-
The sample size (N) was estimated with the formula N ≥ (Z1-α/2/δ)2 × p × (1 – p), wherein Z was 1.96 for the two-sided 95% confidential intervals (CIs), P was the dyslipidemia prevalence of 34.64% in Shenzhen adults as known in 2012 but unpublished at the design stage of our study[21], δ was 2.2%, representing tolerable error, and the calculated N was 1,798.
After signing written consent forms to be subjects in the study, adult volunteers visiting a health examination center in Shenzhen City in Guangdong Province, China, were recruited between July 2013 and January 2014. A questionnaire survey administered via face-to-face interview was conducted to collect the basic health information of each participant. The inclusion criteria were: 1) Han Chinese aged ≥ 20 years old; 2) living in Shenzhen for > 2 years; 3) free of liver diseases, renal diseases, and any cancers in the past six months; and 4) not pregnant (for women). The excluded subjects were those who 1) had severe organic diseases, 2) had acute infection symptoms, allergic diseases, and malignant tumors, 3) had a family history of genetic diseases including familial dyslipidemia, 4) had taken VD supplements in the past six months, 5) had taken medicines to control lipid levels within the past 12 hours, or 6) had taken diuretics, engaged in strenuous exercise, or had overeaten within the 24 hours before the test.
From ulnar veins of the subjects, who had fasted overnight, blood samples were collected with vacuum tubes, and within two hours post-collection, supernatant and blood cells were separated by centrifugation of 3,000 ×g at 4 °C for 10 min. The body mass index (BMI) was calculated as body weight (kg)/ height (m)2. The above protocol for the cross-sectional study was approved by the Ethics Committee of the Shenzhen Center for Chronic Disease Control and was in accordance with the Declaration of Helsinki. The study was registered at ClinicalTrials.gov (registration ID number NCT04707612).
-
Parameters of lipids, glucose, hemogram, etc., were assayed right on the day, and the rest of the samples were aliquoted with EP tubes and stored at -80 °C for later use. The systolic blood pressure (SBP) and diastolic blood pressure (DBP) of the subjects were measured by a standard mercury sphygmomanometer. Glycated hemoglobin (HbA1c) was detected with a Japan Arkray Instruments analyzer (ion chromatography method). The serum levels of TG, TC, LDLC, HDLC, and fasting plasma glucose (FPG) were tested by the Beckman-LX20 automatic biochemical analyzer. The plasma 25OHD concentration was detected with a commercial ELISA kit (Cat. #: AC-57F1, IDS Ltd., UK). According to the Chinese guidelines for dyslipidemia management[22], TG ≥ 2.3 mmol/L, TC ≥ 6.2 mmol/L, LDLC ≥ 4.1 mmol/L, HDLC < 1.0 mmol/L, or previously diagnosed dyslipidemia, were the criteria used to define the dyslipidemia group (DL), and those subjects who did not match the DL criteria were assigned to the non-dyslipidemia group (ND).
In the logistic analyses, from the viewpoint of preventive medicine, as well as to avoid the small subject numbers for the genotypes of low minor allele frequency (MAF)[23], the available marginally-elevated cut-off values for TG (≥ 1.7 mmol/L), TC (≥ 5.2 mmol/L), and LDLC (≥ 3.4 mmol/L), as well as the only available cut-off value for HDLC (< 1.0 mmol/L), were used to define the abnormal subgroups for the corresponding lipid parameters.
-
The protocols for DNA preparation and SNP genotyping described in our previous studies[23, 24] were also adopted in the present study. Briefly, an asymmetric amplification with molecular beacon-based real-time quantitative PCR (MB-qPCR) followed by a melting step was performed to determine the variation of the SNP loci. Before its application to the large sample size analysis, the method was verified with the gold standard of Sanger sequencing (ThermoFisher, Shanghai, China). The information of primers and molecular beacons for the genotyping experiment with qPCR (Roche 480II, Singapore) is presented in Supplementary Table S1, available in www.besjournal.com.
NCBI rs ID SNP name Allelesa Positionb Oligo name Oligo sequence, 5’–3’ directionc Length of
amplicon, bprs11568820 Cdx2 C > T promoter region, Probe cctgaTTACTGTGACCTAGTTTACTCAGG 179 chr12:47908762 Forward primer CAATGAAAGCAAACCAAGGGGTCTTC Backward primer AGGAAGGAAAAGAGGATAGAGAAAAT rs2228570 Fok1 A > Bd exon 2, chr12:47879112 Probe ccgcGGGATGGAGGCAATGGCGG 178 Forward primer CACTGACTCTGGCTCTGACCGT Backward primer GCAGCCTTCACAGGTCATA rs7975232 Apa1 C > A intron 8, chr12:47845054 Probee ctTGGGCCCCTCACTGCTCAAg 185 rs731236 Taq1 A > G exon 9, chr12:47844974 Probee cgcGGATGGCCTCAATCAGCGCG Forward primer GGCGGCAGCGGATGTACG Backward primer GCCGTTGAGTGTCTGTGT Note. aThe usages of these alleles are consistent to those used in the NCBI dbSNP database. bLocation of the allelic bases on the VDR and chromosome 12. cIn the probe sequence, the lowercase letters at the 5’ or 3’ end are adaptor bases, and the highlighted letters are one of the alleles in the SNP locus. dB, degenerate base standing for C, G, and T, i.e. not A. eApa1 and Taq1 were detected with their respective probe on the same qPCR amplicon. Table S1. The information of molecular beacon probes and primers for genotyping the four single nucleotide polymorphisms (SNPs) of vitamin D receptor gene (VDR)
The nucleotide bases used in our study were consistent with those in dbSNP of NCBI, i.e., C > T for rs11568820 (Cdx2), A > B (not A) for rs2228570 (Fok1), C > A for rs7975232 (Apa1), and A > G for rs731236 (Taq1). If the complementary bases [G > A for Cdx2, T > V (standing for A, C, and G) for Fok1, G > T for Apa1, and T > C for Taq1], or the letter standing for the DNA-digestibility with the corresponding restriction enzyme (f > F for Fok1, a > A for Apa1, and T > t for Taq1), were used in the references, the original usages were provided as bracketed annotations in our article.
