Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats

LIU Miao Qing CHEN Hai Qiong DAI Hai Peng LI Jing Jing TIAN Fu Hong WANG Yi Yan CHEN Cong De LI Xiao Heng LI Jun Wei LI Zhong Rong GE Ren Shan

LIU Miao Qing, CHEN Hai Qiong, DAI Hai Peng, LI Jing Jing, TIAN Fu Hong, WANG Yi Yan, CHEN Cong De, LI Xiao Heng, LI Jun Wei, LI Zhong Rong, GE Ren Shan. Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats[J]. Biomedical and Environmental Sciences, 2023, 36(1): 60-75. doi: 10.3967/bes2023.006
Citation: LIU Miao Qing, CHEN Hai Qiong, DAI Hai Peng, LI Jing Jing, TIAN Fu Hong, WANG Yi Yan, CHEN Cong De, LI Xiao Heng, LI Jun Wei, LI Zhong Rong, GE Ren Shan. Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats[J]. Biomedical and Environmental Sciences, 2023, 36(1): 60-75. doi: 10.3967/bes2023.006

doi: 10.3967/bes2023.006

Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats

Funds: This work was supported by the National Natural Science Fund of China [no. 81730042]
More Information
    Author Bio:

    LIU Miao Qing, male, born in 1984, Postgraduate, majoring in lediatric surgery

    CHEN Hai Qiong, female, born in 1994, Postgraduate, majoring in pediatric surgery

    Corresponding author: LI Zhong Rong, E-mail: wmclzr@163.comGE Ren Shan, E-mail: r_ge@yahoo.com
  • The work was performed as a collaboration among all authors.
  • LIU Miao Qing, CHEN Hai Qiong, DAI Hai Peng, LI Jing Jing, TIAN Fu Hong, WANG Yi Yan, CHEN Cong De, LI Xiao Heng, LI Jun Wei, LI Zhong Rong, and GE Ren Shan defined the research topic. GE Ren Shan and LI Zhong Rong conceptualized the study design and analyzed the data. GE Ren Shan wrote the paper. All authors have contributed to, read, and approved the manuscript.
  • &These authors contributed equally to this work.
    • 关键词:
    •  / 
    •  / 
    •  / 
    •  / 
    •  
    The work was performed as a collaboration among all authors.
    LIU Miao Qing, CHEN Hai Qiong, DAI Hai Peng, LI Jing Jing, TIAN Fu Hong, WANG Yi Yan, CHEN Cong De, LI Xiao Heng, LI Jun Wei, LI Zhong Rong, and GE Ren Shan defined the research topic. GE Ren Shan and LI Zhong Rong conceptualized the study design and analyzed the data. GE Ren Shan wrote the paper. All authors have contributed to, read, and approved the manuscript.
    &These authors contributed equally to this work.
    注释:
    1) AUTHOR CONTRIBUTIONS: 2) AUTHOR CONTRIBUTIONS:
  • Figure  1.  Regimen and serum testosterone (T), luteinizing hormone (LH), and follicle-stimulating hormone (FSH) levels after BBOP exposure in puberty. Panel A, BBOP (0, 10, 100, 250, or 500 mg/kg bw per day) was administered via gavage; Panels B–D, serum T, LH, and FSH levels, respectively. Mean ± SEM, n = 6; *P < 0.05 and **P < 0.01 in the BBOP group versus control (0 mg/kg).

    Figure  2.  Immunohistochemical staining of CYP11A1 and the number of Leydig cells (LC). The LC number was normalized to that of Sertoli cells (SC). Panels A–E, CYP11A1 staining of the 0, 10, 100, 250, and 500 mg/kg bw per day BBOP groups, respectively. Black arrow indicates CYP11A1. Scale bar = 20 μm. Panel F, quantitative number. Mean ± SEM, n = 6. **P < 0.01 in the BBOP group versus the control (0 mg/kg).

    S1.  Immunohistochemical staining of SOX9 and Sertoli cell (SC) number in the testis after BBOP exposure from postnatal day (PND) 35 to 56 Panels A–E, SOX9 staining for 0, 10, 100, 250, and 500 mg/kg BBOP group, respectively; Black arrow points to SOX9 staining; Scale bar = 20 μm; Panel F, quantitation of SC number; Mean ± SEM, n = 6. There was no significant difference in the BBOP group versus the control (0 mg/kg).

    Figure  3.  Gene expression in the testis and pituitary gland after BBOP exposure. The expression of the testis genes Lhcgr, Scarb1, Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b3, Hsd11b1, Insl3, Nr5a1, Sox9, Dhh, and Fshr and of the pituitary genes Gnrhr, Lhb, and Fshb (in the dotted box) was determined by qPCR. The mRNA levels were normalized to those of Rsp16 (internal control). Mean ± SEM, n = 6. *P < 0.05, **P < 0.01 and ***P < 0.001 in the BBOP group versus the control (0 mg/kg).

    Figure  4.  Protein levels in the testis after BBOP exposure. Panel A, western blotting image. Panel B, quantitative results for CYP11A1, HSD11B1, INSL3, and DHH, normalized to GAPDH (the internal control). Mean ± SEM, n = 3–4. *P < 0.05 and **P < 0.01, in the BBOP group versus the control (0 mg/kg).

    Figure  5.  Semi-quantitative immunohistochemical measurement of CYP11A1 density and Leydig cell (LC) morphological metrics. Panels A–E, CYP11A1 staining for 0, 10, 100, 250, and 500 mg/kg bw per day BBOP, groups, respectively. Black arrow indicates CYP11A1 staining; scale bar = 20 μm. Panel F, CYP11A1 density. Panels G–I, LC size, nuclear size, and cytoplasm size. Mean ± SEM, n = 6. *P < 0.05 and ***P < 0.001 in the BBOP group versus the control (0 mg/kg).

    Figure  6.  Expression of antioxidant enzymes, apoptosis-associated genes, and malondialdehyde (MDA) amounts after BBOP exposure. Panel A, expression of Sod1, Sod2, Gpx1, Cat, Bax, and Bcl2 in the testis, normalized to Rsp16. Panel B, testicular level of MDA. Panel C, western blotting image. Panel D, quantitative results of antioxidant enzymes and apoptosis-associated proteins. Mean ± SEM, n = 6 for mRNAs and MDA and n = 3 for western blotting. *P < 0.05, **P < 0.01, and ***P < 0.001 in the BBOP group versus the control (0 mg/kg).

    Figure  7.  SIRT1, AKT1, AKT2, ERK1/2, mTOR, and GSK3β and their phosphorylated protein levels in the rat testis. Panel A, western blotting image. Panels B–G: quantification of AKT1, AKT2, ERK1/2, mTOR, and GSK3β, and their phosphorylated proteins, as well as SIRT1. The protein levels were normalized to those of GAPDH (internal control). Mean ± SEM, n = 3. *P < 0.05 and **P < 0.01 in the BBOP group versus the control (0 mg/kg).

    Figure  8.  Effects of BBOP on reactive oxygen species (ROS) and apoptosis in Leydig cells from 35-day-old rats. Leydig cells were cultured for 24 h. Panel A: ROS fluorescence spectrum. Panel B: quantification of ROS levels. Panel C: apoptosis spectrum. Panel D: quantification of the apoptosis rate. Mean ± SEM, n = 3. *P < 0.05, **P < 0.01, and ***P < 0.001 in the BBOP group versus the control (0 μmol/L).

    S2.  Immunohistochemical staining of HSD11B1 and Leydig cell (LC) number in the testis after BBOP exposure from postnatal day (PND) 35 to 56. Panels A–E, HSD11B1 staining for 0, 10, 100, 250, and 500 mg/kg BBOP group, respectively; Scale bar = 20 μm; Panel F, quantitation of LC number [normalized to Sertoli cell (SC) number]; Mean ± SEM, n = 6. There was no significant difference in the BBOP group versus the control (0 mg/kg).

    S3.  Semi-quantitative measurement SOX9 density in the testis after BBOP exposure from postnatal day (PND) 35 to 56. Panels A–E, SOX9 staining for 0, 10, 100, 250, and 500 mg/kg BBOP group, respectively; Black arrow points to SOX9 staining; Scale bar = 20 μm. Panel F, SOX9 density; Mean ± SEM, n = 6. There is no significant difference in the BBOP group versus the control (0 mg/kg).

    S4.  Graphical abstract

    S1.   qPCR primer information

    SymbolGene namePrimerSequences (5’to 3’)bpAccession No.
    LhcgrLuteinizing hormone receptorForward
    Reverse
    CTGCGCTGTCCTGGCC
    CGACCTCATTAAGTCCCCTGAA
    102NM_012978
    StarSteroidogenic acute regulatory proteinForward
    Reverse
    CCCAAATGTCAAGGAAATCA
    AGGCATCTCCCCAAAGTG
    187NM_031558
    Scarb1Scavenger receptor class B member 1Forward
    Reverse
    ATGGTACTGCCGGGCAGAT
    CGAACACCCTTGATTCCTGGTA
    117NM_031541
    Cyp11a1Cholesterol side chain cleavageForward
    Reverse
    AAGTATCCGTGATGTGGG
    TCATACAGTGTCGCCTTTTCT
    127NM_017286
    Cyp17a117α-Hydroxylase/17,20-lyaseForward
    Reverse
    TGGCTTTCCTGGTGCACAATC
    TGAAAGTTGGTGTTCGGCTGAAG
    90NM_012753
    Hsd3b13β-Hydroxysteroid dehydrogenase 1Forward
    Reverse
    CCCTGCTCTACTGGCTTGC
    TCTGCTTGGCTTCCTCCC
    189NM_001007719
    Hsd17b317β-Hydroxysteroid dehydrogenase 3Forward
    Reverse
    TGAAAGTTGGTGTTCGGCTGAAG
    TGAAAGTTGGTGTTCGGCTGAAG
    202NM_054007
    Hsd11b111β-Hydroxysteroid dehydrogenase 1Forward
    Reverse
    GAAGAAGCATGGAGGTCAAC
    GCAATCAGAGGTTGGGTCAT
    133NM_017080
    Sox9

    Fshr
    SRY-box transcription factor 9
    Follicle-stimulating hormone receptor
    Forward
    Reverse
    Forward
    Reverse
    GCAGCGTGGGGTTGTG
    TGGATGATTGGGATGGTCA
    CAAAAGTCCAGCCCAATACC
    AACCCCGACATAATCTTCA
    172

    327
    NM_138547

    NM_199237
    DhhDesert hedgehogForward
    Reverse
    AACCCCGACATAATCTTCA
    CTCGTCCCAACCTTCAGT
    150NM_053367
    Nr5a1Nuclear receptor subfamily 5 group A1Forward
    Reverse
    CAGAGCTGCAAAATCGACAA
    CCCGAATCTGTGCTTTCTTC
    187NM_001191099
    Insl3
    Insulin-like 3Forward
    Reverse
    GTGGCTGGAGCAACGACA
    AGAAGCCTGGTGAGGAAGC
    102NM_053680
    Sod1

