spleen coefficient, and kidney coefficient were calculated as liver mass/body mass, spleen mass/body mass, and kidney mass/body mass, respectively. The calculation result was expressed as g/100 g.

    • The whole blood remained still for 1 h at 4 °C after collection, and then, the serum was separated by centrifugation at 3,000 rpm for 15 min at 4 °C. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), direct bilirubin (DBIL), and alkaline phosphatase (ALP) were detected by Hitachi 7600-020 automatic biochemical analyzer, following the manufacturer’s protocol.

    • The excised liver tissue was fully fixed in 4% paraformaldehyde and then dehydrated, paraffin-embedded, sectioned, and stained with hematoxylin and eosin. The sections of liver tissue were observed with EVOS FL Auto Cell Imaging System.

    • Liver tissue was homogenized in ice-cold saline at a ratio of 1:9 (g:mL) and centrifuged at 2,500 rpm for 10 min at 4 °C. The supernatant was used for hepatic CAT, GSH, and SOD detection. The serum was used to measure MDA concentration. The measurements were performed according to the manufacturer’s instructions.

    • The serum level of interleukin-6 (IL-6) and hepatic level of 8-OHdG were measured by ELISA kits. Samples were prepared before performing ELISA test. For 8-OHdG determination, the required supernatant was obtained by homogenizing liver tissue in phosphate-buffered saline at a ratio of 1:9 (g:mL) and centrifuging at 5,000 rpm for 15 min. The serum was directly used to detect IL-6 concentration. The operation steps of ELISA include as follows: preparing standard solution for standard curve establishment, loading samples, washing plate, rendering color, terminating reaction, and determining the optical density value. All procedures were performed following the manufacturer’s instructions of ELISA kits.

    • Total RNA was extracted from the liver tissue by Eastep® Super Total RNA Extraction Kit. RNA reverse transcription was conducted by GoScript™ Reverse Transcription Mix, and qPCR was performed using GoTaq® qPCR Master Mix. The primers used in this study are listed in Table 1. PCR amplification was carried out by StepOne™ Real-Time PCR System for 40 cycles; the procedures included prevariation at 95 °C for 10 min, denaturation at 95 °C for 15 s, annealiation at 55 °C for 30 s, and extension at 72 °C for 30 s.

      Table 1.  Polymerase chain reaction primers and the amplified product length

      GenePrimer sequences (5′-3′)Product length (bp)
      IL-6Forward: AGTTGCCTTCTTGGGACTGA126
      Reverse: CCTCCGACTTGTGAAGTGGT
      bcl-2Forward: GACTGAGTACCTGAACCGGCATC135
      Reverse: CTGAGCAGCGTCTTCAGAGACA
      baxForward: AGACACCTGAGCTGACCTTGGA196
      Reverse: TTGAAGTTGCCATCAGCAAACA
      β-actinForward: GGAGATTACTGCCCTGGCTCCTA150
      Reverse: GACTCATCGTACTCCTGCTTGCTG
    • The excised liver tissue was homogenized in RIPA lysis buffer [1% Triton X-100, 1% deoxycholate, 0.1% sodium dodecylsulphate (SDS), and 1 mmol/L phenylmethylsulfonyl fluoride]. The lysate was centrifuged at 14,000 g for 10 min. The supernatant was used for protein quantification by BCA protein assay kit to ensure equal loading of total protein of each sample on a 12% SDS-polyacrylamide gel electrophoresis gel. The proteins were transferred to polyvinylidene fluoride membranes. Membranes were incubated with blocking buffer (20% skim milk) for 30 min at room temperature and then incubated with primary antibodies for bcl-2, bax, and β-actin overnight at 4 °C. Subsequently, the membranes were washed three times using 1× Tris-buffered saline with Tween buffer and incubated with secondary antibodies for 1 h at room temperature. The proteins on membrane were visualized by Western Lightning Plus ECL. The intensity of each protein band was quantified by densitometry using Image J software[23].

    • All data were expressed as mean ± standard deviation. Data were analyzed by one-way analysis of variance and followed by a least significant difference test. Statistical analysis was performed using SPSS 20.0 software. P < 0.05 was identified as statistically different.

    • The liver, spleen, and kidney index coefficients were elevated in rats exposed to AFB1 compared with the control group (all P < 0.01). PCB2 lowered the liver and kidney coefficients in AFB1-treated rats (all P < 0.01). The weight gain was inhibited by AFB1 (P < 0.01), while PCB2 could not significantly prevent it as shown in the AFB1 + PCB2 group versus the AFB1 group (P > 0.05; Figure 2A–D).

