A Five-year Surveillance of Carbapenemase-producing Klebsiella pneumoniae in a Pediatric Hospital in China Reveals Increased Predominance of NDM-1

DONG Fang LU Jie WANG Yan SHI Jin ZHEN Jing Hui CHU Ping ZHEN Yang HAN Shu Jing GUO Yong Li SONG Wen Qi

DONG Fang, LU Jie, WANG Yan, SHI Jin, ZHEN Jing Hui, CHU Ping, ZHEN Yang, HAN Shu Jing, GUO Yong Li, SONG Wen Qi. A Five-year Surveillance of Carbapenemase-producing Klebsiella pneumoniae in a Pediatric Hospital in China Reveals Increased Predominance of NDM-1[J]. Biomedical and Environmental Sciences, 2017, 30(8): 562-569. doi: 10.3967/bes2017.075
Citation: DONG Fang, LU Jie, WANG Yan, SHI Jin, ZHEN Jing Hui, CHU Ping, ZHEN Yang, HAN Shu Jing, GUO Yong Li, SONG Wen Qi. A Five-year Surveillance of Carbapenemase-producing Klebsiella pneumoniae in a Pediatric Hospital in China Reveals Increased Predominance of NDM-1[J]. Biomedical and Environmental Sciences, 2017, 30(8): 562-569. doi: 10.3967/bes2017.075

doi: 10.3967/bes2017.075
基金项目: 

Beijing Municipal Science and Technology Project D131100005313014

Scientific Research Project of Beijing Children's Hospital 2012MS08

A Five-year Surveillance of Carbapenemase-producing Klebsiella pneumoniae in a Pediatric Hospital in China Reveals Increased Predominance of NDM-1

Funds: 

Beijing Municipal Science and Technology Project D131100005313014

Scientific Research Project of Beijing Children's Hospital 2012MS08

More Information
    Author Bio:

    DONG Fang, female, born in 1970, MM, majoring in microbiology and bacterial resistance

    Corresponding author: SONG Wen Qi, E-mail:songwqbch@163.com
    • 关键词:
    •  / 
    •  / 
    •  
  • Table  1.   Primers used for PCR Amplification

    CPMase Sequence (5'to 3') Expected Size (bp)
    KPC15 P1: GCTACACCTAGCTCCACCTTC P2: GCATGGATTACCAACCACTGT 898
    GES15 P1: ATGCGCTTCATTCACGCAC P2: CTATTTGTCCGTGCTCAGG 591
    IMI/NMC-A15 P1: CAGAGCAAATGAACGATTTC P2: GGTACGCTAGCACGAATAC 879
    SME15 P1: GTGTTTGTTTAGCTTTGTCGGC P2: GCAATACGTGATGCTTCCGC 642
    IMP12 P1: GGAATAGAGTGGCTTAATTCTC P2: GTGATGCGTCYCCAAYTTCACT 361
    VIM12 P1: CAGATTGCCGATGGTGTTTGG P2: AGGTGGGCCATTCAGCCAGA 523
    GIM16 P1: TCGACACACCTTGGTCTGAA P2: AACTTCCAACTTTGCCATGC 477
    SPM16 P1: AAAATCTGGGTACGCAAACG P2: ACATTATCCGCTGGAACAGG 271
    SIM16 P1: TACAAGGGATTCGGCATCG P2: TAATGGCCTGTTCCCATGTG 570
    NDM-112 P1: CAGCACACTTCCTATCTC P2: CCGCAACCATCCCCTCTT 292
    OXA-51-like16 P1: TAATGCTTTGATCGGCCTTG P2: TGGATTGCACTTCATCTTGG 353
    OXA-23-like16 P1: GATCGGATTGGAGAACC GA P2: ATTTCTGACCGCATTTCCAT 501
    OXA-40-like16 P1: GGTTAGTTGGCCCCCTTA AA P2: AGTTGAGCGAAAAGGGGATT 246
    OXA-58-like16 P1: AAGTATTGGGGCTTGTGCTG P2: CCCCTCTGCGCTCTACATAC 599
    OXA-4817 P1: GCGTGGTTAAGGATGAACAC P2: CATCAAGTTCAACCCAACCG 438
    OXA-18117 P1: ATGCGTGTATTAGCCTTATCG P2: AACTACAAGCGCATCGAGCA 888
    下载: 导出CSV

    Table  2.   Clinical Features of the Carbapenemase-producing K. pneumoniae Strains