-
The statistical analyses were performed using SPSS for Windows version 25 (IBM Corp., Armonk, NY, USA). Clinical data were presented as medians and interquartile ranges (25% to 75%) and compared with rank-sum tests (Wilcoxon rank test or Kruskal-Wallis rank test). The genotypes of the four SNPs were tested with Hardy-Weinberg equilibrium (HWE) analyses for sampling representation. For genotypic comparisons, differences in allele and genotype frequencies were evaluated using the chi-square (χ2) test. The homozygous genotypes of CC for Cdx2, AA for Fok1, CC for Apa1, and AA for Taq1 were used as reference genotypes, respectively. For both genders, the additive, dominant, recessive, homozygous, and allelic models for each of the SNPs were entered into the logistic regression analyses for odds ratios (ORs) and 95% CIs with adjustment for age, BMI, FPG, HbA1c, 25OHD, SBP, and DBP. In order to analyze the interaction between VD nutritional levels and VDR SNPs, the interaction factor calculated by 25OHD concentrations and VDR SNPs were entered into the logistic regression with adjustment for those confounders mentioned above. A simple linear regression was used to assess the association between circulating 25OHD and lipid profiles. A P-value of less than 0.05 was considered to be statistically significant.
-
A total of 1,987 adults were included in the analysis, aged from 20 to 81 years old. Among them, there were 1,124 females aged 39 (31–49) (median and interquartile range) years old and 863 males aged 36 (30–44) years old. The clinical profiles of the participants were divided into DL and ND for each gender, as summarized in Table 1. It was indicated that several metabolic or metabolism-related parameters were statistically different between DL and ND adults (P < 0.05), such as age, BMI, FPG, HbA1c, SBP, DBP, TG, TC, LDLC, HDLC, etc. In particular, 25OHD concentrations were statistically different between DL and ND groups in men but not in women.
Variables Female Male DL (n = 236) ND (n = 888) P-value DL (n = 299) ND (n = 564) P-value Age, y 50 (38.3–57) 36 (30–46) < 0.001 39 (33–47) 33 (29–42) < 0.001 BMI, kg/m2 23.1 (21.1–24.9) 21.6 (20.0–23.2) < 0.001 25.3 (24.0–27.0) 23.9 (22.0–25.6) < 0.001 25OHD, nmol/L 59.3 (49.6–71.3) 58.4 (49.2–68.3) 0.245 60.8 (50.8–71.1) 63.4 (54.3–73.6) 0.005 Sun exposure time, min/w 23.0 (10.0–39.0) 20.0 (10.0–39.0) 0.680 24.0 (10.0–41.0) 24.0 (13.0–50.0) 0.135 FPG, mmol/L 5.6 (5.3–6.0) 5.3 (5.0–5.6) < 0.001 5.5 (5.2–5.9) 5.3 (5.0–5.6) < 0.001 HbA1c, % 5.8 (5.5–6.1) 5.5 (5.4–5.7) < 0.001 5.7 (5.5–6.0) 5.6 (5.4–5.8) < 0.001 SBP, mmHg 118 (108–133.8) 111.5 (104–121) < 0.001 126 (118–136) 121.5 (112–131) < 0.001 DBP, mmHg 71 (64–79) 67 (61–73) < 0.001 77 (71–85) 73 (67–80) < 0.001 TG, mmol/L 1.7 (1.0–2.8) 0.8 (0.6–1.1) < 0.001 2.7 (2.1–3.6) 1.2 (0.9–1.6) < 0.001 TC, mmol/L 6.4 (5.4–6.9) 4.9 (4.4–5.4) < 0.001 5.7 (4.7–6.4) 5.0 (4.4–5.5) < 0.001 LDLC, mmol/L 3.7 (3.0–3.9) 2.7 (2.4–3.1) < 0.001 3.2 (2.7–3.7) 2.8 (2.5–3.1) < 0.001 HDLC, mmol/L 1.6 (1.4–1.8) 1.4 (1.3–1.6) < 0.001 1.5 (1.3–1.6) 1.3 (1.2–1.5) < 0.001 Note. BMI: body mass index; DBP: diastolic blood pressure; DL: dyslipidemia; FPG: fasting plasma glucose; HbA1c: glycated hemoglobin; HDLC: high-density lipoprotein cholesterol; LDLC: low-density lipoprotein cholesterol; ND: non-dyslipidemia; SBP: systolic blood pressure; TC: total cholesterol; TG: triglyceride. Table 1. Clinical profiles of study subjects (medians and interquartile ranges)
-
The results of the genotyping experiment on the SNPs with MB-qPCR are shown in Supplementary Figure S1, available in www.besjournal.com. The HWE test showed that the population sampled from the Health Examination Center was representative of the population at large (Supplementary Table S2, available in www.besjournal.com). The genotypic and allelic frequencies of VDR SNPs between DL and ND groups are summarized in Supplementary Table S3, available in www.besjournal.com. In the female participants, both genotypic and allelic frequencies of Fok1 showed differences between DL and ND groups (P < 0.05); while in the male participants, these differences were not observed. The genotypic and allelic frequencies of the other three SNPs, namely Cdx2, Apa1, and Taq1, did not display significant differences between the DL and ND groups for either gender (P ≥ 0.05), and neither did their different genetic models (Supplementary Tables S4–S6, available in www.besjournal.com).
Gene Additive model Dominant model Recessive model Homozygous model Allelic model models GG AG AA GG + AG AA GG AG + AA GG AA G A DL n 2 45 488 47 488 2 533 2 488 49 1,021 % 0.4 8.4 91.2 8.8 91.2 0.4 99.6 0.4 99.6 4.6 95.4 ND n 7 141 1,304 148 1,304 7 1,445 7 1,304 155 2,749 % 0.5 9.6 89.9 10.2 89.8 0.5 99.5 0.5 99.5 5.3 94.7 Total n 9 186 1,792 195 1,792 9 1,978 9 1,792 204 3,770 % 0.5 9.4 90.2 9.8 90.2 0.5 99.5 0.5 99.5 5.1 94.9 χ2 0.89 0.88 0.00 0.11 0.92 P value 0.64 0.35 1.00 0.74 0.34 Table S6. Genetic model comparison of Taq1 (rs731236) in vitamin D receptor gene between dyslipidemia (DL) and non-dyslipidemia (ND) adults
Figure S1. Melting curve analyses on the polymorphisms of vitamin D receptor gene (VDR). Panel A: Melting curve of VDR Cdx2 (rs11568820, A). Panel B: Melting curve of Fok1 (rs2228570, B). Panel C: Melting curve of VDR Apa1 (rs7975232, C). Panel D: Melting curve of VDR Taq1 (rs731236, D).