    Sod2

    Cat

    Gpx1

    BCL2

    Bax
    Superoxide dismutase 1

    Superoxide dismutase 2

    Catalase

    Glutathione peroxidase 1
    BCL2 apoptosis regulator
    BCL2 associated X apoptosis regulator
    Forward
    Reverse
    Forward
    Reverse
    Forward
    Reverse
    Forward
    Reverse
    Forward
    Reverse
    Forward
    Reverse
    GCCGTGTGCGTGCTGAAGG
    TGTAATCTGTCCTGACACCACAACTG
    TCCCTGACCTGCCTTACGACTATG
    TCGTGGTACTTCTCCTCGGTGAC
    AGCGGATTCCTGAGAGAGTGGTAC
    CTGTGGAGAATCGGACGGCAATAG
    TGCAATCAGTTCGGACATCAGGAG
    CTCACCATTCACCTCGCACTTCTC
    AGCGTCAACAGGGAGATGTC
    TATGCACCCAGAGTGATGCA
    GACGCATCCACCAAGAAGCTGAG
    GCTGCCACACGGAAGAAGACC
    99

    130

    147

    129

    204

    134
    NM_017050.1

    NM_017051.2

    NM_012520.2

    NM_030826.4

    NM_016993

    NM_017059
    LhbLuteinizing hormone subunit betaForward
    Reverse
    CTGCTGCTGAGCCCAAGTGT TGCTGGTGGTGAAGGTGATG400NM_012858
    FshbFollicle stimulating hormone subunit betaForward
    Reverse
    CATTCACCCACCCTTGTCTT
    GCTCCTCCTCACTACCTGTC
    326NM_001007597.2
    GnrhrGonadotropin releasing hormone receptorForward
    Reverse
    CTTGAAGCCCGTCCTTGG
    GCGATCCAGGCTAATCAC
    440NM_031038
    Rps16

    Gapdh
    Ribosomal protein S16

    Glyceraldehyde-3-phosphate dehydrogenase
    Forward
    Reverse
    Forward
    Reverse
    AAGTCTTCGGACGCAAGAAA
    TTGCCCAGAAGCAGAACAG
    GTCCATGCCATCACTGCCACTC
    GATGACCTTGCCCACAGCCTTG
    148

    132
    NM_001169146

    NM_017008.4
    下载: 导出CSV

    S2.   Antibody information

    AntibodySpeciesVendor (City, State)Dilution
    WBHS
    GAPDHMouseCell Signaling Technology (Danvers, MA)1:1,000ND
    CYP11A1RabbitCell Signaling Technology (Danvers, MA)1:1,0001:200
    HSD11B1RabbitAbcam (San Francisco, CA)1:1,0001:200
    INSL3RabbitAbcam (San Francisco, CA)1:1,000ND
    DHHMouseSanta Cruz Biotechnology (Dallas, TX)1:100ND
    pmTORrabbitCell Signaling Technology (Danvers, MA)1:1,000ND
    mTORrabbitCell Signaling Technology (Danvers, MA)1:1,000ND
    ERK1/2mouseCell Signaling Technology (Danvers, MA)1:1,000ND
    pERK1/2mouseCell Signaling Technology (Danvers, MA)1:5,000ND
    AKT1RabbitCell Signaling Technology (Danvers, MA)1:2,000ND
    pAKT1RabbitCell Signaling Technology (Danvers, MA)1:5,000ND
    AKT2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
    pAKT2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
    BAXRabbitAbcam (San Francisco, CA)1:1,000ND
    BCL2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
    SOD1RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
    SOD2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
    PGC1αRabbitAbcam (San Francisco, CA)1:1,000ND
    SIRT1RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      Note. ND = Not detected; WB = Western blot; HS = Histochemical staining.
    下载: 导出CSV