      Figure 2.  PCB2 reduced the abnormal AFB1-induced organ coefficient. (A) Total weight gain during the experiment, (B) liver coefficient, (C) kidney coefficient, and (D) spleen coefficient. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group. SD, standard deviation; AFB1, aflatoxin B1; PCB2, procyanidin B2.

    • Histopathological change of liver sections was performed under the life EVOS FL Auto Cell Imaging System. The control and PCB2 groups showed normal liver architecture with even texture and polygonal hepatocytes. Liver injury in the AFB1 group was characterized by rough texture, spotty necrosis, ballooning degeneration of liver cells, and inflammatory cell infiltration, whereas the AFB1 + PCB2 group showed a reduction in these negative histopathological changes. The result indicated that the administration of PCB2 might have a protective effect on AFB1-induced histopathological damage (Figure 3A–D).

      Figure 3.  Procyanidin B2 (PCB2) ameliorated aflatoxin B1 (AFB1)-induced hepatic histopathological damage and abnormal liver function. Hematoxylin and eosin staining of the liver in the (A) control group, (B) AFB1 group, (C) AFB1 + PCB2 group, and (D) PCB2 group. (E) Serum alanine aminotransferase (ALT), (F) aspartate aminotransferase (AST), (G) alkaline phosphatase (ALP) activities, (H) total bilirubin (TBIL), and (I) direct bilirubin (DBIL) were measured. Scale bars: 100 μm. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group.

    • After exposure to AFB1, rats exhibited higher serum levels of ALT, AST, TBIL, DBIL, and ALP (all P < 0.01). PCB2 treatment decreased the serum levels of ALT, AST, TBIL, DBIL, and ALP (all P < 0.05); however, the levels detected were still above baseline (all P < 0.01). There was no statistical difference between the control and PCB2 groups (all P > 0.05). The results suggest that PCB2 could ameliorate AFB1-induced liver damage (Figure 3E–I).

    • Hepatic activities of CAT, SOD, GSH, 8-OHdG, and serum MDA were measured to access the extent of oxidation. CAT, GSH, and SOD levels were decreased in the AFB1 group compared with that in the control group (all P < 0.01), whereas the MDA and 8-OHdG levels were increased in the AFB1 group compared with that in the control group (both P < 0.01). PCB2 treatment could significantly reverse the decreased CAT, GSH, and SOD levels (all P < 0.05) and increased MDA and 8-OHdG levels as shown in the AFB1 + PCB2 group versus the AFB1 group (P < 0.01 or P < 0.05). The oxidative extent between the control and PCB2 groups was comparable (all P > 0.05). Since 8-OHdG is the biomarker of DNA oxidative damage, the results indicate that PCB2 could prevent the oxidative injury of liver tissue and DNA oxidative damage caused by AFB1 (Figure 4A–E).

      Figure 4.  Procyanidin B2 (PCB2) suppressed aflatoxin B1 (AFB1)-induced oxidative injury and inflammatory response. (A) Hepatic catalase (CAT) activity, (B) hepatic superoxide dismutase (SOD) activity, (C) hepatic glutathione (GSH) content, (D) hepatic 8-hydroxy-2′-deoxyguanosine (8-OHdG) content, (E) serum malondialdehyde (MDA) content, (F) relative mRNA expression of IL-6, and (G) serum interleukin-6 (IL-6) concentration. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group.

    • AFB1 treatment significantly increased hepatic IL-6 mRNA expression and serum IL-6 compared with the control group (P < 0.05 or P < 0.01), whereas PCB2 treatment decreased the expression and levels of these two inflammatory response markers compared with the AFB1 group (P < 0.05 or P < 0.01). There was no significant difference between the control and PCB2 groups in IL-6 mRNA expression and serum levels of IL-6 (both P > 0.05). The results hinted that PCB2 could hinder inflammatory response induced by AFB1 (Figure 4F and G).

    • The mRNA and protein ratios of bcl-2/bax suggest apoptosis of hepatocytes. When the ratio decreases, it indicates that hepatocytes may undergo apoptosis. Compared with the control group, the mRNA and protein ratios of bcl-2/bax were significantly lower in the AFB1 group (both P < 0.01). However, the mRNA and protein bcl-2/bax ratios were higher in the AFB1 + PCB2 group than the AFB1 group (P < 0.01 or P < 0.05). The mRNA and protein bcl-2/bax ratios in the PCB2 group were comparable with those in the control group (both P > 0.05). The results revealed that PCB2 might decrease AFB1-induced apoptosis of hepatocytes (Figure 5A–G).