Genotype n Genotype frequency, % χ2 P value* Cdx2 TT CT CC DL 1,142 20.0 47.0 34.0 2.06 0.15 ND 845 19.0 51.0 30.0 0.80 0.37 total 1,987 19.0 49.0 32.0 0.26 0.61 Fok1 BB AB AA DL 1,142 28.0 52.0 20.0 2.38 0.12 ND 845 28.0 50.0 22.0 0.06 0.81 total 1,987 28.0 51.0 21.0 1.75 0.19 Apa1 AA AC CC DL 1,142 10.0 39.0 51.0 4.85 0.03 ND 845 9.0 42.0 49.0 0.09 0.76 total 1,987 9.0 40.0 50.0 2.14 0.14 Taq1 GG AG AA DL 1,142 0.5 8.0 90.0 2.73 0.10 ND 845 0.5 11.0 91.0 0.60 0.44 total 1,987 1.0 9.0 90.0 3.01 0.08 Note. Abbreviations: B, degenerate base standing for C, G, and T; DL, dyslipidemia; ND, non-dyslipidemia. *Hardy-Weinberg equilibrium analyses test for the genotypes of the four SNPs. Table S2. Hardy-Weinberg equilibrium tests on the vitamin D receptor gene polymorphisms, Cdx2 (rs11568820), Fok1 (rs2228570), Apa1 (rs7975232), and Taq1 (rs731236)
Genotype Female Male DL, %
n = 236ND, %
n = 888χ2 P value DL, %
n = 299ND, %
n = 564χ2 P value Cdx2 TT 17.8 19.4 0.955 0.620 20.4 19.1 0.390 0.823 CT 50.0 51.6 43.8 45.9 CC 32.2 29.1 35.8 34.9 T 42.8 45.2 0.841 0.359 42.3 42.1 0.006 0.937 C 57.2 54.8 57.7 57.9 Fok1 AA 15.3 23.3 11.658 0.003 16.7 21.6 3.871 0.144 AB 48.7 50.2 53.2 52.8 BB 36.0 26.5 30.1 25.5 A 39.6 48.4 11.618 0.001 43.3 48.0 3.528 0.060 B 60.4 51.6 56.7 52.0 Apa1 AA 9.3 9.9 0.120 0.942 8.7 9.0 0.304 0.859 AC 41.1 40.1 41.5 39.5 CC 49.6 50.0 49.8 51.4 A 29.9 30.0 0.001 0.972 29.4 28.8 0.073 0.787 C 70.1 70.0 70.6 71.2 Taq1 AA 91.5 88.9 1.496 0.476 91.0 91.3 0.256 0.921 AG 8.1 10.7 8.7 8.2 GG 0.4 0.5 0.3 0.5 A 95.6 94.2 1.305 0.253 95.3 95.4 0.005 0.946 G 4.4 5.8 4.7 4.6 Note. Abbreviations: B, degenerate base standing for C, G, and T. Table S3. Comparisons of the genotypic and allelic frequencies of vitamin D receptor gene polymorphisms, Cdx2 (rs11568820), Fok1 (rs2228570), Apa1 (rs7975232), and Taq1 (rs731236) between dyslipidemia (DL) and non-dyslipidemia (ND) adults
Gene Additive model Dominant model Recessive model Homozygous model Allelic model models TT CT CC TT + CT CC TT CT + CC TT CC T C DL n 103 249 183 352 183 103 432 103 183 455 615 % 19.3 46.5 34.2 65.8 34.2 19.3 80.7 36.0 64.0 42.5 57.5 ND n 280 717 455 997 455 280 1,172 280 455 1,277 1,627 % 19.3 49.4 31.3 68.7 31.3 19.3 80.7 38.1 61.9 44.0 56.0 Total n 383 966 638 1,349 638 383 1,604 383 638 1,732 2,242 % 19.3 48.6 32.1 67.9 32.1 19.3 80.7 37.5 62.5 43.6 56.4 χ2 1.54 1.48 0.00 0.38 0.67 P value 0.46 0.22 0.99 0.54 0.41 Table S4. Genetic model comparison of Cdx2 (rs11568820) in vitamin D receptor gene between dyslipidemia (DL) and non-dyslipidemia (ND) adults
-
Logistic regression analyses were performed with adjustment for age and BMI since the adjustment for 25OHD did not change the overall correlations (see Supplementary Tables S7–S8). For female participants (see Table 2), between the subgroups of LDLC (≥ 3.4 vs. < 3.4 mmol/L), VDR Fok1 presented significance (P < 0.05) in its additive (BB vs. AB vs. AA, P = 0.03, OR = 1.28, 95% CI: 1.03–1.59), recessive (BB vs. AB + AA, P = 0.03, OR = 1.44, 95% CI: 1.04–2.00), homozygous (BB vs. AA, P = 0.02, OR = 2.89, 95% CI: 1.18–7.05), and allelic (B vs. A, P = 0.04, OR = 1.26, 95% CI: 1.01–1.59) models, but between the subgroups of TC (≥ 5.2 vs. < 5.2 mmol/L) and HDLC (< 1.0 vs. ≥ 1.0 mmol/L), no significance (P ≥ 0.05) was found in all models of the four SNPs.