    Table  1.   General parameters of toxicity after treatment of BBOP in puberty

    ParametersBBOP [mg/(kg·day)]
    010100250500
    Number66666
    mortality (%)00000
    BW (g) before213.3 ± 9.3218.3 ± 8.2211.8 ± 11.8204.3 ± 8.0218.0 ± 4.8
    BW (g) after316.8 ± 20.2321.7 ± 24.4335.0 ± 14.4317.5 ± 14.2304.3 ± 18.3
    Testis weight (g)1.55 ± 0.081.45 ± 0.111.53 ± 0.101.53 ± 0.101.47 ± 0.09
    Relative testis weight (g)1.54 ± 0.071.42 ± 0.141.543 ± 0.101.543 ± 0.101.479 ± 0.07
    Both epididymis weight (g)0.81 ± 0.070.73 ± 0.040.76 ± 0.050.72 ± 0.05*0.70 ± 0.03**
      Note. BW = body weight. Values are mean ± SEM, n = 6. *, **Indicate significant difference when compared to the control [0 mg/(kg·day) BBOP] at P < 0.05 and 0.01, respectively.
    下载: 导出CSV
  • [1] Radke EG, Braun JM, Meeker JD, et al. Phthalate exposure and male reproductive outcomes: a systematic review of the human epidemiological evidence. Environ Int, 2018; 121, 764−93. doi:  10.1016/j.envint.2018.07.029
    [2] Dutta S, Haggerty DK, Rappolee DA, et al. Phthalate exposure and long-term epigenomic consequences: a review. Front Genet, 2020; 11, 405. doi:  10.3389/fgene.2020.00405
    [3] Zhang WZ, Zheng XW, Gu P, et al. Distribution and risk assessment of phthalates in water and sediment of the Pearl River Delta. Environ Sci Pollut Res Int, 2020; 27, 12550−65. doi:  10.1007/s11356-019-06819-y
    [4] Zhou B, Zhao LX, Wang YB, et al. Spatial distribution of phthalate esters and the associated response of enzyme activities and microbial community composition in typical plastic-shed vegetable soils in China. Ecotoxicol Environ Saf, 2020; 195, 110495. doi:  10.1016/j.ecoenv.2020.110495
    [5] Liu H, Liang HC, Liang Y, et al. Distribution of phthalate esters in alluvial sediment: a case study at JiangHan Plain, Central China. Chemosphere, 2010; 78, 382−8. doi:  10.1016/j.chemosphere.2009.11.009
    [6] Koch HM, Lorber M, Christensen KLY, et al. Identifying sources of phthalate exposure with human biomonitoring: results of a 48 h fasting study with urine collection and personal activity patterns. Int J Hyg Environ Health, 2013; 216, 672−81. doi:  10.1016/j.ijheh.2012.12.002
    [7] Li XH, Mo JY, Zhu QQ, et al. The structure-activity relationship (SAR) for phthalate-mediated developmental and reproductive toxicity in males. Chemosphere, 2019; 223, 504−13. doi:  10.1016/j.chemosphere.2019.02.090
    [8] Liu MQ, Chen HQ, Dai HP, et al. Effects of bis(2-butoxyethyl) phthalate exposure in utero on the development of fetal Leydig cells in rats. Toxicol Lett, 2021; 351, 65−77. doi:  10.1016/j.toxlet.2021.08.008
    [9] Ge RS, Hardy MP. Variation in the end products of androgen biosynthesis and metabolism during postnatal differentiation of rat Leydig cells. Endocrinology, 1998; 139, 3787−95. doi:  10.1210/endo.139.9.6183
    [10] Ye LP, Li XH, Li LX, et al. Insights into the Development of the adult Leydig cell lineage from stem leydig cells. Front Physiol, 2017; 8, 430. doi:  10.3389/fphys.2017.00430
    [11] Batista-Silva H, Dambrós BF, Rodrigues K, et al. Acute exposure to bis(2-ethylhexyl)phthalate disrupts calcium homeostasis, energy metabolism and induces oxidative stress in the testis of Danio rerio. Biochimie, 2020; 175, 23−33. doi:  10.1016/j.biochi.2020.05.002
    [12] Nelli G, Pamanji SR. Di-n-butyl phthalate prompts interruption of spermatogenesis, steroidogenesis, and fertility associated with increased testicular oxidative stress in adult male rats. Environ Sci Pollut Res Int, 2017; 24, 18563−74. doi:  10.1007/s11356-017-9478-3
    [13] Zhou DX, Wang HX, Zhang J, et al. Di-n-butyl phthalate (DBP) exposure induces oxidative damage in testes of adult rats. Syst Biol Reprod Med, 2010; 56, 413−9. doi:  10.3109/19396368.2010.509902
    [14] Colón E, Zaman F, Axelson M, et al. Insulin-like growth factor-I is an important antiapoptotic factor for rat leydig cells during postnatal development. Endocrinology, 2007; 148, 128−39. doi:  10.1210/en.2006-0835
    [15] Martinot E, Boerboom D. Slit/robo signaling regulates Leydig cell steroidogenesis. Cell Commun Signaling, 2021; 19, 8. doi:  10.1186/s12964-020-00696-6
    [16] Matzkin ME, Yamashita S, Ascoli M. The ERK1/2 pathway regulates testosterone synthesis by coordinately regulating the expression of steroidogenic genes in Leydig cells. Mol Cell Endocrinol, 2013; 370, 130−7. doi:  10.1016/j.mce.2013.02.017
    [17] Yu YG, Li ZQ, Ma FF, et al. Neurotrophin-3 stimulates stem Leydig cell proliferation during regeneration in rats. J Cell Mol Med, 2020; 24, 13679−89. doi:  10.1111/jcmm.15886
    [18] Zhang S, Chen XX, Li XH, et al. Effects of in utero exposure to diisodecyl phthalate on fetal testicular cells in rats. Toxicol Lett, 2020; 330, 23−9. doi:  10.1016/j.toxlet.2020.04.024
    [19] Chen HQ, Xin X, Liu MQ, et al. In utero exposure to dipentyl phthalate disrupts fetal and adult Leydig cell development. Toxicol Appl Pharmacol, 2021; 419, 115514. doi:  10.1016/j.taap.2021.115514
    [20] Guo JJ, Zhou HY, Su ZJ, et al. Comparison of cell types in the rat Leydig cell lineage after ethane dimethanesulfonate treatment. Reproduction, 2013; 145, 371−80. doi:  10.1530/REP-12-0465
    [21] Vaillant S, Magre S, Dorizzi M, et al. Expression of AMH, SF1, and SOX9 in gonads of genetic female chickens during sex reversal induced by an aromatase inhibitor. Dev Dyn, 2001; 222, 228−37. doi:  10.1002/dvdy.1190
    [22] Akingbemi BT, Ge RS, Klinefelter GR, et al. Phthalate-induced Leydig cell hyperplasia is associated with multiple endocrine disturbances. Proc Natl Acad Sci USA, 2004; 101, 775−80. doi:  10.1073/pnas.0305977101
    [23] Shan LX, Phillips DM, Bardin CW, et al. Differential regulation of steroidogenic enzymes during differentiation optimizes testosterone production by adult rat Leydig cells. Endocrinology, 1993; 133, 2277−83. doi:  10.1210/endo.133.5.8404681
    [24] Li HT, Wen ZN, Ni CB, et al. Perfluorododecanoic acid delays Leydig cell regeneration from stem cells in adult rats. Food Chem Toxicol, 2021; 151, 112152. doi:  10.1016/j.fct.2021.112152
    [25] Hu GX, Li JW, Shan YY, et al. In utero combined di-(2-ethylhexyl) phthalate and diethyl phthalate exposure cumulatively impairs rat fetal Leydig cell development. Toxicology, 2018; 395, 23−33. doi:  10.1016/j.tox.2018.01.002
    [26] Chen XW, Dong YY, Tian EP, et al. 4-Bromodiphenyl ether delays pubertal Leydig cell development in rats. Chemosphere, 2018; 211, 986−97. doi:  10.1016/j.chemosphere.2018.08.008
    [27] Di GQ, Xiang JL, Dong L, et al. Testosterone synthesis in testicular Leydig cells after long-term exposure to a static electric field (SEF). Toxicology, 2021; 458, 152836. doi:  10.1016/j.tox.2021.152836
    [28] Payne AH, Downing JR, Wong KL. Luteinizing hormone receptors and testosterone synthesis in two distinct populations of Ley dig cells. Endocrinology, 1980; 106, 1424−9. doi:  10.1210/endo-106-5-1424
    [29] Wang YY, Dong YY, Wu SW, et al. Acephate interferes with androgen synthesis in rat immature Leydig cells. Chemosphere, 2020; 245, 125597. doi:  10.1016/j.chemosphere.2019.125597
    [30] Koopman P. Sry and Sox9: mammalian testis-determining genes. Cell Mol Life Sci, 1999; 55, 839−56.
    [31] Orth JM. Proliferation of Sertoli cells in fetal and postnatal rats: a quantitative autoradiographic study. Anat Rec, 1982; 203, 485−92. doi:  10.1002/ar.1092030408
    [32] Ge RS, Dong Q, Sottas CM, et al. Gene expression in rat leydig cells during development from the progenitor to adult stage: a cluster analysis. Biol Reprod, 2005; 72, 1405−15. doi:  10.1095/biolreprod.104.037499
    [33] Bao AM, Man XM, Guo XJ, et al. Effects of di-n-butyl phthalate on male rat reproduction following pubertal exposure. Asian J Androl, 2011; 13, 702−9. doi:  10.1038/aja.2011.76
    [34] Janjic MM, Stojilkovic SS, Bjelobaba I. Intrinsic and regulated gonadotropin-releasing hormone receptor gene transcription in mammalian pituitary gonadotrophs. Front Endocrinol (Lausanne), 2017; 8, 221. doi:  10.3389/fendo.2017.00221
    [35] Li XH, Tian EP, Wang YY, et al. Stem Leydig cells: current research and future prospects of regenerative medicine of male reproductive health. Semin Cell Dev Biol, 2022; 121, 63−70. doi:  10.1016/j.semcdb.2021.05.007
    [36] Clark AM, Garland KK, Russell LD. Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biol Reprod, 2000; 63, 1825−38. doi:  10.1095/biolreprod63.6.1825
    [37] Zhao Y, Ao H, Chen L, et al. Mono-(2-ethylhexyl) phthalate affects the steroidogenesis in rat Leydig cells through provoking ROS perturbation. Toxicol in Vitro, 2012; 26, 950−5. doi:  10.1016/j.tiv.2012.04.003
    [38] Zhou L, Beattie MC, Lin CY, et al. Oxidative stress and phthalate-induced down-regulation of steroidogenesis in MA-10 Leydig cells. Reprod Toxicol, 2013; 42, 95−101. doi:  10.1016/j.reprotox.2013.07.025
    [39] Sedha S, Kumar S, Shukla S. Role of oxidative stress in male reproductive dysfunctions with reference to phthalate compounds. Urol J, 2015; 12, 2304−16.
    [40] Zirkin BR, Papadopoulos V. Leydig cells: formation, function, and regulation. Biol Reprod, 2018; 99, 101−11. doi:  10.1093/biolre/ioy059
    [41] Chung JY, Chen HL, Zirkin B. Sirt1 and Nrf2: regulation of Leydig cell oxidant/antioxidant intracellular environment and steroid formation. Biol Reprod, 2021; 105, 1307−16. doi:  10.1093/biolre/ioab150
    [42] Lv Y, Li LL, Fang YH, et al. In utero exposure to bisphenol A disrupts fetal testis development in rats. Environ Pollut, 2019; 246, 217−24. doi:  10.1016/j.envpol.2018.12.006
    [43] Spitz AZ, Gavathiotis E. Physiological and pharmacological modulation of BAX. Trends Pharmacol Sci, 2022; 43, 206−20. doi:  10.1016/j.tips.2021.11.001
    [44] Dummler B, Tschopp O, Hynx D, et al. Life with a single isoform of Akt: mice lacking Akt2 and Akt3 are viable but display impaired glucose homeostasis and growth deficiencies. Mol Cell Biol, 2006; 26, 8042−51. doi:  10.1128/MCB.00722-06
    [45] Chen WS, Xu PZ, Gottlob K, et al. Growth retardation and increased apoptosis in mice with homozygous disruption of the akt1 gene. Genes Dev, 2001; 15, 2203−8. doi:  10.1101/gad.913901
    [46] Chen FL, Wang YJ, Liu QG, et al. ERO1α promotes testosterone secretion in hCG-stimulated mouse Leydig cells via activation of the PI3K/AKT/mTOR signaling pathway. J Cell Physiol, 2020; 235, 5666−78. doi:  10.1002/jcp.29498
    [47] Schmeisser K, Parker JA. Pleiotropic effects of mTOR and autophagy during development and aging. Front Cell Dev Biol, 2019; 7, 192. doi:  10.3389/fcell.2019.00192
    [48] Kim YC, Guan KL. mTOR: a pharmacologic target for autophagy regulation. J Clin Invest, 2015; 125, 25−32. doi:  10.1172/JCI73939
    [49] Chen YB, Wang J, Xu DH, et al. m6A mRNA methylation regulates testosterone synthesis through modulating autophagy in Leydig cells. Autophagy, 2021; 17, 457−75. doi:  10.1080/15548627.2020.1720431
    [50] Gao FY, Li GP, Liu C, et al. Autophagy regulates testosterone synthesis by facilitating cholesterol uptake in Leydig cells. J Cell Biol, 2018; 217, 2103−19. doi:  10.1083/jcb.201710078
    [51] Yan HN, Li CC, Zou C, et al. Perfluoroundecanoic acid inhibits Leydig cell development in pubertal male rats via inducing oxidative stress and autophagy. Toxicol Appl Pharmacol, 2021; 415, 115440. doi:  10.1016/j.taap.2021.115440
    [52] Yang HQ, Wang H, Liu YB, et al. The PI3K/Akt/mTOR signaling pathway plays a role in regulating aconitine-induced autophagy in mouse liver. Res Vet Sci, 2019; 124, 317−20. doi:  10.1016/j.rvsc.2019.04.016
    [53] Valenzuela-Leon P, Dobrinski I. Exposure to phthalate esters induces an autophagic response in male germ cells. Environ Epigenet, 2017; 3, dvx010.
    [54] Zhou XL, Zhang ZG, Shi H, et al. Effects of Lycium barbarum glycopeptide on renal and testicular injury induced by di(2-ethylhexyl) phthalate. Cell Stress Chaperones, 2022; 27, 257−71. doi:  10.1007/s12192-022-01266-0
    [55] Zhu XY, Hu ME, Ji HS, et al. Exposure to di-n-octyl phthalate during puberty induces hypergonadotropic hypogonadism caused by Leydig cell hyperplasia but reduced steroidogenic function in male rats. Ecotoxicol Environ Saf, 2021; 208, 111432. doi:  10.1016/j.ecoenv.2020.111432
    [56] Wang YY, Ge F, Li XH, et al. Propofol inhibits androgen production in rat immature leydig cells. Front Pharmacol, 2019; 10, 760. doi:  10.3389/fphar.2019.00760
    [57] Souder DC, Anderson RM. An expanding GSK3 network: implications for aging research. Geroscience, 2019; 41, 369−82. doi:  10.1007/s11357-019-00085-z
    [58] Beurel E, Grieco SF, Jope RS. Glycogen synthase kinase-3 (GSK3): regulation, actions, and diseases. Pharmacol Ther, 2015; 148, 114−31. doi:  10.1016/j.pharmthera.2014.11.016
    [59] Yuan KM, Zhao BH, Li XW, et al. Effects of phthalates on 3β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase 3 activities in human and rat testes. Chem Biol Interact, 2012; 195, 180−8. doi:  10.1016/j.cbi.2011.12.008
    [60] Zhang XF, Qu NQ, Zheng J, et al. Di (n-butyl) phthalate inhibits testosterone synthesis through a glucocorticoid-mediated pathway in rats. Int J Toxicol, 2009; 28, 448−56. doi:  10.1177/1091581809342596
    [61] van den Driesche S, Walker M, McKinnell C, et al. Proposed role for COUP-TFII in regulating fetal Leydig cell steroidogenesis, perturbation of which leads to masculinization disorders in rodents. PLoS One, 2012; 7, e37064. doi:  10.1371/journal.pone.0037064
    [62] Tomonari V, Kurata Y, David RM, et al. Effect of di(2-ethylhexyl) phthalate (DEHP) on genital organs from juvenile common marmosets: I. Morphological and biochemical investigation in 65-week toxicity study. J Toxicol Environ Health A, 2006; 69, 1651−72. doi:  10.1080/15287390600630054
    [63] Kessler W, Numtip W, Grote K, et al. Blood burden of di(2-ethylhexyl) phthalate and its primary metabolite mono(2-ethylhexyl) phthalate in pregnant and nonpregnant rats and marmosets. Toxicol Appl Pharmacol, 2004; 195, 142−53. doi:  10.1016/j.taap.2003.11.014
    [64] Kessler W, Numtip W, Völkel W, et al. Kinetics of di(2-ethylhexyl) phthalate (DEHP) and mono(2-ethylhexyl) phthalate in blood and of DEHP metabolites in urine of male volunteers after single ingestion of ring-deuterated DEHP. Toxicol Appl Pharmacol, 2012; 264, 284−91. doi:  10.1016/j.taap.2012.08.009
    [65] Hauser R, Meeker JD, Duty S, et al. Altered semen quality in relation to urinary concentrations of phthalate monoester and oxidative metabolites. Epidemiology, 2006; 17, 682−91. doi:  10.1097/01.ede.0000235996.89953.d7
    [66] Wang YX, Zeng Q, Sun Y, et al. Phthalate exposure in association with serum hormone levels, sperm DNA damage and spermatozoa apoptosis: a cross-sectional study in China. Environ Res, 2016; 150, 557−65. doi:  10.1016/j.envres.2015.11.023
    [67] Xu TY, Hu JB, Gao HS, et al. Determination and analysis of 16 kinds of phthalates concentration in semen from infertile men. Chin J Clin Lab Sci, 2013; 31, 51−3. (In Chinese
    [68] Lin H, Ge RS, Chen GR, et al. Involvement of testicular growth factors in fetal Leydig cell aggregation after exposure to phthalate in utero. Proc Natl Acad Sci USA, 2008; 105, 7218−22. doi:  10.1073/pnas.0709260105
    [69] Harley KG, Berger KP, Kogut K, et al. Association of phthalates, parabens and phenols found in personal care products with pubertal timing in girls and boys. Hum Reprod, 2019; 34, 109−17. doi:  10.1093/humrep/dey337
    [70] Liu T, Wang YZ, Yang MD, et al. Di-(2-ethylhexyl) phthalate induces precocious puberty in adolescent female rats. Iran J Basic Med Sci, 2018; 21, 848−55.
  • [1] ZUO Hao Xiao, LI Jin Quan, HAN Bing, KE Chen Juan, LIU Xu Dong, ZHANG Yu Chao, LI Li, YANG Xu.  Di-(n-butyl)-phthalate-induced Oxidative Stress and Depression-like Behavior in Mice with or without Ovalbumin Immunization . Biomedical and Environmental Sciences, 2014, 27(4): 268-280. doi: 10.3967/bes2014.001
    [2] LIU Qing, GU Jian Hong, YUAN Yan, LIU Xue Zhong, WANG Ya Jun, WANG Han Dong, LIU Zong Ping.  Effect of Cadmium on Rat Leydig Cell Testosterone Production and DNA Integrity in vitro . Biomedical and Environmental Sciences, 2013, 26(9): 769-773. doi: 10.3967/0895-3988.2013.09.009
    [3] YUAN Yan, BIAN Jian Chun, LIU Xue Zhong, ZHANG Ying, SUN Ya, LIU Zong Ping.  Oxidative Stress and Apoptotic Changes of Rat Cerebral Cortical NeuronsExposed to Cadmium in Vitro . Biomedical and Environmental Sciences, 2012, 25(2): 172-181. doi: 10.3967/0895-3988.2012.02.008
    [4] LI ShuGuang, DAI JiCan, ZHANG LiQian, ZHANG Jing, ZHANG ZiQiang, CHEN Bo.  An Association of Elevated Serum Prolactin with Phthalate Exposure in Adult Men . Biomedical and Environmental Sciences, 2011, 24(1): 31-39. doi: 10.3967/0895-3988.2011.01.004
    [5] CHEN Bo, LIU Ying, SONG Wei Ming, HAYASHI Yasuhiko, DING Xun Cheng, LI Wei Hua.  In Vitro Evaluation of Cytotoxicity and Oxidative Stress Induced by Multiwalled Carbon Nanotubes in Murine RAW 264.7 Macrophages and Human A549 Lung Cells . Biomedical and Environmental Sciences, 2011, 24(6): 593-601. doi: 10.3967/0895-3988.2011.06.002
    [6] DONG CHANG, FAN WANG, YA-SHUANG ZHAO, HONG-ZHI PAN.  Evaluation of Oxidative Stress in Colorectal Cancer Patients . Biomedical and Environmental Sciences, 2008, 21(4): 286-289.
    [7] RI-AN YU, TAO XIA, AI-GUO WANG, XUE-MIN CHEN.  Effects of Selenium and Zinc on Renal Oxidative Stress and Apoptosis Induced by Fluoride in Rats . Biomedical and Environmental Sciences, 2006, 19(6): 439-444.
    [8] YOU-GEN ZHU, SHU-MEI ZHANG, JI-YUE WANG, WEI-QIANG XIAO, XIN-YU WANG, JUN-FU ZHOU.  Overweight and Obesity-Induced Oxidative Stress in Children . Biomedical and Environmental Sciences, 2006, 19(5): 353-359.
    [9] JIAN-GUO LOU, JIE DONG, YI-CHUN ZHENG, SHU-MEI ZHANG, WEI-QIANG XIAO, JUN-FU ZHOU.  Increased Oxidative Stress and Damage in Patients With Chronic Bacterial Prostatitis . Biomedical and Environmental Sciences, 2006, 19(6): 481-486.
    [10] JUN-FU ZHOU, XIN-YU WANG, XUE-JUN SHANGGUAN, ZU-MING GAO, SHU-MEI ZHANG, WEI-QIANG XIAO, CHANG-GUI CHEN.  Increased Oxidative Stress in Women With Pregnancy-induced Hypertension . Biomedical and Environmental Sciences, 2005, 18(6): 419-426.
    [11] JUN-FU ZHOU, WEN ZHOU, SHU-MEI ZHANG, YAN-ER LUO, Huai-Hong Chen.  Oxidative Stress and Free Radical Damage in Patients With Acute Dipterex Poisoning . Biomedical and Environmental Sciences, 2004, 17(2): 223-233.
    [12] YOU-GEN ZHU, JUN-FU ZHOU, WEI-YING SHAN, PEI-SU ZHOU, GUI-ZHONG TONG.  Potential Oxidative Stress in the Bodies of Electric Arc Welding Operators:Effect of Photochemical Smog . Biomedical and Environmental Sciences, 2004, 17(4): 381-389.
    [13] P.DIPTI, B.YOGESH, A.K.KAIN, T.PAULINE, B.ANJU, M.SAIRAM, B.Singh, S.S.MONGIA, G.ILAVAZHAGAN DEVENDRA KUMAR, W.SELVAMURTHY.  Lead Induced Oxidative Stress: Beneficial Effects of Kombucha Tea . Biomedical and Environmental Sciences, 2003, 16(3): 276-282.
    [14] JUN-FU ZHOU, YE-HUA ZHOU, Liang Zhang, Huai-Hong Chen, DONG CAI.  3,4-Methylenedioxymethamphetamine (MDMA) Abuse Markedly Inhibits Acetylcholinesterase Activity and Induces Severe Oxidative Damage and Liperoxidative Damage . Biomedical and Environmental Sciences, 2003, 16(1): 53-61.
    [15] JUN-FU ZHOU, WEI-WEI CHEN, GUI-ZHONG TONG.  Ozone Emitted During Copying Process -A Potential Cause of Pathological Oxidative Stress and Potential Oxidative Damage in the Bodies of Operators . Biomedical and Environmental Sciences, 2003, 16(2): 95-104.
    [16] ZHOU JUN-FU, CHEN Jia-xi, SHEN Han-chao, CAI DONG.  Abnormal Reactions of Free Radicals and Oxidative Damages in the Bodies of Patients With Chronic Glomerulonephritis . Biomedical and Environmental Sciences, 2002, 15(3): 233-244.
    [17] XIE Bo, ZHOU JUN-FU, LU Qun, LI Chong-jian, CHEN PENG.  Oxidative Stress in Patients With Acute Coxsackie Virus Myocarditis . Biomedical and Environmental Sciences, 2002, 15(1): 48-57.
    [18] ZHOU JUN-FU, CHEN PENG.  Studies on the Oxidative Stress in Alcohol Abusers in China . Biomedical and Environmental Sciences, 2001, 14(3): 180-188.
    [19] ZHOU JUN-FU, CHEN PENG, YANG JIN-LU, ZHU YOU-GEN, PENG Cheng-hong, WU Yu-lian.  Oxidative Stress before and after Operation in Patients with Chronic Cholecystitis Containing Gallstone . Biomedical and Environmental Sciences, 2000, 13(4): 254-262.
    [20] WU XIANG-DONG, YANG JIAN-MING, WU XIAO-YUN, DING XUN-CHENG, PANG BING, JIANG XUE-ZHI, JI ZAI-SI, SHIN KAZUO.  The effects of 2-Bromopropane on Viability and Testosterone Production Ability of Rat Leydig Cells in Primary Culture . Biomedical and Environmental Sciences, 1999, 12(1): 43-49.
  • 22068Supplementary Materials.pdf
  • 加载中
图(12) / 表ll (3)
计量
  • 文章访问数:  1154
  • HTML全文浏览量:  479
  • PDF下载量:  96
  • 被引次数: 0
出版历程
  • 收稿日期:  2022-02-26
  • 录用日期:  2022-08-04
  • 刊出日期:  2023-01-20

Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats

doi: 10.3967/bes2023.006
    基金项目:  This work was supported by the National Natural Science Fund of China [no. 81730042]
    作者简介:

    LIU Miao Qing, male, born in 1984, Postgraduate, majoring in lediatric surgery

    CHEN Hai Qiong, female, born in 1994, Postgraduate, majoring in pediatric surgery

    通讯作者: LI Zhong Rong, E-mail: wmclzr@163.comGE Ren Shan, E-mail: r_ge@yahoo.com
注释:
1) AUTHOR CONTRIBUTIONS: 2) AUTHOR CONTRIBUTIONS:

English Abstract

LIU Miao Qing, CHEN Hai Qiong, DAI Hai Peng, LI Jing Jing, TIAN Fu Hong, WANG Yi Yan, CHEN Cong De, LI Xiao Heng, LI Jun Wei, LI Zhong Rong, GE Ren Shan. Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats[J]. Biomedical and Environmental Sciences, 2023, 36(1): 60-75. doi: 10.3967/bes2023.006
Citation: LIU Miao Qing, CHEN Hai Qiong, DAI Hai Peng, LI Jing Jing, TIAN Fu Hong, WANG Yi Yan, CHEN Cong De, LI Xiao Heng, LI Jun Wei, LI Zhong Rong, GE Ren Shan. Bis (2-butoxyethyl) Phthalate Delays Puberty Onset by Increasing Oxidative Stress and Apoptosis in Leydig Cells in Rats[J]. Biomedical and Environmental Sciences, 2023, 36(1): 60-75. doi: 10.3967/bes2023.006
    • In recent years, the incidence of tumors of the human reproductive system, endocrine disorders in puberty, and reproductive tract malformations in neonates has increased and received substantial attention. These phenomena may be associated with environmental pollution. Phthalates, a family of environmental pollutants, contain a group of ethers formed by the condensation of benzene-1,2-dicarboxylic acid and alcohols of different alkyl chain lengths. They are widely used as plasticizers in polyvinyl chloride plastics, additives in some medical devices, and deodorants in various personal care products[1, 2].

      Phthalates usually contain one or two alkyl chains in the alcohol moiety, including bis (2-ethylhexyl) phthalate (DEHP), diisononyl phthalate, and di-n-butyl phthalate (DBP). However, bis (2-butoxyethyl) phthalate (BBOP) is a unique phthalate because it is esterified with 2-butoxyethanol, a glycol ether. The phthalate interacts with polymers in a non-covalent manner and eventually enters the environment. BBOP has been detected in water systems[3] and soil sediments[3-5]. Humans are exposed to phthalates through their entire life cycle, including pregnancy, puberty, and adulthood. Phthalates eventually enter the human body[2]. The main route of human exposure to phthalates is orally through food, whereas dermal contact and inhalation contribute only marginally[6].