    Clinical Feature 2010(n = 28)n (%) 2011(n = 37)n (%) 2012(n = 28)n (%) 2013(n = 40)n (%) 2014(n = 46)n (%) Total(n= 179)n (%)
    Clinical units Internal medicine 11 (39.3) 24 (64.9) 8 (28.6) 14 (35.0) 14 (30.4) 71 (39.7)
    Haematology 6 (21.4) 9 (24.3) 8 (28.6) 15 (37.5) 15 (32.6) 53 (29.6)
    Intensive care unit 6 (21.4) 2 (5.4) 10 (35.6) 7 (17.5) 10 (21.8) 35 (19.6)
    Surgery 5 (17.9) 2 (5.4) 1 (3.6) 4 (10.0) 7 (15.2) 19 (10.6)
    Dermatology 0 0 1 (3.6) 0 0 1 (0.5)
    Gender Male 15 (53.6) 23 (62.6) 17 (60.7) 27 (67.5) 28 (60.9) 110 (61.5)
    Female 13 (46.4) 14 (37.4) 11 (39.3) 13 (32.5) 18 (39.1) 69 (38.5)
    Years < 1 m 2 (7.1) 5 (13.5) 6 (21.4) 3 (7.5) 2 (4.3) 18 (10.0)
    1 m-1 y 12 (42.9) 16 (43.3) 8 (28.6) 17 (42.5) 18 (39.1) 71 (39.7)
    1-6 y 9 (32.2) 8 (21.6) 5 (17.9) 8 (20.0) 17 (37.0) 47 (26.3)
    7-12 y 2 (7.1) 4 (10.8) 9 (32.1) 8 (20.0) 8 (17.4) 31 (17.3)
    > 12 y 3 (10.7) 4 (10.8) 0 4 (10.0) 1 (2.2) 12 (6.7)
    Specimen site Tracheal aspirations 16 (57.2) 24 (64.9) 14 (50.0) 17 (42.5) 20 (43.5) 91 (50.8)
    Blood 4 (14.2) 7 (18.9) 10 (35.6) 16 (40.0) 19 (41.3) 56 (31.3)
    Midstream urine 4 (14.2) 4 (10.8) 1 (3.6) 2 (5.0) 3 (6.5) 14 (7.8)
    Pus secretions 1 (3.6) 1 (2.7) 1 (3.6) 4 (10.0) 1 (2.2) 8 (4.5)
    Nasopharyngeal secretions 1 (3.6) 1 (2.7) 0 1 (2.5) 3 (6.5) 6 (3.4)
    Catheter 2 (7.2) 0 1 (3.6) 0 0 3 (1.7)
    Ascites 0 0 1 (3.6) 0 0 1 (0.5)
    下载: 导出CSV

    Table  3.   Antimicrobial Resistance Profiles of K. pneumoniae Strains during the Study Period

    Antibiotics Total (n = 179) 2010 (n = 28) 2011 (n = 37) 2012 (n = 28) 2013 (n = 40) 2014 (n = 46)
    %R %I %R %I %R %I %R %I %R %I %R %I
    AM 100 0 100 0 100 0 100 0 100 0 100 0
    CZ 100 0 100 0 100 0 100 0 100 0 100 0
    CTX 100 0 100 0 100 0 100 0 100 0 100 0
    CAZ 99.4 0.6 100 0 97.3 2.7 100 0 100 0 100 0
    FEP 89.4 7.8 75.0 10.7 91.9 8.1 92.9 3.6 87.5 12.5 95.7 4.3
    ATM 86.6 0 96.4 0 64.9 0 82.1 0 87.5 0 84.8 0
    AMC 100 0 100 0 100 0 100 0 100 0 100 0
    TZP 67.0 13.4 75.0 25.0 48.6 21.6 67.9 10.7 67.5 7.5 76.1 6.5
    IMP 68.2 26.8 14.3 71.4 62.2 29.7 87.5 7.1 75.0 25.0 89.1 10.9
    MEN 87.2 8.4 67.9 17.9 70.3 21.6 100 0 92.5 5.0 100 0
    STX 76.0 0.6 75.0 0 75.7 0 85.7 3.6 82.5 0 65.2 0
    GEN 68.7 1.1 50.0 0 70.3 2.7 75.0 3.6 65.0 0 67.4 0
    ANK 10.1 1.7 7.1 3.6 18.9 5.4 10.7 0 25.0 0 10.9 0
    CIP 20.7 13.4 28.6 0 25.0 5.6 25.0 28.6 15.0 25.0 15.2 8.7
    CL 0 0 0 0 0 0 0 0 0 0 0 0
      Note.AM, Ampicillin; CZ, Cefazolin; CTX, Cefotaxime; CAZ, Ceftazidime; FEP, Cefepime; ATM, Aztreonam; AMC, Amoxicillin-clavulanic; TZP, Piperacillin-Tazobactam; IMP, Imipenem; MEN, Meropenem; STX, Trimethoprim-sulfamethorazole; GEN, Gentamicin; ANK, Amikacin; CIP, Ciprofloxacin; CL, Colistin; R, resistant, I, intermediate.
    下载: 导出CSV