Gene models TG ≥ 1.7 vs. < 1.7 mmol/L TC ≥ 5.2 vs. < 5.2 mmol/L LDLC ≥ 3.4 vs. < 3.4 mmol/L HDLC < 1.0 vs. ≥ 1.0 mmol/L P OR (95% CI) P OR (95% CI) P OR (95% CI) P OR (95% CI) Apa1 (rs7975232) Add.: AA vs. AC vs. CC 0.45 1.11
(0.84–1.48)0.47 0.93
(0.75–1.14)0.39 1.11
(0.87–1.42)0.93 1.03
(0.52–2.02)Dom.: AA + AC vs. CC 0.59 1.11
(0.77–1.59)0.34 0.88
(0.67–1.15)0.59 1.09
(0.79–1.50)0.84 1.10
(0.45–2.69)Rec.: AA vs. AC + CC 0.76 1.10
(0.61–1.98)0.86 0.96
(0.62–1.48)0.35 1.27
(0.77–2.09)0.95 0.96
(0.22–4.22)Hom.: AA vs. CC 0.20 0.25
(0.03–2.05)0.56 1.31
(0.53–3.22)0.17 2.01
(0.74–5.50)0.84 1.29
(0.12–13.92)Alle.: A vs. C 0.44 1.12
(0.84–1.51)0.36 0.90
(0.73–1.12)0.61 1.07
(0.83–1.38)0.87 1.06
(0.52–2.19)Cdx2 (rs11568820) Add.: TT vs. CT vs. CC 0.13 0.82
(0.64–1.06)0.77 0.97
(0.81–1.17)0.76 1.04
(0.83–1.29)0.35 0.74
(0.40–1.38)Dom.: TT + CT vs. CC 0.09 0.72
(0.50–1.05)0.30 0.86
(0.65–1.14)0.70 1.07
(0.77–1.49)0.74 0.85
(0.34–2.14)Rec.: TT vs. CT + CC 0.57 0.88
(0.56–1.37)0.48 1.12
(0.82–1.55)0.99 1.00
(0.68–1.48)0.20 0.38
(0.09–1.65)Hom.: TT vs. CC 0.33 0.61
(0.23–1.64)0.23 1.49
(0.77–2.88)0.58 1.26
(0.56–2.84)0.34 0.33
(0.04–3.16)Alle.: T vs. C 0.10 0.80
(0.62–1.04)0.81 0.98
(0.81–1.18)0.70 0.96
(0.76–1.20)0.27 0.70
(0.37–1.33)Fok1 (rs2228570) Add.: BB vs. AB vs. AA 0.54 1.08
(0.84–1.39)0.36 1.09
(0.91–1.30)0.03 1.28
(1.03–1.59)0.63 1.16
(0.64–2.13)Dom.: BB + AB vs. AA 0.49 1.17
(0.75–1.81)0.67 1.07
(0.78–1.46)0.20 1.29
(0.88–1.90)0.59 0.77
(0.29–2.01)Rec.: BB vs. AB + AA 0.69 1.08
(0.74–1.59)0.28 1.17
(0.88–1.54)0.03 1.44
(1.04–2.00)0.19 1.80
(0.75–4.30)Hom.: BB vs. AA 0.27 0.60
(0.24–1.48)0.76 1.11
(0.58–2.11)0.02 2.89
(1.18–7.05)0.95 1.06
(0.16–7.25)Alle.: B vs. A 0.30 1.15
(0.89–1.49)0.20 1.13
(0.94–1.36)0.04 1.27
(1.01–1.59)0.46 1.27
(0.67–2.40)Taq1 (rs731236) Add.: GG vs. AG vs. AA 0.10 0.57
(0.29–1.11)0.36 0.81
(0.53–1.24)0.81 0.94
(0.57–1.55)0.86 0.87
(0.20–3.83)Dom.: GG + AG vs. AA 0.13 0.59
(0.30–1.17)0.38 0.82
(0.53–1.28)0.88 0.96
(0.57–1.62)0.94 0.95
(0.20–4.48)Rec.: GG vs. AG + AA 1.00 0.00
(0.00–NA)0.47 0.43
(0.05–4.10)0.93 1.11
(0.12–10.47)1.00 0.00
(0.00–NA)Hom.: GG vs. AA NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)Alle.: G vs. A 0.11 0.58
(0.30–1.14)0.31 0.80
(0.52–1.23)0.72 0.91
(0.55–1.51)0.88 0.89
(0.19–4.07)Note. Abbreviations: Add.: additive model; Alle.: allelic model; B: degenerate base standing for C, G, and T; CI: confidence interval; Dom.: dominant model; HDLC: high-density lipoprotein cholesterol; Hom.: homozygous model; LDLC: low-density lipoprotein cholesterol; NA: not available; OR: odds ratio; Rec.: recessive model; SNPs: single nucleotide polymorphisms; TC: total cholesterol; TG: triglyceride; VDR: vitamin D receptor gene. Table 2. Logistic regression analyses of lipids with SNPs of VDR in adult females with adjustment for age and body mass index
Gene models TG ≥ 1.7 vs. < 1.7 mmol/L TC ≥ 5.2 vs. < 5.2 mmol/L LDLC ≥ 3.4 vs. < 3.4 mmol/L HDLC < 1.0 vs. ≥ 1.0 mmol/L P OR (95% CI) P OR (95% CI) P OR (95% CI) P OR (95% CI) Apa1 (rs7975232) Add.: AA vs. AC vs. CC 0.47 1.11
(0.84–1.47)0.48 0.93
(0.76–1.14)0.38 1.12
(0.87–1.43)0.93 1.03
(0.52–2.04)Dom.: AA + AC vs. CC 0.59 1.10
(0.77–1.59)0.35 0.88
(0.67–1.15)0.59 1.09
(0.79–1.50)0.87 1.08
(0.44–2.64)Rec.: AA vs. AC + CC 0.84 1.06
(0.59–1.92)0.88 0.97
(0.63–1.49)0.33 1.29
(0.78–2.12)0.99 1.01
(0.23–4.45)Hom.: AA vs. CC 0.16 0.21
(0.03–1.86)0.52 1.35
(0.54–3.34)0.16 2.09
(0.75–5.81)0.71 1.63
(0.13–20.27)Alle.: A vs. C 0.45 1.12
(0.83–1.51)0.38 0.91
(0.73–1.13)0.54 1.08
(0.84–1.40)0.79 1.11
(0.53–2.33)Cdx2 (rs11568820) Add.: TT vs. CT vs. CC 0.15 0.83
(0.64–1.07)0.77 0.97
(0.81–1.17)0.79 1.03
(0.83–1.29)0.38 0.76
(0.40–1.42)Dom.: TT + CT vs. CC 0.10 0.73
(0.50–1.06)0.30 0.86
(0.65–1.14)0.70 1.07
(0.76–1.49)0.79 0.88
(0.35–2.23)Rec.: TT vs. CT + CC 0.65 0.90
(0.57–1.41)0.49 1.12
(0.81–1.55)0.97 0.99
(0.67–1.46)0.20 0.38
(0.09–1.68)Hom.: TT vs. CC 0.42 0.66
(0.23–1.85)0.27 1.45
(0.75–2.82)0.51 1.32
(0.58–3.02)0.27 0.28
(0.03–2.71)Alle.: T vs. C 0.11 0.81
(0.62–1.05)0.98 1.00
(0.83–1.21)0.79 0.97
(0.77–1.22)0.45 0.77
(0.40–1.50)Fok1 (rs2228570) Add.: BB vs. AB vs. AA 0.57 1.08
(0.84–1.39)0.35 1.09
(0.91–1.31)0.03 1.28
(1.03–1.59)0.68 1.13
(0.62–2.07)Dom.: BB + AB vs. AA 0.51 1.16