      Some phthalates have been found to be endocrine-disrupting chemicals, and the male reproductive endocrine system is a sensitive target of some phthalates (see review[7]). Phthalates include low molecular weight phthalates with C3-C6 carbon length alcohols esterified in the ortho-phthalate, such as di-(n-propyl)-phthalate to DEHP, and high molecular weight phthalates, which have longer carbon lengths[7]. Increasing evidence indicates that many phthalates, including DEHP, DBP, and BBOP, perturb Leydig cell function in male fetuses and adults[7,8]. However, whether BBOP affects puberty onset by affecting the development of Leydig cells in male rats remains unclear.

      In puberty in male rats, Leydig cells rapidly mature from postnatal day (PND) 35 to 56[9]. In that time period, a group of immature Leydig cells mature into adult Leydig cells with full testosterone biosynthetic capacity[9]. The development of Leydig cells requires the regulation of luteinizing hormone (LH) secreted by the pituitary gland, which also secretes follicle-stimulating hormone (FSH), a regulator of Sertoli cell function that indirectly controls the development of Leydig cells[10]. Testosterone biosynthesis is actively regulated by LH. After LH binds the cell surface luteinizing hormone/choriogonadotropin receptor (LHCGR), cyclic adenosine monophosphate, a common second messenger, is induced to initiate a series of signaling cascades. This signaling ultimately increases cholesterol uptake through scavenging receptor class B member 1 (SCARB1) endocytosis; intracellular transport of cholesterol through the regulation of steroidogenic acute regulatory protein (STAR); and a series of steroidogenic enzymes, such as cholesterol side chain cleavage (CYP11A1), 3β-hydroxysteroid dehydrogenase 1 (HSD3B1), 17α-hydroxylase/17,20-lyase (CYP17A1), and 17β-hydroxysteroid dehydrogenase 3 (HSD17B3)[10]. Adult Leydig cells also express mature biomarkers, such as insulin-like 3 (INSL3) and 11β-hydroxysteroid dehydrogenase 1 (HSD11B1)[10].

      Under normal circumstances, the oxidative and antioxidant systems of the testis maintain a dynamic balance. These antioxidant enzymes, mainly superoxide dismutase 1 and 2 (SOD1 and SOD2), glutathione peroxidase 1 (GPX1), and catalase, have been found to be reduced, and reactive oxygen species (ROS) are generated after phthalate exposure[11-13]. The onset of male puberty relies on the pubertal development of Leydig cells, in a process involving a variety of signaling cascades, such as the AKT, ERK1/2, GSK3β, mTOR, and SIRT1 pathways[14-17]. This study focused on the effect of BBOP on puberty onset by investigating the pubertal development of Leydig cells according to various parameters, including hormonal changes, Leydig cell numbers, steroidogenesis-associated gene and protein expression, ROS generation, and alterations in several signaling pathways.

    • BBOP (CAS registry number 117-83-9) was purchased from Fusheng Industrial Co. (Shanghai, China). An Immulite 2000 total testosterone kit was obtained from Sinopharm (Hangzhou, China). TRIzol reagent was obtained from Invitrogen (Carlsbad, CA). A reverse transcription kit and SYBR green real-time polymerase chain reaction (qPCR) kit were purchased from Takara (Otsu, Japan). A BCA protein assay kit was purchased from Beyotime (Shanghai, China). Primer information for qPCR detection is shown in Supplementary Table S1 (available in www.besjournal.com) and antibody information for immunohistochemistry and western blotting is shown in Supplementary Table S2 (available in www.besjournal.com).

      Table S1.  qPCR primer information

      SymbolGene namePrimerSequences (5’to 3’)bpAccession No.
      LhcgrLuteinizing hormone receptorForward
      Reverse
      CTGCGCTGTCCTGGCC
      CGACCTCATTAAGTCCCCTGAA
      102NM_012978
      StarSteroidogenic acute regulatory proteinForward
      Reverse
      CCCAAATGTCAAGGAAATCA
      AGGCATCTCCCCAAAGTG
      187NM_031558
      Scarb1Scavenger receptor class B member 1Forward
      Reverse
      ATGGTACTGCCGGGCAGAT
      CGAACACCCTTGATTCCTGGTA
      117NM_031541
      Cyp11a1Cholesterol side chain cleavageForward
      Reverse
      AAGTATCCGTGATGTGGG
      TCATACAGTGTCGCCTTTTCT
      127NM_017286
      Cyp17a117α-Hydroxylase/17,20-lyaseForward
      Reverse
      TGGCTTTCCTGGTGCACAATC
      TGAAAGTTGGTGTTCGGCTGAAG
      90NM_012753
      Hsd3b13β-Hydroxysteroid dehydrogenase 1Forward
      Reverse
      CCCTGCTCTACTGGCTTGC
      TCTGCTTGGCTTCCTCCC
      189NM_001007719
      Hsd17b317β-Hydroxysteroid dehydrogenase 3Forward
      Reverse
      TGAAAGTTGGTGTTCGGCTGAAG
      TGAAAGTTGGTGTTCGGCTGAAG
      202NM_054007
      Hsd11b111β-Hydroxysteroid dehydrogenase 1Forward
      Reverse
      GAAGAAGCATGGAGGTCAAC
      GCAATCAGAGGTTGGGTCAT
      133NM_017080
      Sox9

      Fshr
      SRY-box transcription factor 9
      Follicle-stimulating hormone receptor
      Forward
      Reverse
      Forward
      Reverse
      GCAGCGTGGGGTTGTG
      TGGATGATTGGGATGGTCA
      CAAAAGTCCAGCCCAATACC
      AACCCCGACATAATCTTCA
      172

      327
      NM_138547

      NM_199237
      DhhDesert hedgehogForward
      Reverse
      AACCCCGACATAATCTTCA
      CTCGTCCCAACCTTCAGT
      150NM_053367
      Nr5a1Nuclear receptor subfamily 5 group A1Forward
      Reverse
      CAGAGCTGCAAAATCGACAA
      CCCGAATCTGTGCTTTCTTC
      187NM_001191099
      Insl3
      Insulin-like 3Forward
      Reverse
      GTGGCTGGAGCAACGACA
      AGAAGCCTGGTGAGGAAGC
      102NM_053680
      Sod1

      Sod2

      Cat

      Gpx1

      BCL2

      Bax
      Superoxide dismutase 1

      Superoxide dismutase 2

      Catalase

      Glutathione peroxidase 1
      BCL2 apoptosis regulator
      BCL2 associated X apoptosis regulator
      Forward
      Reverse
      Forward
      Reverse
      Forward
      Reverse
      Forward
      Reverse
      Forward
      Reverse
      Forward
      Reverse
      GCCGTGTGCGTGCTGAAGG
      TGTAATCTGTCCTGACACCACAACTG
      TCCCTGACCTGCCTTACGACTATG
      TCGTGGTACTTCTCCTCGGTGAC
      AGCGGATTCCTGAGAGAGTGGTAC
      CTGTGGAGAATCGGACGGCAATAG
      TGCAATCAGTTCGGACATCAGGAG
      CTCACCATTCACCTCGCACTTCTC
      AGCGTCAACAGGGAGATGTC
      TATGCACCCAGAGTGATGCA
      GACGCATCCACCAAGAAGCTGAG
      GCTGCCACACGGAAGAAGACC
      99

      130

      147

      129

      204

      134
      NM_017050.1

      NM_017051.2

      NM_012520.2

      NM_030826.4

      NM_016993

      NM_017059
      LhbLuteinizing hormone subunit betaForward
      Reverse
      CTGCTGCTGAGCCCAAGTGT TGCTGGTGGTGAAGGTGATG400NM_012858
      FshbFollicle stimulating hormone subunit betaForward
      Reverse
      CATTCACCCACCCTTGTCTT
      GCTCCTCCTCACTACCTGTC
      326NM_001007597.2
      GnrhrGonadotropin releasing hormone receptorForward
      Reverse
      CTTGAAGCCCGTCCTTGG
      GCGATCCAGGCTAATCAC
      440NM_031038
      Rps16

      Gapdh
      Ribosomal protein S16

      Glyceraldehyde-3-phosphate dehydrogenase
      Forward
      Reverse
      Forward
      Reverse
      AAGTCTTCGGACGCAAGAAA
      TTGCCCAGAAGCAGAACAG
      GTCCATGCCATCACTGCCACTC
      GATGACCTTGCCCACAGCCTTG
      148

      132
      NM_001169146

      NM_017008.4

      Table S2.  Antibody information

      AntibodySpeciesVendor (City, State)Dilution
      WBHS
      GAPDHMouseCell Signaling Technology (Danvers, MA)1:1,000ND
      CYP11A1RabbitCell Signaling Technology (Danvers, MA)1:1,0001:200
      HSD11B1RabbitAbcam (San Francisco, CA)1:1,0001:200
      INSL3RabbitAbcam (San Francisco, CA)1:1,000ND
      DHHMouseSanta Cruz Biotechnology (Dallas, TX)1:100ND
      pmTORrabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      mTORrabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      ERK1/2mouseCell Signaling Technology (Danvers, MA)1:1,000ND
      pERK1/2mouseCell Signaling Technology (Danvers, MA)1:5,000ND
      AKT1RabbitCell Signaling Technology (Danvers, MA)1:2,000ND
      pAKT1RabbitCell Signaling Technology (Danvers, MA)1:5,000ND
      AKT2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      pAKT2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      BAXRabbitAbcam (San Francisco, CA)1:1,000ND
      BCL2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      SOD1RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      SOD2RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
      PGC1αRabbitAbcam (San Francisco, CA)1:1,000ND
      SIRT1RabbitCell Signaling Technology (Danvers, MA)1:1,000ND
        Note. ND = Not detected; WB = Western blot; HS = Histochemical staining.
    • Male Sprague-Dawley rats [28 days of age (post weaning)] were from the Shanghai Laboratory Animal Center (Shanghai, China). All animal procedures were approved by the Ethics Committee of Animal Care and Use of Wenzhou Medical University (protocol number: wydw2014-0057). Rats were raised in clear polycarbonate cages under the following conditions: a 12-h dark/12-h light cycle, temperature range of 21–25 °C, and a humidity range of 45%–55%. After 7 days of acclimation, the rats were 35 days of age. Thirty rats were randomly assigned to five groups (with 6 animals per group) receiving BBOP at 0 (corn oil as control vehicle), 10, 100, 250, or 500 mg/kg bw per day. The dosage range was chosen on the basis of a previous study on the developmental/reproductive toxicity of BBOP, which induced abnormal changes in the morphology of fetal Leydig cells after in utero exposure through gavage for 8 days at doses as high as 500 mg/kg bw per day[8]. Different doses of BBOP were prepared by dissolving BBOP in corn oil and were administered at a rate of 2 mL/(kg·day). The administration duration (from PND 35 to 56) spanned the pubertal development of Leydig cells in rats[10]. Rats were weighed daily. At the end of administration, the rats were euthanized by CO2 asphyxiation. The testis and epididymis were harvested and weighed. Pituitary glands were collected. One testis, one epididymis, and the pituitary gland were stored at –80 °C. The other testis was immersed in Bouin’s fixative. Trunk blood was harvested for the collection of serum.

    • An Immulite 2000 total testosterone kit was used to measure serum testosterone concentrations at the Department of Medical Chemistry of our hospital, as previously documented[18].