    Table  4.   Distribution of Different Genotypes from 2010 to 2014

    Genotype 2010 (n = 28)n(%) 2011 (n = 37)n(%) 2012 (n = 28)n(%) 2013 (n = 40)n(%) 2014 (n = 46)n (%) Total (n = 179)n(%)
    IMP-4 type 21 (75.0) 29 (78.4) 14 (50.0) 15 (37.5) 13 (28.3) 92 (51.4)
    IMP-8 type 3 (10.8) 0 0 0 0 3 (1.7)
    NDM-1 type 2 (7.1) 4 (10.8) 11 (39.3) 19 (47.5) 29 (63.0) 65 (36.3)
    KPC-2 -type 0 1 (2.7) 0 2 (5.0) 3 (6.5) 6 (3.4)
    Undetermined 2 (7.1) 3 (8.1) 3 (10.7) 4 (10.0) 1 (2.2) 13 (7.2)
    下载: 导出CSV

    Table  5.   Antimicrobial Resistance Profiles of Different Genotypes of K. pneumoniae Strains

    Antimicrobial Agent IMP-4 type (92) IMP-8 type (3) NDM-1 type (65) KPC type (6) Undetermined (13)
    %R %I %R %I %R %I %R %I %R %I
    AM 100 0 100 0 100 0 100 0 100 0
    CZ 100 0 100 0 100 0 100 0 100 0
    CTX 100 0 100 0 100 0 100 0 100 0
    CAZ 98.9 1.1 100 0 100 0 100 0 100 0
    FEP 82.6 13.0 66.7 33.3 100 0 100 0 84.6 7.7
    ATM 84.8 0 100 0 89.2 0 100 0 69.2 0
    AMC 100 0 100 0 100 0 100 0 100 0
    TZP 46.7 18.5 100 0 89.2 7.7 83.3 16.7 76.9 7.7
    IMP 50.0 42.4 0 66.7 96.9 3.1 100 0 53.9 38.4
    MEN 78.3 16.3 66.7 0 100 0 100 0 84.6 0
    STX 69.6 0 33.3 0 84.6 1.5 66.7 0 84.6 0
    GEN 64.1 1.1 66.7 0 72.3 1.5 83.3 0 76.9 0
    ANK 12.0 2.2 0 0 4.6 1.5 50 0 7.7 0
    CIP 21.7 9.8 33.3 0 10.8 21.5 66.7 0 30.8 7.7
    CL 0 0 0 0 0 0 0 0 0 0
      Note.AM, Ampicillin; CZ, Cefazolin; CTX, Cefotaxime; CAZ, Ceftazidime; FEP, Cefepime; ATM, Aztreonam; AMC, Amoxicillin-clavulanic; TZP, Piperacillin-Tazobactam; IMP, Imipenem; MEN, Meropenem; STX, Trimethoprim-sulfamethorazole; GEN, Gentamicin; ANK, Amikacin; CIP, Ciprofloxacin; CL, Colistin. R, resistant, I, intermediate.
    下载: 导出CSV
  • [1] Struve C, Krogfelt K. Pathogenic potential of environmental Klebsiella pneumoniae isolates. Environ Microbiol, 2004; 6, 584-90. doi:  10.1111/emi.2004.6.issue-6
    [2] Tzouvelekis LS, Markogiannakis A, Psichogiou M, et al. Carbapenemases in Klebsiella pneumoniae and Other Enterobacteriaceae:an Evolving Crisis of Global Dimensions. Clin Microbiol Rev, 2012; 25, 682-707. doi:  10.1128/CMR.05035-11
    [3] Holt KE, Wertheim H, Zadoks RN, et al. Genomic analysis of diversity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent threat to public health. P Natl Acad Sci USA, 2015; 112, E3574-81. doi:  10.1073/pnas.1501049112
    [4] van Duin D, Kaye KS, Neuner EA, et al. Carbapenem-resistant Enterobacteriaceae:a review of treatment and outcomes. Diagn Microbiol Infect Dis, 2013; 75, 115-20. doi:  10.1016/j.diagmicrobio.2012.11.009
    [5] Correa L, Martino M, Marra A, et al. 2013. A hospital-based matched case-control study to identify clinical outcome and risk factors associated with carbapenem-resistant Klebsiella pneumoniae infection. BMC Infect Dis, 2013; 13, 80.
    [6] Centers for Disease Control and Prevention (CDC). Vital signs:carbapenem-resistant Enterobacteriaceae. MMWR Morb Mortal Wkly Rep, 2013; 62, 165-70. https://www.ncbi.nlm.nih.gov/pubmed/23466435
    [7] Deshpande LM, Jones RN, Fritsche TR, et al. Occurrence and characterization of carbapenemase-producing Enterobacteriaceae:Report from the SENTRY Antimicrobial Surveillance Program (2000-2004). Microb Drug Resist, 2006; 12, 223-30. doi:  10.1089/mdr.2006.12.223
    [8] Chen L, Mathema B, Chavda KD, et al. Carbapenemase-producing Klebsiella pneumoniae:molecular and genetic decoding. Trends Microbiol, 2014; 22, 686-96. doi:  10.1016/j.tim.2014.09.003
    [9] Pitout JDD, Nordmann P, Poirel L. Carbapenemase-Producing Klebsiella pneumoniae, a Key Pathogen Set for Global Nosocomial Dominance. Antimicrob Agents Chemother, 2015; 59, 5873-84. doi:  10.1128/AAC.01019-15