(0.75–1.80)0.64 1.08
(0.79–1.47)0.18 1.31
(0.89–1.92)0.57 0.76
(0.29–1.99)Rec.: BB vs. AB + AA 0.70 1.08
(0.73–1.59)0.29 1.16
(0.88–1.54)0.03 1.45
(1.04–2.00)0.22 1.72
(0.72–4.14)Hom.: BB vs. AA 0.22 0.55
(0.21–1.44)0.68 1.15
(0.60–2.20)0.02 2.86
(1.16–7.08)0.98 1.03
(0.14–7.63)Alle.: B vs. A 0.30 1.15
(0.88–1.49)0.27 1.11
(0.92–1.34)0.05 1.26
(1.00–1.58)0.37 1.36
(0.70–2.65)Taq1 (rs731236) Add.: GG vs. AG vs. AA 0.08 0.55
(0.28–1.08)0.35 0.82
(0.54–1.25)0.85 0.95
(0.58–1.58)0.87 0.89
(0.20–3.87)Dom.: GG + AG vs. AA 0.11 0.57
(0.28–1.13)0.41 0.83
(0.53–1.29)0.94 0.98
(0.58–1.66)0.98 0.98
(0.21–4.64)Rec.: GG vs. AG + AA 1.00 0.00
(0.00–NA)0.45 0.42
(0.04–3.99)0.96 1.06
(0.11–10.06)1.00 0.00
(0.00–NA)Hom.: GG vs. AA NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)Alle.: G vs. A 0.12 0.59
(0.30–1.15)0.27 0.79
(0.51–1.21)0.75 0.92
(0.56–1.53)0.86 0.87
(0.19–4.09)Note. Abbreviations: Add., additive model; Alle., allelic model; B, degenerate base standing for C, G, and T; CI, confidential interval; Dom., dominant model; HDLC, high-density lipoprotein cholesterol; Hom., homozygous model; LDLC, low-density lipoprotein cholesterol; NA, not available; OR, odds ratio; Rec., recessive model; SNPs, single nucleotide polymorphisms; TC, total cholesterol; TG, triglyceride; VDR, vitamin D receptor gene. Table S7. Logistic regression analyses of lipids with SNPs of VDR in adult females with adjustment for age, body mass index, dietary 25-hydroxyvitamin D, and the sunshine time per week
Gene models TG
≥ 1.7 vs. < 1.7 mmol/LTC
≥ 5.2 vs. < 5.2 mmol/LLDLC
≥ 3.4 vs. < 3.4 mmol/LHDLC
< 1.0 vs. ≥ 1.0 mmol/LP OR (95% CI) P OR (95% CI) P OR (95% CI) P OR (95% CI) Apa1 (rs7975232) Add.: AA vs. AC vs. CC 0.55 1.08
(0.85–1.37)0.95 0.99
(0.79–1.24)0.92 0.99
(0.75–1.30)0.11 1.72
(0.88–3.35)Dom.: AA + AC vs. CC 0.49 1.12
(0.82–1.51)0.46 0.90
(0.68–1.19)0.74 0.94
(0.67–1.34)0.13 2.11
(0.81–5.51)Rec.: AA vs. AC + CC 0.77 1.08
(0.64–1.83)0.23 1.35
(0.83–2.20)0.82 1.07
(0.58–1.97)0.51 1.54
(0.43–5.53)Hom.: AA vs. CC 0.74 1.18
(0.45–3.11)0.25 1.72
(0.69–4.29)0.56 1.36
(0.49–3.82)0.31 3.00
(0.37–24.68)Alle.: A vs. C 0.47 1.10
(0.86–1.41)0.66 1.05
(0.84–1.33)0.83 0.97
(0.73–1.29)0.35 1.39
(0.70–2.77)Cdx2 (rs11568820) Add.: TT vs. CT vs. CC 0.65 0.96
(0.78–1.17)0.09 0.85
(0.71–1.03)0.46 0.92
(0.73–1.16)0.12 1.62
(0.89–2.95)Dom.: TT + CT vs. CC 0.88 0.98
(0.72–1.33)0.14 0.81
(0.61–1.07)0.64 0.92
(0.65–1.30)0.57 1.32
(0.50–3.50)Rec.: TT vs. CT + CC 0.57 0.90
(0.62–1.30)0.20 0.80
(0.57–1.13)0.40 0.83
(0.54–1.28)0.04 2.68
(1.06–6.75)Hom.: TT vs. CC 0.06 2.25
(0.97–5.23)0.82 0.92
(0.42–1.99)0.74 1.17
(0.47–2.95)0.19 4.84
(0.46–51.14)Alle.: T vs C 0.62 0.95
(0.76–1.18)0.14 0.86
(0.70–1.05)0.45 0.91
(0.71–1.17)0.30 1.42
(0.73–2.73)Fok1 (rs2228570) Add.: BB vs. AB vs. AA 0.50 0.93
(0.75–1.15)0.08 0.84
(0.69–1.02)0.77 1.04
(0.81–1.33)0.02 2.26
(1.12–4.56)Dom.: BB + AB vs. AA 0.75 0.94
(0.65–1.36)0.30 0.84
(0.59–1.17)0.63 1.11
(0.72–1.72)0.23 2.48
(0.57–10.90)Rec.: BB vs. AB + AA 0.47 0.89
(0.64–1.23)0.08 0.76
(0.56–1.03)0.97 0.99
(0.68–1.45)0.03 2.75
(1.12–6.74)Hom.: BB vs. AA 0.89 1.06
(0.48–2.35)0.80 1.11
(0.52–2.35)0.82 1.11
(0.45–2.73)0.82 0.79
(0.10–6.34)Alle.: B vs. A 0.50 0.93
(0.75–1.15)0.19 0.87
(0.71–1.07)0.53 1.08
(0.84–1.39)0.09 1.85
(0.91–3.76)Taq1 (rs731236) Add.: GG vs AG vs. AA 0.67 1.12
(0.67–1.86)0.70 1.10
(0.68–1.76)0.30 0.72
(0.38–1.35)0.64 0.69
(0.15–3.19)Dom.: GG + AG vs. AA 0.69 1.12
(0.65–1.91)0.75 1.09
(0.66–1.79)0.42 0.76
(0.40–1.47)0.85 0.86
(0.19–3.97)Rec.: GG vs. AG + AA 0.83 1.27
(0.15–11.06)0.47 2.36
(0.23–24.37)1.00 0.00
(0.00–NA)1.00 0.00
(0.00–NA)Hom.: GG vs. AA NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)Alle.: G vs. A 0.65 1.13
(0.67–1.89)0.68 1.11
(0.68–1.79)0.31 0.72
(0.38–1.37)0.71 0.75
(0.17–3.37)Note. Abbreviations: Add., additive model; Alle., allelic model; B, degenerate base standing for C, G, and T; CI, confidential interval; Dom., dominant model; HDLC, high-density lipoprotein cholesterol; Hom., homozygous model; LDLC, low-density lipoprotein cholesterol; NA, not available; OR, odds ratio; Rec., recessive model; SNPs, single nucleotide polymorphisms; TC, total cholesterol; TG, triglyceride; VDR, vitamin D receptor gene. Table S8. Logistic regression analyses of lipids with SNPs of VDR in adult males with adjustment for age, body mass index, dietary 25-hydroxyvitamin D, and the sunshine time per week