    • Enzyme linked immunosorbent assay kits for rat LH or FSH were used to detect rat serum LH and FSH concentrations, as previously documented[19]. We prepared samples and standards in pre-coated anti-LH or anti-FSH antibody plates and added biotinylated anti-LH or anti-FSH solution, and then peroxidase-conjugated IgG solutions to the plates. After the detection substrate was added, the plates were read at 450 nm within 30 min. The lower detection limit of LH and FSH was 0.1 mIU/mL; the detection was within the linear range, and the co-variation in detection of LH and FSH was within 10%.

    • For equivalent detection of the pixel density of each antigen, the testis was prepared as a tissue array according to a previously described protocol[19]. The testis was cut into pieces and dehydrated in ethanol and xylene. The dehydrated pieces were embedded in paraffin, and 1.5 mm2 of testis tissue was randomly selected from each sample and assembled in a tissue array mold holding 30 samples (6 per group). The cross section (6 μm) was cut. Ten slides were randomly collected for immunohistochemistry analysis with an immunohistochemical kit (Vector Laboratories, Inc., Burlingame, CA) as previously described[19]. Each slide was boiled at 60 °C for 2 h, de-waxed, and rehydrated with xylene and alcohol. Peroxidase activity was blocked with 3% hydrogen peroxide. Antigens were repaired in citric acid, and the slides were blocked with 10% goat serum for 30 min. CYP11A1, which is expressed in all cells of the Leydig cell lineage[9]; HSD11B1, which is expressed in mature Leydig cells[20]; and SOX9, which is expressed in Sertoli cells[21], were selected as biomarkers for immunohistochemical staining. Anti-CYP11A1, anti-HSD11B1, and anti-SOX9 primary antibodies and subsequently conjugated secondary antibody were incubated with the slides at 4 °C. Diaminobenzidine was added for color development. The sections were counterstained with Mayer hematoxylin. The slides were scanned with a NanoZoomer-XR (Hamamatsu, Japan) at 0.23 μm per pixel to generate digital images.

    • The digital images were displayed in Image-Pro Plus software version 7 (Media Cybernetics, Silver Spring, MD). Cells with positive staining were picked, and Leydig cells and Sertoli cells were identified. The number of CYP11A1-positive Leydig cells, HSD11B1-positive Leydig cells, and SOX9-positive Sertoli cells was calculated through stereological techniques as previously described[22].

    • Leydig cell size increases with maturity[23]. The Leydig cell morphological metrics (cell size, nuclear size, and cytoplasmic area) were calculated as previously described [24]. Immunohistochemical staining for Leydig cells was performed. The digital images were displayed in Image-Pro Plus software. The peripheral contours of a Leydig cell and its nucleus were drawn, and the surface areas of the Leydig cell and its nucleus were exported into a Microsoft Excel spreadsheet by the software. The cytoplasmic size was calculated by subtraction of the nuclear area from the Leydig cell size. Fifty Leydig cells were randomly selected, and the mean value of each sample was calculated.

    • Total RNAs in testis and pituitary samples were prepared with a TRIzol extraction kit, as previously described[25]. The concentration of total RNA was determined by the optical density (OD) value at 260 nm with a NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, CA). The purity of total RNA was calculated according to the OD260/OD280 ratio. Total RNA was used to prepare cDNA templates through reverse transcription[25]. The expression of each gene was measured by qPCR as described previously[19]. The following genes were analyzed. Leydig cell genes: 1) a growth factor (Insl3), 2) receptors (Lhcgr and Scrab1), 3) a cholesterol transport regulator (Star), 4) androgen synthases (Cyp11a1, Hsd3b1, Cyp17a1, and Hsd17b3), 5) a glucocorticoid steroidogenic enzyme (Hsd11b1), and 6) a transcription factor (Nr5a1); Sertoli cell genes: 1) a growth factor (Dhh), 2) a receptor (Fshr), and 3) a transcription factor (Sox9); and antioxidant enzyme genes: Sod1, Sod2, Gpx1, and Cat; anti-apoptotic and pro-apoptotic genes: 1) an anti-apoptosis gene (Bcl2) and 2) a pro-apoptosis gene (Bax); pituitary genes: 1) hormones (Lhb and Fshb), and 2) a receptor (Gnrhr); and internal house-keeping genes: Rps16 and Gapdh. After qPCR, Ct values were exported into an Excel spreadsheet for standards and samples, and the expression levels of the target genes were determined according to the standard curve as previously described[25]. No statistical difference in Rps16 or Gapdh was observed between groups. The gene Rps16 was finally selected for normalization [19].

    • Western blotting was used for the detection of testicular proteins as previously described[19]. Briefly, tissue lysate was prepared, and protein was quantified with a BCA kit. An aliquot of protein (30 μg) from each sample was added to a 10%–12% PAGE gel, and electrophoresis was performed. The proteins were electrically transferred onto a nitrocellulose membrane. The membranes were subjected to western blotting to detect the following proteins: CYP11A1, HSD11B1, INSL3, DHH; mTOR, AKT1, AKT2, ERK1/2, GSK3β, phosphorylated mTOR (pmTOR), phosphorylated AKT1 (pAKT1), phosphorylated AKT2 (pAKT2), phosphorylated GSK3β (pGSK3β), phosphorylated ERK1/2 (pERK), SIRT1, and GAPDH (an internal control). Enhanced chemiluminescence was detected with an enhanced chemiluminescence kit (Amersham, Arlington Heights, IL). The protein density was quantified in Image-Lab (Bio-Rad), and GAPDH was used for normalization.

    • Semi-quantitative immunohistochemical measurement of protein density was performed as previously described[26]. In brief, the digital images were displayed in Image-Pro plus software, and the protein was selected, and a nearby negative background area was selected for subtraction. The pixel density of CYP11A1 and SOX9 was exported by the software to determine the protein levels in individual cells. Fifty pairs of densities per sample were measured and calculated for mean value as a sample size. Optical density (in arbitrary units) represents the ratio of IOD/area for proteins.

    • MDA is a decomposition product of tri-unsaturated fatty acid hydroperoxides and is a biomarker of ROS[27]. The amount of MDA in testicular homogenates was measured with a kit (Solarbio Science and Technology Co, Beijing, China) as previously described[27]. In brief, 100 mg of testicular tissue was prepared for homogenization in the extraction solution. The solution was centrifuged at 8,000 ×g in a 4 °C centrifuge for 10 min. The supernatant was used for measurement of MDA with the kit. The plates were read at 450, 532, and 600 nm with a Bio-Tek microplate reader (Shanghai, China). The amount of MDA (mmol/g testis) was calculated with the following Formula: 5 × (12.9 × (ΔA532 – ΔA600) – 2.58 × Δ450)/0.1.

    • To study the direct effects of BBOP, we used 35-day-old male Sprague Dawley rats to purify Leydig cells, as previously described[9]. The testes were removed and perfused with a collagenase D solution (0.1 mg/mL) through the testicular artery. The testis was further digested with collagenase D (0.25 mg/mL) and DNase (0.25 mg/mL). The cell suspension was filtered with a 100 μm nylon mesh and centrifuged through a Percoll gradient, and cells in the density range of 1.070–1.088 g/mL were harvested. HSD3B1 staining was performed as previously described to determine the purity of Leydig cells[28]. Leydig cells were transferred to a 12-well culture plate at a cell density of 1.0 × 106 cells/well, and 1 mL of DMEM/F12 medium was added to the well. After 24 h, the cells attached to the bottom of the well, and the medium was switched to DMEM/F12 medium containing BBOP (0, 50, 100, and 500 μmol/L) for another 24 h. The highest concentration, 500 µmol/L, was water soluble.

    • ROS levels were measured with a DCFH-DA test kit (Solarbio, Beijing, China), as previously described[29]. In brief, after Leydig cells were harvested, they were incubated with DCFH-DA in a dark room at 37 °C for 20 min, and then the fluorescence intensity was measured in a flow cytometer for ROS. The apoptosis rate was measured with an Annexin V-FITC/PI Apoptosis Detection Kit (MultiSciences Biotech Co., Hangzhou, China) as previously described[29]. Leydig cells were incubated with FITC-labeled Annexin V and PI. The apoptotic rate was measured with a flow cytometer.

    • Data are expressed as mean ± standard error (SEM). GraphPad 8 (San Diego, CA) was used for statistical analysis and graphing. Statistical evaluation was performed with one-way analysis of variance followed by Dunnett’s post hoc multiple comparison test. The significance level was set as P < 0.05.

    • Rats were exposed to BBOP (0, 10, 100, 250, or 500 mg/kg bw per day) through daily gavage during puberty (PND 35 to PND 56, Figure 1A). Compared with the control, exposure to BBOP for 21 days did not affect body weight or testis weight in rats at PND 56. BBOP significantly decreased the weight of the epididymis at doses of 250 (P < 0.05) and 500 (P < 0.01) mg/kg (Table 1). No mortality was observed in any rat group, and no abnormal behavior was observed.

      Figure 1.  Regimen and serum testosterone (T), luteinizing hormone (LH), and follicle-stimulating hormone (FSH) levels after BBOP exposure in puberty. Panel A, BBOP (0, 10, 100, 250, or 500 mg/kg bw per day) was administered via gavage; Panels B–D, serum T, LH, and FSH levels, respectively. Mean ± SEM, n = 6; *P < 0.05 and **P < 0.01 in the BBOP group versus control (0 mg/kg).

      Table 1.  General parameters of toxicity after treatment of BBOP in puberty

      ParametersBBOP [mg/(kg·day)]
      010100250500
      Number66666
      mortality (%)00000
      BW (g) before213.3 ± 9.3218.3 ± 8.2211.8 ± 11.8204.3 ± 8.0218.0 ± 4.8
      BW (g) after316.8 ± 20.2321.7 ± 24.4335.0 ± 14.4317.5 ± 14.2304.3 ± 18.3
      Testis weight (g)1.55 ± 0.081.45 ± 0.111.53 ± 0.101.53 ± 0.101.47 ± 0.09
      Relative testis weight (g)1.54 ± 0.071.42 ± 0.141.543 ± 0.101.543 ± 0.101.479 ± 0.07
      Both epididymis weight (g)0.81 ± 0.070.73 ± 0.040.76 ± 0.050.72 ± 0.05*0.70 ± 0.03**
        Note. BW = body weight. Values are mean ± SEM, n = 6. *, **Indicate significant difference when compared to the control [0 mg/(kg·day) BBOP] at P < 0.05 and 0.01, respectively.
    • BBOP affected serum testosterone levels, which were significantly lower than those in the control groups after treatment with BBOP at 250 and 500 mg/kg bw per day (P < 0.05, Figure 1B). Therefore, BBOP delays puberty onset by inhibiting testosterone biosynthesis. To check whether BBOP affects the development of Leydig cells by acting on the pituitary in the hypothalamus-pituitary testis axis, we measured serum LH and FSH levels. BBOP at 500 mg/kg bw per day significantly decreased the levels of LH (P < 0.01, Figure 1C) and FSH (P < 0.05, Figure 1D), mg/kg bw per day thus indicating that BBOP at the highest dose inhibited gonadotropin secretion.