    [10] Nordmann P, Naas T, Poirel L. Global Spread of Carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis, 2011; 17, 1791-8. doi:  10.3201/eid1710.110655
    [11] Dai YY, Zhang CF, Ma XL, et al. Outbreak of carbapenemase-producing Klebsiella pneumoniae neurosurgical site infections associated with a contaminated shaving razor used for preoperative scalp shaving. Am J Infect Control, 2014; 42, 805-6. doi:  10.1016/j.ajic.2014.03.023
    [12] Liu Y, Wan LG, Deng Q, et al. First description of NDM-1-, KPC-2-, VIM-2-and IMP-4-producing Klebsiella pneumoniae strains in a single Chinese teaching hospital. Epidemiol Infect, 2015; 143, 376-84. doi:  10.1017/S0950268814000995
    [13] ZhouJ, Li GP, Ma XJ, et al. Outbreak of colonization by carbapenemase-producing Klebsiella pneumoniae in a neonatal intensive care unit:Investigation, control measures and assessment. Am J Infect Control, 2015; 43, 1122-4. doi:  10.1016/j.ajic.2015.05.038
    [14] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; 24th Informational Supplement M100-S24. Wayne. Pennsylvania: CLSI, 2014.
    [15] Deshpande LM, Rhomberg PR, Sader HS, et al. Emergence of serine carbapenemases (KPC and SME) among clinical strains of Enterobacteriaceae isolated in the United States Medical Centers:Report from the MYSTIC Program (1999-2005). Diagn Microbiol Infect Dis, 2006; 56, 367-72. doi:  10.1016/j.diagmicrobio.2006.07.004
    [16] NeilWoodford. Rapid characterization of beta-lactamases by multiplex PCR. Methods Mol Biol, 2010; 642, 181-92. doi:  10.1007/978-1-60327-279-7
    [17] Shanthi M, Sekar U, ArunagiriK, et al. OXA-181 Beta Lactamase is not a Major Mediator of Carbapenem Resistance in Enterobacteriaceae. J Clin Diagn Res, 2013; 7, 1986-8.
    [18] Ahmed-Bentley J, Chandran AU, Joffe AM, et al. Gram-Negative Bacteria That Produce Carbapenemases Causing Death Attributed to Recent Foreign Hospitalization. Antimicrob Agents Chemother, 2013; 57, 3085-91. doi:  10.1128/AAC.00297-13
    [19] Hu FP, Guo Y, Zhu DM, et al. Resistance trends among clinical isolates in China reported from CHINET surveillance of bacterial resistance, 2005-2014. Clin Microbiol Infect, 2016; 22, S9-S14. doi:  10.1016/j.cmi.2016.01.001
    [20] Hu FP, Zhu DM, Wang F, et al. CHINET surveillance of distribution and susceptibility of carbapenem-resistant Enterobacteriaceae isolates in 2012. Chinese Journal of Infection and Chemotherapy, 2014; 14, 382-6. (In Chinese)
    [21] Meng JH, Zhu L, Li WL, et al. Antimicrobial resistance surveillance of gram-negative bacteria from children in China, 2012. Chin J Clin Pharmacol, 2015; 31, 990-2. (In Chinese)
    [22] Jin Y, Shao CH, Li J, et al. Outbreak of Multidrug Resistant NDM-1-Producing Klebsiella pneumoniae from a Neonatal Unit in Shandong Province, China. PLoS One, 2015; 10, e0119571. doi:  10.1371/journal.pone.0119571
    [23] Centers for Disease Control and Prevention (CDC). Detection of Enterobacteriaceae isolates carrying metallo-beta-lactamase-United States, 2010. MMWR Morb Mortal Wkly Rep, 2010; 59, 750.
    [24] Sánchez-Romero I, Asensio A, Oteo J, et al. Nosocomial Outbreak of VIM-1-Producing Klebsiella pneumoniae Isolates of Multilocus Sequence Type 15:Molecular Basis, Clinical Risk Factors, and Outcome. Antimicrob Agents Chemother, 2012; 56, 420-7. doi:  10.1128/AAC.05036-11
    [25] Chen LR, Zhou HW, Cai JC, et al.Combination of IMP-4 metallo-beta-lactamase production and porin deficiency causes carbapenem resistance in a Klebsiella oxytoca clinical isolate. Diagn Microbiol Infect Dis, 2009; 65, 163-7. doi:  10.1016/j.diagmicrobio.2009.07.002