Table 3 displays the logistic regression analyses of the relationships between the lipids and the SNPs of VDR in the male participants. Between the subgroups of HDLC (< 1.0 vs. ≥ 1.0 mmol/L), the data presented significance (P < 0.05) in the recessive model of Cdx2 (TT vs. CT + CC, P = 0.04, OR = 2.70, 95% CI: 1.08–6.80) and the additive (BB vs. AB vs. AA, P = 0.02, OR = 2.25, 95% CI: 1.12–4.52) and recessive (BB vs. AB + AA, P = 0.02, OR = 2.73, 95% CI: 1.11–6.70) models of Fok1, while other models of the genotype showed no significance (P ≥ 0.05). Differences were not found for Apa1 and Taq1 between the subgroups defined by any of the lipid profiles (P ≥ 0.05).
Gene models TG ≥ 1.7 vs. < 1.7 mmol/L TC ≥ 5.2 vs. < 5.2 mmol/L LDLC ≥ 3.4 vs. < 3.4 mmol/L HDLC < 1.0 vs. ≥ 1.0 mmol/L P OR (95% CI) P OR (95% CI) P OR (95% CI) P OR (95% CI) Apa1 (rs7975232) Add.: AA vs. AC vs. CC 0.65 1.06
(0.83–1.34)0.89 0.98
(0.79–1.23)0.86 0.98
(0.74–1.29)0.12 1.71
(0.88–3.31)Dom.: AA + AC vs. CC 0.54 1.10
(0.81–1.49)0.43 0.89
(0.67–1.18)0.71 0.94
(0.66–1.33)0.13 2.10
(0.80–5.48)Rec.: AA vs. AC + CC 0.90 1.04
(0.62–1.74)0.27 1.32
(0.81–2.15)0.88 1.05
(0.57–1.92)0.50 1.55
(0.43–5.53)Hom.: AA vs. CC 0.85 1.09
(0.44–2.72)0.26 1.67
(0.68–4.09)0.55 1.36
(0.50–3.73)0.28 3.17
(0.40–25.19)Alle.: A vs. C 0.49 1.09
(0.85–1.40)0.66 1.05
(0.84–1.33)0.86 0.98
(0.73–1.30)0.34 1.40
(0.70–2.78)Cdx2 (rs11568820) Add.: TT vs. CT vs. CC 0.66 0.96
(0.78–1.17)0.09 0.85
(0.71–1.03)0.46 0.92
(0.73–1.16)0.10 1.65
(0.91–3.00)Dom.: TT + CT vs. CC 0.90 0.98
(0.72–1.33)0.14 0.81
(0.61–1.07)0.65 0.92
(0.65–1.31)0.54 1.36
(0.51–3.59)Rec.: TT vs. CT + CC 0.56 0.90
(0.62–1.29)0.20 0.80
(0.57–1.13)0.40 0.83
(0.54–1.28)0.04 2.70
(1.08–6.80)Hom.: TT vs. CC 0.12 1.87
(0.85–4.13)0.71 0.87
(0.40–1.86)0.90 1.06
(0.43–2.61)0.19 4.71
(0.46–48.16)Alle.: T vs. C 0.67 0.95
(0.77–1.18)0.15 0.86
(0.71–1.06)0.45 0.91
(0.71–1.17)0.28 1.43
(0.74–2.76)Fok1 (rs2228570) Add.: BB vs. AB vs. AA 0.48 0.93
(0.75–1.15)0.08 0.84
(0.68–1.02)0.80 1.03
(0.81–1.32)0.02 2.25
(1.12–4.52)Dom.: BB + AB vs. AA 0.80 0.96
(0.66–1.37)0.32 0.84
(0.60–1.18)0.60 1.12
(0.73–1.73)0.22 2.53
(0.58–11.06)Rec.: BB vs. AB + AA 0.43 0.88
(0.63–1.21)0.07 0.75
(0.56–1.02)0.91 0.98
(0.67–1.43)0.03 2.73
(1.11–6.70)Hom.: BB vs. AA 0.83 1.09
(0.51–2.34)0.82 1.09
(0.52–2.29)0.79 1.13
(0.46–2.74)0.78 0.75
(0.10–5.83)Alle.: B vs. A 0.45 0.92
(0.74–1.14)0.16 0.87
(0.71–1.06)0.58 1.07
(0.84–1.38)0.10 1.82
(0.90–3.70)Taq1 (rs731236) Add.: GG vs. AG vs. AA 0.64 1.13
(0.68–1.85)0.69 1.10
(0.69–1.76)0.32 0.73
(0.39–1.37)0.65 0.71
(0.15–3.24)Dom.: GG + AG vs. AA 0.69 1.12
(0.66–1.90)0.74 1.09
(0.66–1.79)0.44 0.77
(0.40–1.48)0.84 0.85
(0.19–3.94)Rec.: GG vs. AG + AA 0.79 1.34
(0.16–11.27)0.46 2.42
(0.24–24.75)1.00 0.00
(0.00–NA)1.00 0.00
(0.00–NA)Hom.: GG vs. AA NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)NA NA
(NA–NA)Alle.: G vs. A 0.62 1.14
(0.68–1.90)0.66 1.11
(0.69–1.80)0.32 0.72
(0.38–1.37)0.70 0.74
(0.17–3.34)Note. Abbreviations: Add.: additive model; Alle.: allelic model; B: degenerate base standing for C, G, and T; CI: confidence interval; Dom.: dominant model; HDLC: high-density lipoprotein cholesterol; Hom.: homozygous model; LDLC: low-density lipoprotein cholesterol; NA: not available; OR, odds ratio; Rec.: recessive model; SNPs: single nucleotide polymorphisms; TC: total cholesterol; TG: triglyceride; VDR: vitamin D receptor gene. Table 3. Logistic regression analyses of lipids with SNPs of VDR in adult males with adjustment for age and body mass index
-
No differences were found in the comparison of 25OHD concentrations across genotype models of VDR gene polymorphisms in both genders (see Supplementary Table S9, available in www.besjournal.com). When the plasma 25OHD concentrations in subjects with abnormal and normal lipid profiles were compared, it was shown that women with low HDLC had higher 25OHD while men with high TG had lower 25OHD than the subjects with normal lipid parameters (P < 0.05, Supplementary Table S10, available in www.besjournal.com).