      Figure 5.  Procyanidin B2 (PCB2) decreased aflatoxin B1 (AFB1)-induced apoptosis of hepatocytes. Relative mRNA expression of (A) bcl-2, (B) bax, and (C) bcl-2/bax mRNA ratio were measured. Western blot analysis of (D) bcl-2, (E) bax, and (F) bcl-2/bax protein ratio were performed. (G) Protein strip of bax, bcl-2, and β-actin. The data are expressed as mean ± standard deviation. *P < 0.05 vs. the control group; #P < 0.05 vs. the AFB1 group.

    • AFB1 has been classified as a group 1 carcinogen, which is the top level of carcinogenicity categories, by the International Agency for Research on Cancer recently[24]. Previous studies have shown that AFB1 exerts carcinogenesis after being transformed into intermediate metabolites[3]. Meanwhile, the formation of AFBO and reactive oxygen species (ROS) deplete GSH, resulting in oxidative stress[5]. Histopathological change, liver dysfunction, and inflammation always exist in AFB1-induced hepatotoxicity[25-27]. In this study, PCB2 significantly ameliorated these adverse effects, which may partially explain its protective properties on AFB1-induced liver injury.

      The organ coefficient is the ratio of organ mass to body weight, which reflects the influence of a substance on experimental animals. Changes in body weight and organ mass during the course of an experiment can affect the organ coefficient. In this study, the weight gain of the AFB1 group rats was lower than that of the control group, whereas the liver, spleen, and kidney coefficients were higher (Figure 2A–D), indicating that body weight change is one of the main factors affecting the organ coefficient of rats subjected to acute liver injury. Previous studies have also shown that AFB1 has a negative effect on weight gain[28, 29], probably due to the impaired liver function affecting appetite and biosynthesis. Compared with the AFB1 group, there was no significant change in the weight gain of the AFB1 + PCB2 group, but the liver and kidney coefficients decreased (Figure 2A–C), suggesting that PCB2 may reduce the abnormal weight gain of liver and kidney caused by AFB1.

      Histopathological examination is the gold standard for determining hepatic damage. Once a liver injury occurs, hepatocytes may undergo edema, necrosis or apoptosis, and inflammatory cell infiltration[30]. AFB1 was reported to cause acute liver injury at an intraperitoneal injection dose of 1.5 mg/kg, characterized by the structure of hepatic lobule becoming abnormal, hepatocytes showing a balloon-like change, and bile duct hyperplasia in the portal area accompanied by inflammatory cell infiltration[31]. In our study, the pathological damage of liver tissue was observed 48 h after exposure to 2 mg/kg AFB1 in SD rats. The hepatocytes showed obvious balloon-like changes; the hepatic cord structure was destroyed; the texture of the tissue was disordered, and there were spotted necrosis and inflammatory cell infiltration (Figure 3B), which was similar to previous studies. While the clearer structure of liver tissue could be seen in the AFB1 + PCB2 group (Figure 3C), this finding indicates that PCB2 has a protective effect on AFB1-induced hepatic pathological damage.

      Intracellular ALT, AST, and ALP are released into the peripheral blood, increasing the concentration of these enzymes in the serum when hepatocytes undergo damage. In addition, the ability of hepatocyte to ingest, transform, and excrete bilirubin is reduced, resulting in elevating levels of serum bilirubin[32, 33]. Therefore, serum ALT, AST, ALP, and bilirubin can serve as biomarkers of liver dysfunction. It was reported that when rats were exposed to AFB1, serum ALT, AST, and TBIL increased[34, 35]. The current study showed that the serum ALT, AST, ALP, TBIL, and DBIL of rats were elevated after the exposure to AFB1, whereas PCB2 administration could reduce these five indexes (Figure 3E–I), suggesting that PCB2 could ameliorate liver dysfunction.

      GSH, CAT, and SOD are proteins or enzymes that scavenge oxygen free radicals and toxins in the body. GSH, composed of glutamate, cysteine, and glycine, is the main antioxidant of the human body exerting a detoxification effect[36]. SOD is an essential antioxidant enzyme widely found in living organisms, which catalyzes the disproportionation of superoxide anion to oxygen and hydrogen peroxide[37]. CAT is the enzyme that catalyzes the decomposition of hydrogen peroxide[38]. The concentration of these proteins or enzymes serves as a surrogate measure of the body’s ability to resist oxidative damage. MDA is the end product of lipid peroxidation, which reflects the degree of lipid peroxidation damage in the body[39]. 8-OHdG is the biomarker of DNA oxidative damage, mainly caused by ROS attacking the eighth carbon atom of the guanine base in DNA[40]. Oxidative damage induced by AFB1 can be monitored by detecting SOD, CAT, MDA, and 8-OHdG[41, 42]. Our study found that AFB1 leads to obvious oxidative damage with descending GSH, CAT, and SOD and elevating 8-OHdG and MDA, whereas PCB2 administration could inversely change the tendency (Figure 4A–E). Therefore, PCB2 may have a protective effect on AFB1-induced oxidative damage.