    [26] Dong F, Song WQ, Xu XW, et al. Analysis of carbapenemase genotypes in carbapenem-nonsusceptible Enterobacteriaceae strains isolated from pediatric patient. Chinese Journal of Infection and Chemotherapy, 2013; 13, 270-4. (In Chinese) http://en.cnki.com.cn/Article_en/CJFDTOTAL-KGHL201304010.htm
    [27] Bax BD, Chan PF, Eggleston DS, et al. Type ⅡA topoisomerase inhibition by a new class of antibacterial agents. Nature, 2010; 466, 935-40. doi:  10.1038/nature09197
    [28] Nordmann, Couard JP, Sansot D, et al.Emergence of an Autochthonous and Community-Acquired NDM-1-Producing Klebsiella pneumoniae in Europe. Clin Infect Dis, 2012; 54, 150-1. doi:  10.1093/cid/cir720
    [29] Yong D, TolemanMA, Giske CG, et al. Characterization of a New Metallo-beta-Lactamase Gene, bla(NDM-1), and a Novel Erythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiella pneumoniae Sequence Type 14 from India. Antimicrob Agents Chemother, 2009; 53, 5046-54. doi:  10.1128/AAC.00774-09
  • [1] Huan Liu, Yuecheng Yang, Xing Duan, Yichen Jin, Yanfen Cao, Yi Feng, Chang Cai, Hehe Zhao, Houlin Tang.  HIV Pretreatment Drug Resistance and Transmission Clusters among Newly Diagnosed Patients in the China-Myanmar Border Region, 2020–2023 . Biomedical and Environmental Sciences, 2025, 38(7): 840-847. doi: 10.3967/bes2025.080
    [2] Yu Feng FAN, Dong Xin LIU, Yi Wang CHEN, Xi Chao OU, Qi Zhi MAO, Ting Ting YANG, Xi Jiang WANG, Wen Cong HE, Bing ZHAO, Zhen Jiang LIU, Maiweilanjiang ABULIMITI, Maimaitiaili AIHEMUTI, Qian GAO, Yan Lin ZHAO.  Inferring Mycobacterium Tuberculosis Drug Resistance and Transmission using Whole-genome Sequencing in a High TB-burden Setting in China . Biomedical and Environmental Sciences, 2024, 37(2): 157-169. doi: 10.3967/bes2023.116
    [3] DING Rui, MA Rui Rui, LIU Ya Li, ZHAO Ying, GUO Li Na, DOU Hong Tao, SUN Hong Li, LIU Wen Jing, ZHANG Li, WANG Yao, LI Ding Ding, YI Qiao Lian, XU Ying Chun.  Causative Microorganisms Isolated from Patients with Intra-Abdominal Infections and Their Drug Resistance Profiles: An 11-Year (2011–2021) Single-Center Retrospective Study . Biomedical and Environmental Sciences, 2023, 36(8): 732-742. doi: 10.3967/bes2023.072
    [4] YU De E, XU Yu Jun, LI Mu, YANG Yuan, LIANG Hua Yue, ZHONG Shan Mei, QIN Cai, LAN Ya Nan, LI Da Wei, YU Ji Peng, PANG Yuan, QIN Xue Qiu, LIANG Hao, ZHU Kao Kao, YE Li, LIANG Bing Yu.  HIV-1 Subtype Diversity and Factors Affecting Drug Resistance among Patients with Virologic Failure in Antiretroviral Therapy in Hainan Province, China, 2014–2020 . Biomedical and Environmental Sciences, 2023, 36(9): 800-813. doi: 10.3967/bes2023.077
    [5] MENG Shuang, MIAO Bei Bei, LI Jie, YIN Jian Wen, LIU Ze Liang, JIANG Xue Qi, GONG Xin Yi, LI Juan.  Isolation of Leclercia adecarboxylata Producing Carbapenemases in A Newborn Female . Biomedical and Environmental Sciences, 2023, 36(9): 874-879. doi: 10.3967/bes2023.104
    [6] SHI Da Wei, WANG Dong Mei, NING Li Hua, LI Jing, DONG Yan, ZHANG Zhi Kun, DOU Hai Wei, WAN Rui Jie, JIA Chun Mei, XIN De LI.  Using 16S rDNA Sequencing Technology to Preliminarily Analyze Intestinal Flora in Children with Mycoplasma pneumoniae Pneumonia . Biomedical and Environmental Sciences, 2022, 35(6): 528-537. doi: 10.3967/bes2022.070
    [7] LIU Chun Fa, SONG Yi Meng, HE Ping, LIU Dong Xin, HE Wen Cong, LI Yan Ming, ZHAO Yan Lin.  Evaluation of Multidrug Resistant Loop-mediated Isothermal Amplification Assay for Detecting the Drug Resistance of Mycobacterium tuberculosis . Biomedical and Environmental Sciences, 2021, 34(8): 616-622. doi: 10.3967/bes2021.085
    [8] YIN Yue Qi, LU Jing, ZHOU Ying, SHI Ling En, YUAN De Fu, CHEN Jian Shuang, XUAN Yan, HU Hai Yang, ZHANG Zhi, XU Xiao Qin, FU Geng Feng, WANG Bei.  Drug Resistance to HIV-1 Integrase Inhibitors among Treatment-naive Patients in Jiangsu, China . Biomedical and Environmental Sciences, 2021, 34(5): 400-403. doi: 10.3967/bes2021.053