-
In men, lg TG (β = −0.003, P < 0.001), LDLC (β = −0.003, P = 0.006), and HDLC (β = −0.001, P = 0.025) were inversely associated with the 25OHD concentration while in women, none of the lipid profiles showed a significant correlation with the 25OHD concentration (P ≥ 0.05, Supplementary Table S11, available in www.besjournal.com).
Genotype Female Male comparison n Median IQR P value n Median IQR P value Apa1 (rs7975232) Add: AA vs. AC vs. CC CC 561 58.97 [49.68–69.18] 0.35 439 63.18 [53.75–72.59] 0.83 AC 453 58.75 [49.16–68.63] 347 62.33 [52.65–73.59] AA 110 57.04 [48.40–65.71] 77 60.91 [52.44–73.32] Dom: AC + AA vs. CC AC + AA 563 58.53 [49.01–68.18] 0.47 424 62.12 [52.66–73.49] 0.54 CC 561 58.97 [49.68–69.18] 439 63.18 [53.75–72.59] Rec: AA vs. AC + CC AA 110 57.04 [48.40–65.71] 0.16 77 60.91 [52.44–73.32] 0.83 AC + CC 1,014 58.86 [49.50–68.82] 786 62.63 [53.24–72.72] Hom: AA vs. CC AA 110 57.04 [48.40–65.71] 0.15 77 60.91 [52.44–73.32] 0.74 CC 561 58.97 [49.68–69.18] 439 63.18 [53.75–72.59] Alle: A vs. C A 673 58.30 [48.86–67.20] 0.23 501 62.04 [52.66–73.38] 0.57 C 1,575 58.90 [49.54–68.88] 1,225 62.85 [53.38–72.66] Cdx2 (rs11568820) Add.: TT vs. CT vs. CC CC 334 59.17 [50.94–68.68] 0.20 304 61.79 [53.30–72.53] 0.69 CT 576 59.08 [48.96–69.29] 390 63.11 [53.50–72.93] TT 214 56.48 [48.30–67.03] 169 61.65 [51.85–72.31] Dom.: CT + TT vs. CC CT + TT 790 58.35 [48.80–68.56] 0.41 559 62.76 [53.14–72.88] 0.72 CC 334 59.17 [50.94–68.68] 304 61.79 [53.30–72.53] Rec.: TT vs. CT + CC TT 214 56.48 [48.30–67.03] 0.08 169 61.65 [51.85–72.31] 0.56 CT + CC 910 59.15 [49.50–69.12] 694 62.83 [53.46–72.73] Hom.: TT vs. CC TT 214 56.48 [48.30–67.03] 0.08 169 61.65 [51.85–72.31] 0.81 CC 334 59.17 [50.94–68.68] 304 61.79 [53.30–72.53] Alle: T vs. C T 1,004 58.00 [48.65–68.27] 0.13 728 62.59 [52.78–72.82] 0.93 C 1,244 59.15 [49.95–68.88] 998 62.61 [53.36–72.66] Fok1 (rs2228570) Add.: BB vs. AB vs. AA AA 243 57.56 [48.62–69.02] 0.83 172 63.52 [54.12–73.35] 0.47 AB 561 58.75 [49.14–69.11] 457 62.44 [53.50–72.16] BB 320 59.04 [49.98–67.16] 234 61.49 [51.87–72.67] Dom.: BB + AB vs. AA BB + AB 881 58.87 [49.43–68.55] 0.54 691 62.30 [53.17–72.33] 0.40 AA 243 57.56 [48.62–69.02] 172 63.52 [54.12–73.35] Rec.: BB vs. AB + AA BB 320 59.04 [49.98–67.16] 0.87 234 61.49 [51.87–72.67] 0.27 AB + AA 804 58.37 [49.03–69.07] 629 62.80 [53.64–72.82] Hom.: BB vs. AA BB 320 59.04 [49.98–67.16] 0.62 234 61.49 [51.87–72.67] 0.24 AA 243 57.56 [48.62–69.02] 172 63.52 [54.12–73.35] Alle.: B vs. A B 1,201 58.92 [49.55–68.41] 0.65 925 62.16 [52.72–72.54] 0.24 A 1,047 58.32 [49.01–69.02] 801 62.99 [53.89–72.93] Taq1 (rs731236) Add.: GG vs AG vs. AA AA 1,005 58.53 [49.43–68.66] 0.92 787 62.37 [53.24–72.59] 0.50 AG 114 60.05 [48.85–67.77] 72 64.27 [52.80–75.16] GG 5 53.88 [37.14–74.36] 4 67.28 [66.31–71.96] Dom.: AG + GG vs. AA AG + GG 119 59.98 [48.95–67.63] 0.91 76 64.98 [53.28–74.37] 0.46 AA 1,005 58.53 [49.43–68.66] 787 62.37 [53.24–72.59] Rec.: GG vs AG + AA GG 5 53.88 [37.14–74.36] 0.68 4 67.28 [66.31–71.96] 0.30 AG + AA 1,119 58.73 [49.36–68.59] 859 62.56 [53.20–72.72] Hom.: GG vs. AA GG 5 53.88 [37.14–74.36] 0.68 4 67.28 [66.31–71.96] 0.29 AA 1,005 58.53 [49.43–68.66] 787 62.37 [53.24–72.59] Alle.: G vs. A G 124 59.97 [49.01–67.61] 0.84 80 65.45 [53.57–73.86] 0.34 A 2,124 58.64 [49.41–68.64] 1,646 62.49 [53.23–72.66] Note. Abbreviations: Add., additive model; Alle., allelic model; B, degenerate base standing for C, G, and T; Dom., dominant model; Hom., homozygous model; IQR, interquartile range; Rec., recessive model; VDR, vitamin D receptor gene. Table S9. Comparison of 25-hydroxyvitamin D concentration (nmol/L) across genotype models of VDR gene polymorphisms in adult males and females
-
According to the logistic regression results (see Tables 2 and 3) and the simple linear regression results (see Supplementary Table S11), VD and VDR SNPs had some parameters that were related to the results of dyslipidemia. Therefore, we further explored whether VD and VDR SNPs were synergistic or antagonistic to the results of dyslipidemia. The results (see Table 4) further showed that in men, the combined effect of VD, Fok1 BB (P = 0.02, OR = 1.03, 95% CI: 1.01–1.06), and Cdx2 TT (P = 0.02, OR = 1.03, 95% CI: 1.01–1.06) synergistically led to a decrease in HDLC levels while in women, there was no significant difference in the interaction between VD and Fok1 or Cdx2 (OR < 1 and P ≥ 0.05) on the lipid profiles.