      When inflammation occurs in the body, the immune system secretes a large number of cytokines into the blood, leading to an increasing concentration of these factors in the serum[43, 44]. Previous studies showed that AFB1 could promote inflammation via elevating the levels of interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-α and involving the activated nuclear factor kappa B (NF-κB) signaling pathways by upregulation of toll-like receptor 2 (TLR2) and TLR4[45, 46]. IL-6 is an important pro-inflammatory factor mediating the acute inflammatory response and inducing B/T cell proliferation[47]. In our research, relative IL-6 mRNA expression and serum IL-6 levels increased in the AFB1 group compared with that of in the control group. Conversely, PCB2 treatment could decrease IL-6 gene expression and serum IL-6 level (Figure 4F and G). Long et al.[48] and Hinton et al.[49] observed that AFB1 treatment led to increased serum IL-6, whereas GSPE could lower the concentration of IL-6[48], which was similar to our findings. These results indicated that PCB2 could alleviate the inflammatory response caused by AFB1, but the underlying mechanism needs further research.

      Bcl-2 and bax are proteins regulating the initiation of apoptosis. When the ratio of bcl-2/bax protein expression decreases, cells are more likely to undergo apoptosis[50]. Apoptosis is a biological process of programmed cell death[51]. According to previous studies, AFB1 invokes apoptosis in the process of exerting hepatotoxicity, which upregulation of p53, caspase-3, and bax and downregulation of bcl-2 can be measured[52]. Meanwhile, the apoptosis induced by AFB1 is related to the death receptor pathway[12] and the Nrf2 signal pathway[53]. In this study, the gene and protein expression of bcl-2 in single AFB1-treated rats decreased (Figure 5A–D), whereas the gene and protein expressions of bax increased (Figure 5B and E), resulting in a decreased bcl-2/bax ratio (Figure 5C and F). Compared with AFB1-treated rats, the gene and protein expressions of bcl-2 in PCB2 + AFB1 rats increased (Figure 5A and D), bax expression decreased (Figure 5B and E), and bcl-2/bax ratio increased (Figure 5C and F). It is speculated that AFB1 may cause apoptosis during the process of inducing acute liver injury; PCB2 could inhibit liver damage by reducing hepatocyte apoptosis. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay is a better method to detect tissue apoptosis[54, 55], thus, it would be better to apply it for further research.

      GSPE has been proven to display a protective effect on AFB1-induced toxicity. Administration of GSPE was found to attenuate hepatotoxicity, immunotoxicity, and oxidative stress caused by AFB1 via modulating NF-κB and Nrf2 pathways, which restored liver dysfunction and contents of antioxidant enzymes and inhibited mRNA expression of inflammatory factors[13, 46, 48]. Although these findings indicate that GSPE may be a potent substance resistant to AFB1 toxicity, it remains unknown which components play the main role, for GSPE is a mixture of procyanidins. In this study, we observed that PBC2, one of the main components of GSPE, reduced serum AST, ALT, MDA, and IL-6 and elevated hepatic CAT, GSH, and SOD under the acute exposure of AFB1, exhibiting the similar characteristics of GSPE. Previous studies also showed that PCB2 exerted hepatoprotective effect through anti-oxidation and anti-inflammatory on liver injury induced by chemical substances like CCl4[17, 18]. In summary, PCB2 may protect against toxicant-induced liver damage mainly targeting oxidation and inflammation, while the mechanisms of which need further exploration.

      In conclusion, this study reveals that PCB2 has an inhibitory effect on AFB1-induced acute liver injury, mainly in reducing histopathological damage, oxidative damage, inflammation, and probable apoptosis in hepatocytes. Therefore, PCB2 may serve as a potential phytochemical with anti-AFB1 toxicity. However, this study does not explore the dose-effect relationship between PCB2 and AFB1. Further research needs to be conducted to address this relationship.

    • The authors declared no conflict of interests.

    • DENG Zhi Ji and ZHAO Jing Fang conducted most experiments, DENG Zhi Jie wrote the paper; HUANG Feng assisted in the completion of animal experiments; SUN Gui Li and GAO Wei collected the experiment data; LU Li and XIAO De Qiang designed this study, LU Li revised this paper.

参考文献 (55)

目录

    /

    返回文章
    返回