    [9] DOU Hai Wei, TIAN Xiu Jun, XIN De Li, WEI Ran, ZHOU Wei, WANG Hong, QIN Xuan Guang, SHAO Jun Yan, XU Bao Ping, GE Li Xia, SHI Da Wei.  Mycoplasma pneumoniae Macrolide Resistance and MLVA Typing in Children in Beijing, China, in 2016: Is It Relevant? . Biomedical and Environmental Sciences, 2020, 33(12): 916-924. doi: 10.3967/bes2020.125
    [10] XIE Na, CHEN Zhao Yun, CHEN Tao, ZHU Bing Qing, XU Li, GAO Yuan, ZHANG Ai Yu, ZHAO Pan, LIU Ji Wen, SHAO Zhu Jun.  A Cross-sectional Survey Assessing Carriage of Streptococcus pneumoniae in a Healthy Population in Xinjiang Uygur Autonomous Region of China . Biomedical and Environmental Sciences, 2018, 31(3): 233-237. doi: 10.3967/bes2018.029
    [11] LI Fu, LI Gui Lian, PANG Hui, LIU Hai Can, XIAO Tong Yang, LI Shuang Jun, LUO Qiao, JIANG Yi, WANG Rui Bai, WAN Kang Lin.  Preliminary Study on Drug Susceptibility Profile and Resistance Mechanisms to Macrolides of Clinical Isolates of Non-tuberculous Mycobacteria from China . Biomedical and Environmental Sciences, 2018, 31(4): 290-299. doi: 10.3967/bes2018.037
    [12] XIAO Hong Li, XIN De Li, WANG Yan, CUI Li Jian, LIU Xiao Ya, LIU Song, SONG Li Hong, LIU Chun Ling, YIN Cheng Hong.  Establishment of a Predictive Diagnostic Model for Acute Mycoplasma Pneumoniae Infection in Elderly Patients with Community-acquired Pneumonia . Biomedical and Environmental Sciences, 2017, 30(7): 540-544. doi: 10.3967/bes2017.072
    [13] LI Shao Li, SUN Hong Mei, ZHU Bao Li, LIU Fei, ZHAO Han Qing.  Whole Genome Analysis Reveals New Insights into Macrolide Resistance in Mycoplasma pneumoniae . Biomedical and Environmental Sciences, 2017, 30(5): 343-350. doi: 10.3967/bes2017.045
    [14] WU Jing, NORRIS Jessie, LIU Hui Xin, LI Zheng, SU Ying Ying, ZHU Lin, WANG Ning.  The Prevalence of HIV Drug Resistance among Treatment-failure Individuals and Treatment-na?ve Individuals in China:A Meta-analysis . Biomedical and Environmental Sciences, 2014, 27(11): 858-871. doi: 10.3967/bes2014.123
    [15] PANG Hui, TONG Jing, LIU Hai Can, DU Yang Guang, ZHAO Xiu Qin, JIANG Yi, WU Xiao Cui.  Molecular Characterization and Drug-resistance of Mycobacterium tuberculosis Strains in Xuzhou, China . Biomedical and Environmental Sciences, 2014, 27(12): 960-964. doi: 10.3967/bes2014.136
    [16] ZHU JingYuan, DUAN GuangCai, YANG HaiYan, FAN QingTang, XI YuanLin.  Multi-drug Resistance and Characteristic of Integrons in Shigella spp.Isolated from China . Biomedical and Environmental Sciences, 2011, 24(1): 56-61. doi: 10.3967/0895-3988.2011.01.007
    [17] YA-LI BEN, GU-ZHEN CUI, CHEN LI, RUI HAN, JIE ZHANG, QING-YE ZHANG, JIAN WAN, DE-LI LIU.  Expression,Purification,Characteristics and Homology Modeling of the HMGS from Streptococcus pneumoniae . Biomedical and Environmental Sciences, 2009, 22(3): 229-236.
    [18] JIAN-LONG WANG, ZE-YU MAO, WEI-ZHONG WU.  Microbial Degradation of Aniline by Bacterial Consortium . Biomedical and Environmental Sciences, 2003, 16(4): 398-404.
    [19] Wei CAO, Jin Zuo, Yan Meng, QIANG Wei, ZHAO-HU SHI, LI-MEI JU, FU-DE FANG.  Anticancer Drug Resistance of HeLa Cells Transfected With Rat Glutathione S-transferase pi Gene . Biomedical and Environmental Sciences, 2003, 16(2): 157-162.
    [20] LIN BIN, HENK W.VAN VERSEVELD, WILFRED F.M.R(O)LING.  Microbial Aspects of Anaerobic BTEX Degradation . Biomedical and Environmental Sciences, 2002, 15(2): 130-144.
  • 加载中
计量
  • 文章访问数:  3319
  • HTML全文浏览量:  1308
  • PDF下载量:  112
  • 被引次数: 0
出版历程
  • 收稿日期:  2016-12-16
  • 录用日期:  2017-04-15
  • 刊出日期:  2017-07-01