Genotype Female Male LDLC, ≥ 3.4 vs. < 3.4 mmol/L HDLC, < 1.0 vs. ≥ 1.0 mmol/L P OR (95% CI) P OR (95% CI) Cdx2 CC − − 0.11 1.02 (1.00–1.05) CT − − 0.28 1.02 (0.99–1.05) TT − − 0.02 1.03 (1.01–1.06) Fok1 AA 0.08 0.99 (0.98–1.00) 0.46 1.01 (0.98–1.05) AB 0.13 0.99 (0.98–1.00) 0.17 1.02 (0.99–1.05) BB 0.58 1.00 (0.99–1.01) 0.02 1.03 (1.01–1.06) Note. Abbreviations: 25OHD: 25-hydroxyvitamin D; B: degenerate base standing for C, G, and T; CI: confidence interval; HDLC: high-density lipoprotein cholesterol; LDLC: low-density lipoprotein cholesterol; OR: odds ratio; SNPs: single nucleotide polymorphisms; TG: triglyceride; –: interaction analyses were not conducted due to negative findings in the logistic regression analyses for the genotypes. Table 4. Interactions between plasma 25OHD concentrations and SNPs of VDR, Cdx2 (rs11568820) and Fok1 (rs2228570) on the occurrence of dyslipidemia
-
None of the authors have any conflicts of interest to declare.
Gene
modelsAdditive model Dominant model Recessive model Homozygous model Allelic model AA AC CC AA + AC CC AA AC + CC AA CC A C DL n 48 221 266 269 266 48 487 48 266 317 753 % 9.0 41.3 49.7 50.3 49.7 9.0 91.0 15.3 84.7 29.6 70.4 ND n 139 579 734 718 734 139 1,313 139 734 857 2,047 % 9.5 39.9 50.6 49.4 50.6 9.6 90.4 15.9 84.1 29.5 70.5 Total n 187 800 1,000 987 1,000 187 1,800 187 1,000 1,174 2,800 % 9.4 40.3 50.3 49.7 50.3 9.4 90.6 15.8 84.2 29.5 70.5 χ2 0.40 0.11 0.17 0.10 0.01 P value 0.82 0.74 0.68 0.79 0.94 Table S5. Genetic model comparison of Apa1 (rs7975232) in vitamin D receptor gene between dyslipidemia (DL) and non-dyslipidemia (ND) adults
Genotype Female Male comparison n Median IQR P value n Median IQR P value TG ≥ 2.3 mmol/L 92 57.79 [49.43–65.74] 0.40 213 59.58 [49.47–69.60] < 0.01 < 2.3 mmol/L 1,032 58.80 [49.25–68.85] 650 63.43 [54.29–73.70] TC ≥ 6.2 mmol/L 151 59.19 [47.87–72.64] 0.68 111 59.18 [49.73–71.13] 0.09 < 6.2 mmol/L 973 58.56 [49.55–68.31] 752 62.92 [53.42–72.93] LDLC ≥ 4.1 mmol/L 29 56.70 [45.80–66.12] 0.52 17 55.45 [45.07–74.43] 0.20 < 4.1 mmol/L 1,095 58.78 [49.41–68.66] 846 62.65 [53.27–72.72] HDLC < 1.0 mmol/L 22 67.80 [59.52–78.05] < 0.01 20 69.35 [57.83–83.61] 0.11 ≥ 1.0 mmol/L 1,102 58.52 [49.13–68.44] 843 62.57 [53.19–72.59] Note. Abbreviations: HDLC, high-density lipoprotein cholesterol; IQR, interquartile range; LDLC, low-density lipoprotein cholesterol; TC, total cholesterol; TG, triglyceride. Table S10. Comparison of 25-hydroxyvitamin D concentration (nmol/L) in abnormal and normal lipid groups of adult males and females
Lipid profiles Female Male β P value β P value lg TG < 0.001 0.902 − 0.003 < 0.001 TC 0.001 0.647 − 0.003 0.088 LDLC − 0.001 0.584 − 0.003 0.006 HDLC < 0.001 0.461 − 0.001 0.025 Note. Abbreviations: HDLC, high-density lipoprotein cholesterol; LDLC, low-density lipoprotein cholesterol; TC, total cholesterol; TG, triglyceride. Table S11. Simple linear regressions between serum 25-hydroxyvitamin D and lipid profiles
HTML
Subjects and Sample Collection
Index Measurement
DNA Preparation and SNP Genotyping
Data Analysis
Clinical Profiles of the Participants
Genotypic Frequencies of VDR
Logistic Regression Analyses of the Relationship between VDR SNPs and Dyslipidemia
Comparison of 25OHD Concentration
Relationship between Circulating 25OHD and Lipid Profiles
Interaction between VD Nutritional Status and VDR SNPs on the Occurrence of Dyslipidemia
21077Supplementary Materials.pdf |