    • Sertoli cells were stained with anti-SOX9 antibody, which detected SOX9, a biomarker of Sertoli cells[30]. Compared with the control, BBOP did not alter the number of SOX9+ Sertoli cells (Supplementary Figure S1, available in www.besjournal.com). Because Sertoli cells do not proliferate after PND 21[31], the unaltered Sertoli cell number after BBOP treatment indicated that BBOP did not induce Sertoli cell apoptosis. CYP11A1, a steroidogenic enzyme in all cells in the Leydig cell lineage[9], is used as a universal biomarker to detect all Leydig cells. HSD11B1 is a steroidogenic enzyme in mature Leydig cells [32] that is used as a specific biomarker to detect Leydig cell maturity. BBOP exposure at 500 mg/kg bw per day markedly decreased the number of CYP11A1+ Leydig cells mg/kg bw per day (P < 0.01, Figure 2). However, no significant difference was observed in HSD11B1+ Leydig cells between the BBOP groups and the control (Supplementary Figure S2, available in www.besjournal.com). Therefore, BBOP affects the number of CYP11A+/HSD11B1- progenitor Leydig cells.

      Figure 2.  Immunohistochemical staining of CYP11A1 and the number of Leydig cells (LC). The LC number was normalized to that of Sertoli cells (SC). Panels A–E, CYP11A1 staining of the 0, 10, 100, 250, and 500 mg/kg bw per day BBOP groups, respectively. Black arrow indicates CYP11A1. Scale bar = 20 μm. Panel F, quantitative number. Mean ± SEM, n = 6. **P < 0.01 in the BBOP group versus the control (0 mg/kg).

      Figure S1.  Immunohistochemical staining of SOX9 and Sertoli cell (SC) number in the testis after BBOP exposure from postnatal day (PND) 35 to 56 Panels A–E, SOX9 staining for 0, 10, 100, 250, and 500 mg/kg BBOP group, respectively; Black arrow points to SOX9 staining; Scale bar = 20 μm; Panel F, quantitation of SC number; Mean ± SEM, n = 6. There was no significant difference in the BBOP group versus the control (0 mg/kg).

    • The expression of Leydig cell genes (Insl3, Lhcgr, Scarb1, Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b3, Hsd11b1, and Nr5a1) and Sertoli cell genes (Dhh, Fshr, and Sox9) was determined by qPCR. BBOP significantly decreased the transcript levels of Cyp11a1 at doses of 10 mg/kg or higher (P < 0.01), and the mRNA levels of Insl3, Hsd11b1, and Dhh at a dose of 500 mg/kg bw per day (P < 0.05, Figure 3), thus indicating that BBOP interferes with the expression of some Leydig cell and Sertoli cell genes. Because BBOP decreased the levels of serum LH and FSH, we asked whether BBOP might affect the expression of the pituitary genes Lhb, Fshb, and Gnrhr in the pituitary gland. BBOP markedly down-regulated the expression of Lhb and Fshb at doses of 10 mg/kg and above (P < 0.01), whereas it up-regulated the expression of Gnrhr at doses of 250 and 500 mg/kg bw per day (P < 0.001, Figure 3), thereby indicating that BBOP interferes with pituitary gene expression.

      Figure 3.  Gene expression in the testis and pituitary gland after BBOP exposure. The expression of the testis genes Lhcgr, Scarb1, Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b3, Hsd11b1, Insl3, Nr5a1, Sox9, Dhh, and Fshr and of the pituitary genes Gnrhr, Lhb, and Fshb (in the dotted box) was determined by qPCR. The mRNA levels were normalized to those of Rsp16 (internal control). Mean ± SEM, n = 6. *P < 0.05, **P < 0.01 and ***P < 0.001 in the BBOP group versus the control (0 mg/kg).

    • Protein levels of INSL3, CYP11A1, HSD11B1, and DHH in the testis were detected by western blotting. BBOP significantly decreased CYP11A1 levels at doses of 100 mg/kg (P < 0.05) and above (P < 0.01, Figure 4A–B), and significantly decreased the levels of INSL3, HSD11B1, and DHH at a dose of 500 mg/kg bw per day (P < 0.05, Figure 4A–B). The density of CYP11A1 and SOX9 represented the protein levels in individual cells. Semi-quantitative immunohistochemical staining used to calculate CYP11A1 and SOX9 pixel density indicated that BBOP significantly decreased CYP11A1 density at doses of 100 mg/kg or above (P < 0.001, Figure 5) without affecting SOX9 density (Supplementary Figure S3, available in www.besjournal.com), in agreement with the western blot data.

      Figure 4.  Protein levels in the testis after BBOP exposure. Panel A, western blotting image. Panel B, quantitative results for CYP11A1, HSD11B1, INSL3, and DHH, normalized to GAPDH (the internal control). Mean ± SEM, n = 3–4. *P < 0.05 and **P < 0.01, in the BBOP group versus the control (0 mg/kg).

      Figure 5.  Semi-quantitative immunohistochemical measurement of CYP11A1 density and Leydig cell (LC) morphological metrics. Panels A–E, CYP11A1 staining for 0, 10, 100, 250, and 500 mg/kg bw per day BBOP, groups, respectively. Black arrow indicates CYP11A1 staining; scale bar = 20 μm. Panel F, CYP11A1 density. Panels G–I, LC size, nuclear size, and cytoplasm size. Mean ± SEM, n = 6. *P < 0.05 and ***P < 0.001 in the BBOP group versus the control (0 mg/kg).

    • More mature Leydig cells have larger cell sizes [23]. Both the 250 and 500 mg/kg bw per day doses of BBOP significantly decreased the Leydig cell size and cytoplasmic size (P < 0.05, Figure 5) without affecting nuclear size. Thus, the maturation of Leydig cells is delayed after exposure to BBOP in puberty.

    • We measured the expression of antioxidant genes (Sod1, Sod2, Gpx1, and Cat), an anti-apoptotic gene (Bcl2), and a pro-apoptotic gene (Bax). BBOP significantly down-regulated the expression of Sod1 and Bcl2 at a dose of 250 (P < 0.05) or 500 (P < 0.01) mg/kg, and the expression of Sod2 at a dose of 500 mg/kg bw per day (P < 0.01), but up-regulated Bax expression at a dose of 500 mg/kg bw per day (P < 0.01, Figure 6). MDA is the end product of lipid peroxidation caused by excessive ROS. MDA was significantly greater in the 250 (P < 0.01) and 500 (P < 0.001) mg/kg bw per day groups than the control group (Figure 6B). We further detected the protein levels of SOD1, SOD2, BCL2, and BAX. BBOP treatment significantly decreased SOD1, SOD2, and BCL2 levels at a dose of 250 (P < 0.05) and 500 (P < 0.01) mg/kg, whereas it markedly elevated BAX levels at a dose of 100 mg/kg (P < 0.05) or higher (P < 0.001, Figure 6C).

      Figure 6.  Expression of antioxidant enzymes, apoptosis-associated genes, and malondialdehyde (MDA) amounts after BBOP exposure. Panel A, expression of Sod1, Sod2, Gpx1, Cat, Bax, and Bcl2 in the testis, normalized to Rsp16. Panel B, testicular level of MDA. Panel C, western blotting image. Panel D, quantitative results of antioxidant enzymes and apoptosis-associated proteins. Mean ± SEM, n = 6 for mRNAs and MDA and n = 3 for western blotting. *P < 0.05, **P < 0.01, and ***P < 0.001 in the BBOP group versus the control (0 mg/kg).

    • We measured the SIRT1 levels and total protein levels of AKT1, AKT2, ERK1/2, mTOR, GSK3β, and their phosphorylated proteins by western blotting. BBOP at 250 (P < 0.05) and 500 mg/kg bw per day significantly decreased SIRT1 levels mg/kg bw per day (P < 0.01, Figure 7). BBOP did not affect total protein levels of AKT1, AKT2, ERK1/2, mTOR, and GSK3β (Figure 7). However, BBOP at 10 mg/kg or higher doses (P < 0.01) significantly decreased pAKT1 levels; consequently, the pAKT1/AKT1 ratio decreased at these doses (P < 0.01). The pAKT2, pERK1/2, and pmTOR levels decreased at a BBOP dose of 500 mg/kg bw per day (P < 0.05), thereby decreasing the pAKT2/AKT2, pERK/ERK1/2, and pmTOR/mTOR ratios (P < 0.05). The pGSK3β levels decreased at BBOP doses of 100 mg/kg or higher (P < 0.01), thus significantly decreasing the pGSK3β/GSK3β ratios (P < 0.01, Figure 7).

      Figure 7.  SIRT1, AKT1, AKT2, ERK1/2, mTOR, and GSK3β and their phosphorylated protein levels in the rat testis. Panel A, western blotting image. Panels B–G: quantification of AKT1, AKT2, ERK1/2, mTOR, and GSK3β, and their phosphorylated proteins, as well as SIRT1. The protein levels were normalized to those of GAPDH (internal control). Mean ± SEM, n = 3. *P < 0.05 and **P < 0.01 in the BBOP group versus the control (0 mg/kg).

    • We cultured Leydig cells from 35-old rats in the presence of various concentrations (50–500 μmol/L) of BBOP. We measured ROS production by cytology with a DCFH-DA kit and apoptosis of Leydig cells with an Annexin V/PI kit at the end of treatment. BBOP significantly induced ROS production at doses of 100 μmol/L (P < 0.01) and 500 μmol/L (P < 0.001, Figure 8). BBOP also markedly increased the apoptotic rate at doses of 100 μmol/L (P < 0.05) and 500 μmol/L (P < 0.001, Figure 8). These results indicated that BBOP directly induces ROS and apoptosis in primary Leydig cells.

      Figure 8.  Effects of BBOP on reactive oxygen species (ROS) and apoptosis in Leydig cells from 35-day-old rats. Leydig cells were cultured for 24 h. Panel A: ROS fluorescence spectrum. Panel B: quantification of ROS levels. Panel C: apoptosis spectrum. Panel D: quantification of the apoptosis rate. Mean ± SEM, n = 3. *P < 0.05, **P < 0.01, and ***P < 0.001 in the BBOP group versus the control (0 μmol/L).

    • In this study, exposure to BBOP significantly decreased serum testosterone levels; down-regulated the expression of several steroidogenesis-associated genes; and decreased the LH and FSH levels after pubertal exposure. Therefore, BBOP delays puberty onset by perturbing Leydig cell development during puberty.