A Five-year Surveillance of Carbapenemase-producing Klebsiella pneumoniae in a Pediatric Hospital in China Reveals Increased Predominance of NDM-1

doi: 10.3967/bes2017.075
    基金项目:

    Beijing Municipal Science and Technology Project D131100005313014

    Scientific Research Project of Beijing Children's Hospital 2012MS08

    作者简介:

    DONG Fang, female, born in 1970, MM, majoring in microbiology and bacterial resistance

    通讯作者: SONG Wen Qi, E-mail:songwqbch@163.com

English Abstract

DONG Fang, LU Jie, WANG Yan, SHI Jin, ZHEN Jing Hui, CHU Ping, ZHEN Yang, HAN Shu Jing, GUO Yong Li, SONG Wen Qi. A Five-year Surveillance of Carbapenemase-producing Klebsiella pneumoniae in a Pediatric Hospital in China Reveals Increased Predominance of NDM-1[J]. Biomedical and Environmental Sciences, 2017, 30(8): 562-569. doi: 10.3967/bes2017.075
Citation: DONG Fang, LU Jie, WANG Yan, SHI Jin, ZHEN Jing Hui, CHU Ping, ZHEN Yang, HAN Shu Jing, GUO Yong Li, SONG Wen Qi. A Five-year Surveillance of Carbapenemase-producing Klebsiella pneumoniae in a Pediatric Hospital in China Reveals Increased Predominance of NDM-1[J]. Biomedical and Environmental Sciences, 2017, 30(8): 562-569. doi: 10.3967/bes2017.075
    • Klebsiella pneumoniae (K. pneumoniae) is a common opportunistic pathogen of community and healthcare associated infections[1]. Multidrug-resistant K. pneumoniaeis spreading globally and producing serious infections associated with septicemia, pnumonia, urinarytract infection, intra-abdominal infection, and bacterial meningitis[2]. However, there are very limited therapeutic options available for multidrug-resistant K. pneumoniae, causing an unprecedented public health crisis[2-3].

      As a useful therapeutic agent, carbapenems (CPMs) play an important role in treating infections of multidrug-resistant K. pneumoniae, particularly those carrying genes for extended-spectrumβ-lactamases[4]. However, with therapeutic use of CPMs in hospitals, CPM-resistant K. pneumoniae has also been emergent and increased rapidly[5-6]. Resistance to CPMs of K. pneumoniae typically involves several mechanisms, and the production of carbapenemases (CPMases) is an important one[7-9]. Besides CPM, CPMases can also hydrolyze the majority of β-lactam antibiotics, including penicillins, cephalosporins and cephamycins. Traditionally, CPMases have been assigned to Ambler classes A (KPC-type), B (MBL), and D (OXA-type)[2, 10]. The CPMases were encoded by CPMase-producing genes, such as blaIMP, blaVIM, blaKPC[2].