      The alterations in serum LH and FSH levels indicated that pituitary function might be affected by BBOP exposure. Indeed, BBOP markedly down-regulated the expression of the rate-limiting genes Lhb and Fshb (Figure 3). Because the pituitary-secreted LH is the main factor regulating Leydig cells, one possible mechanism underlying the effects of BBOP on serum testosterone levels might have been direct interference with gonadotropin synthesis by the pituitary gland. This phenomenon has also been observed with 500 mg/kg bw per day DBP exposure to pubertal male rats[33]. However, DBP increases serum FSH levels mg/kg bw per day after exposure of male rats to at 500 mg/kg bw per day[33]. Moreover, BBOP decreased serum FSH levels (this study). Because LH and FSH lose negative feedback stimuli [33] after BBOP treatment, BBOP may impair testosterone biosynthesis partly via interfering with pituitary function, thereby indirectly inhibiting Leydig cell steroidogenesis. We also observed a significant increase in Gnrhr mRNA levels in the pituitary gland (Figure 3), thus indicating that the negative feedback mechanism for GnRH secretion in the hypothalamus caused by the BBOP-mediated decrease in serum testosterone levels remained intact, because the expression of Gnrhr in the pituitary gland is primarily regulated by GnRH[34].

      Decreases in FSH production may also affect Sertoli cell function. Indeed, BBOP at 500 mg/kg bw per day markedly decreased the expression of DHH mg/kg bw per day. DHH is a critical growth factor regulating the proliferation and differentiation of Leydig cells postnatally[35]. DHH knockout mice show a lack of mature Leydig cells and significantly diminished testosterone levels[36].

      In this study, we examined the general Leydig cell biomarker CYP11A1, and the mature Leydig cell biomarkers INSL3 and HSD11B1, after BBOP exposure. BBOP significantly decreased the expression of CYP11A1 at doses of 10 mg/kg or higher, and the expression of INSL3 and HSD11B1 at a dose of 500 mg/kg bw per day. The down-regulation of INSL3 and HSD11B1 indicated that Leydig cells after BBOP exposure are in an immature stage. We also examined the number of Leydig cells after immunohistochemical staining of CYP11A1 and HSD11B1. Interestingly, BBOP at 500 mg/kg bw per day significantly decreased the number of CYP11A1+ cells mg/kg bw per day but not HSD11B1+ Leydig cells. This finding indicated that the decrease in the number of Leydig cells came from CYP11A1+ and HSD11B1- Leydig cells, and that BBOP compromises the maturation of progenitor Leydig cells. Leydig cell size increases with maturity[23]. We further studied the cell dimensions of Leydig cells. The immunohistochemical results indicated that BBOP significantly decreased Leydig cell area and cytoplasmic dimension, thereby further confirming that the Leydig cells were immature at the end of BBOP treatment.

      An association between Leydig cell dysfunction and oxidative stress induced by several phthalates has been documented [37-39]. Oxidative stress is a possible cause through which BBOP may affect the development of Leydig cells. The equilibrium between ROS and antioxidant proteins is critical for Leydig cell development and cell apoptosis[40,41]. In this study, BBOP significantly increased MDA amounts and repressed the antioxidant enzymes SOD1 and SOD2, which catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen. Immunohistochemistry has indicated the presence of SOD1 in rat Leydig cells[33], which are particularly sensitive to endocrine disruptors. In primary Leydig cells, BBOP at 100 or 500 μmol/L markedly increased ROS generation, thus confirming that BBOP induces oxidative stress in Leydig cells.

      Increased ROS in Leydig cells may lead to cell apoptosis. Indeed, BBOP at 100 and 250 μmol/L significantly induced apoptosis of Leydig cells in vitro after 24 h of treatment. BAX/BCL2 apoptosis pathway analysis indicated that BBOP promoted the expression of BAX and inhibited the expression of BCL2. BAX is the major protein that triggers cell apoptosis. In contrast, BCL2 is an anti-apoptotic protein in the Bcl2 family, which is located in the outer membrane of mitochondria, the nuclear membrane, and the cytoplasm of the endoplasmic reticulum[42], where it blocks BAX-mediated action[43]. Thus, BBOP was found to be involved in the regulation of Leydig cell apoptosis, and to decrease Leydig cells at the highest dose.

      SIRT1 is an enzyme that deacetylates transcription factors and acts as an energy sensor. In this study, BBOP markedly down-regulated SIRT1 levels in the testes. SIRT1 is also involved in ROS removal in tissue. Inhibition of SIRT1 significantly increases ROS levels and decreases steroid synthesis in MA-10 Leydig cells[41]. Increased ROS may interfere with other signaling pathways, including the AKT, ERK1/2, GSK3β, and mTOR pathways. AKT1 and AKT2 are present in the testis, and suppression of AKT1/AKT2 phosphorylation causes growth retardation, testicular tissue apoptosis, and decreased testosterone biosynthesis[44,45]. Indeed, BBOP exposure significantly decreased AKT1 phosphorylation at a dose of 10 mg/kg or higher, and the phosphorylation of AKT2 at a dose of 500 mg/kg bw per day. mTOR is a downstream protein in the AKT cascade, and Chen et al. have found that the PI3K/AKT/mTOR signaling pathway plays an important role in the proliferation, survival, and apoptosis of Leydig cells[46]. Indeed, BBOP at 500 mg/kg bw per day significantly decreased phosphorylated mTOR mg/kg bw per day.

      The mTOR pathway is a major regulator of autophagy[47]. mTORC1 inhibits autophagy initiation by phosphorylating autophagy-associated genes[48]. When mTOR is inhibited, autophagy is induced[47]. Although basal autophagy is critical for positive regulation of Leydig cell steroidogenesis through up-regulation of SCARB1[49,50], excessive autophagy can lead to the inhibition of steroidogenesis and even cell death[51]. In this study, phosphorylated mTOR significantly decreased after 500 mg/kg bw per day BW BBOP exposure (Figure 7), thus possibly leading to autophagy. Studies have also shown that the PI3K/AKT pathway regulates autophagy through regulating mTOR[52]; therefore, the significant decrease in AKT1/AKT2 phosphorylation after BBOP treatment might be associated with the induction of autophagy. Whether BBOP can induce severe autophagy remains unclear. However, some phthalates, such as the metabolite of di-ethylhexyl phthalate, have been found to induce autophagy in testicular cells[53,54]. Future studies on the induction of autophagy of Leydig cells by BBOP may provide valuable information.

      Many studies have shown that ERK1/2 signaling is involved in the development of Leydig cells, through mediating the regulation of steroid production[55,56]. Knockout of the ERK1/2 pathway in mice significantly decreases testosterone biosynthesis and Leydig cell maturation [16]. In this study, BBOP at 500 mg/kg bw per day significantly decreased ERK1/2 phosphorylation (pERK1/2) mg/kg bw per day. GSK3β[57,58] plays a role in cell survival and development. In this study, BBOP was shown to inhibit GSK3β phosphorylation.

      Beyond the effects of these pathways, BBOP may also directly inhibit steroidogenic enzymes. Previous studies have shown that BBOP inhibits rat HSD3B1 and HSD17B3 activity with Ki values of 50.02 and 28.35 μmol/L, respectively [59].

      BBOP is a unique phthalate whose alcohol moiety contains oxygen atoms in the alkyl chain together with 6 carbons (C6). Compared with C1-C2 and C7-C13 phthalates, C4-C6 phthalates have been reported to have more potent inhibitory effects on Leydig cell function[7]. Indeed, BBOP had comparable inhibition of LC development as DBP (C4) in puberty[33]. However, unlike DBP, BBOP had no stimulatory effect on testosterone biosynthesis at a low dose (10 mg/kg) and potently suppressed the expression of Lhb and Fshb in the pituitary gland, thereby indicating that the addition of oxygen atoms in the alcohol carbon chain leads to more severe toxicity. BBOP at 1,000 mg/kg bw per day has been reported to cause death in female rats mg/kg bw per day [8], whereas DBP gavage of 2,000 mg/kg bw per day does not have such effects [60].

      Many phthalates, including DEHP and DBP, affect the development of Leydig cells in the fetal testis and adult Leydig cells in the pubertal testis. Through the study of in utero DBP exposure in rats, Driesche et al. have proposed that phthalates induce the expression of COUP-TFII, thereby leading to masculinization disorders in rodents[61]. However, clear species-dependent differences in phthalate-mediated effects exist. Experiments involving pubertal exposure of young marmosets and human fetal testis xenografts to DEHP have shown that the sensitivity of these two species to phthalates is less than that of rats[62], thus potentially explaining the differences in toxicokinetics observed among rats, marmosets, and humans[63,64]. Whether BBOP shows toxicokinetic differences requires further study.

      Epidemiological studies have demonstrated that some phthalates are negatively associated with semen quality. A study in 463 infertile men has reported a negative correlation between benzyl butyl phthalate metabolite and sperm count[65]. A study in Wuhan in 2013 has found that the DEHP metabolite is negatively associated with serum estradiol and testosterone, and positively associated with sperm damage and apoptosis[66]. Xu et al. have also studied seven phthalates among 116 (32 normal control men and 84 infertile men) in Jiangsu Province (China) and found that the BBOP levels (0.079 mg/L) in the infertile semen were approximately half those of DEHP, whereas the BBOP levels in infertile semen were markedly higher than those in the normal healthy controls[67]. In this regard, the Chinese population is widely exposed to BBOP. Because many studies have used doses as high as 750–1,000 mg/(kg·day) for DEHP in rodents[68], the corresponding doses for BBOP in this study should be associated with human exposure levels.

      Although no epidemiological and animal studies have examined the effects of BBOP on female puberty development, investigations of other phthalates have shown that phthalates promote puberty rather than affecting male reproduction[69,70].

      This was a classic toxicity study of the effect of BBOP on the development of Leydig cells in puberty. The limitation of this study is the inability to extrapolate the research results to humans. More epidemiological studies are required to demonstrate the negative correlation of BBOP with human reproduction and BBOP exposure levels.

    • Exposure of male rats to BBOP in puberty delays puberty onset by inhibition of Leydig cell development. BBOP blocks the secretion of LH and FSH in the pituitary gland, and decreases SIRT1. Consequently, ROS are induced; phosphorylation of AKT1, AKT2, ERK1/2, GSK3β, and mTOR decreases; and the expression of steroidogenic enzymes and testosterone biosynthesis is inhibited.

    • The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

    • Figure S2.  Immunohistochemical staining of HSD11B1 and Leydig cell (LC) number in the testis after BBOP exposure from postnatal day (PND) 35 to 56. Panels A–E, HSD11B1 staining for 0, 10, 100, 250, and 500 mg/kg BBOP group, respectively; Scale bar = 20 μm; Panel F, quantitation of LC number [normalized to Sertoli cell (SC) number]; Mean ± SEM, n = 6. There was no significant difference in the BBOP group versus the control (0 mg/kg).

      Figure S3.  Semi-quantitative measurement SOX9 density in the testis after BBOP exposure from postnatal day (PND) 35 to 56. Panels A–E, SOX9 staining for 0, 10, 100, 250, and 500 mg/kg BBOP group, respectively; Black arrow points to SOX9 staining; Scale bar = 20 μm. Panel F, SOX9 density; Mean ± SEM, n = 6. There is no significant difference in the BBOP group versus the control (0 mg/kg).

      Figure S4.  Graphical abstract

参考文献 (70)
补充材料:
22068Supplementary Materials.pdf

目录

    /

    返回文章
    返回