      Recently, spread of CPMase-producing K. pneumoniae has been reported worldwide, and the phenotypic and genotypic characteristics of the strains from many countries have been identified[2, 8-9]. However, the phenotypic and genotypic studies on clinical isolates of CPMase-producing K. pneumoniae in China were very few and all of these investigations were performed in a very short period[11-13]. Herein, we conducted a five-year surveillance of CPMase-producing K. pneumoniae in one of the most famous children's hospitals of China, to reveal both phenotypic and genotypic characteristics of clinical isolates of CPMase-producing K. pneumoniae from pediatric patients between 2010 and 2014. Our results demonstrated that a more resistant genotypic subtype, namely New Delhi-Metallo-1 (NDM-1), were gradually increasing and becoming predominant in the pediatric patients, which deserved the attention of both pediatricians and public health officials.

    • Beijing Children's Hospital, Capital Medical University, is a general pediatric teaching hospital with 970 beds. The hospital has more than 70, 000 admissions per year. All the patients were recruited as inpatients in Beijing Children's Hospital from January 2010 to December 2014.

    • 1, 730 strains of K. pneumoniae were isolated from nasopharyngeal secretions, tracheal aspirations, blood, pus secretions, mid-stream catheterized urine, pleural effusions, catheter and ascites. Routine methods and the Phoenix100 automated microbiology analyzer (BD Research Inc. USA) were employed to identify the bacterial strains.

    • The CPM-non-susceptible isolates of K. pneumoniae were identified by disk diffusion method using imipenem or meropenem disks. Zone Diameter ≤ 22 mm was defined as non-susceptible to the drugs.

    • Phenotypic test for the CPMase-producing strains was conducted by using the modified Hodge test and the double-disk synergy test (imipenem/ imipenem+EDTA and meropenem/meropenem+ EDTA).

    • The Minimal Inhibition Concentration (MIC) values for 15 antibiotics were determined by a broth microdilution method (BD Research Inc. USA). The antibiotics were as follows: ampicillin, cefazolin, cefotaxime, ceftazidime, cefepime, aztreonam, amoxicillin-clavulanic, piperacillin-tazobactam, imipenem, meropenem, trimethoprim-sulfamethoxazole, gentamicin, amikacin, ciprofloxacin, and colistin. The interpretive break points of Clinical and Laboratory Standards Institute (CLSI) M100-S24 were used to interpret the MIC results for antimicrobial agents[14]. The Escherichia coli ATCC25922 and K. pneumoniae ATCC BAA-1705 strains were adopted as the standards for quality control (QC). WHONET 5.6 software (http://www.whonet.org/) was used to perform resistance analysis.

    • To detect CPMase-producing genes in the CPM-non-susceptible strains, PCR amplification was performed on a PTC-100-type PCR instrument (MJ Research Inc. USA). The CPMase-producing genes included blaIMP, blaVIM, blaSPM, blaGIM, blaNDM-1, blaSIM, blaKPC, blaGES, blaIMI/NMC-A, blaSME, and blaOXA, and the primers were shown in Table 1 [12, 15-17]. The reaction system (total volume, 50 µL) consisted of: PCR Master Mix (2 × PCR buffer, 3 mmol/L Mg2+, 200 µmol/L dNTPs, and 0.1 U Taq DNA polymerase), 50 pmol each of the two primers, and DNA template obtained by heating a bacterial suspension. The reaction conditions were as follows: pre-denaturation at 95 ℃ for 3 min, followed by 35 amplification cycles of 95 ℃ for 1 min, 55 ℃ for 1 min and 72 ℃ for 1 min, with a final extension step of 72 ℃ for 5 min.

      Table 1.  Primers used for PCR Amplification

      CPMase Sequence (5'to 3') Expected Size (bp)
      KPC15 P1: GCTACACCTAGCTCCACCTTC P2: GCATGGATTACCAACCACTGT 898
      GES15 P1: ATGCGCTTCATTCACGCAC P2: CTATTTGTCCGTGCTCAGG 591
      IMI/NMC-A15 P1: CAGAGCAAATGAACGATTTC P2: GGTACGCTAGCACGAATAC 879
      SME15 P1: GTGTTTGTTTAGCTTTGTCGGC P2: GCAATACGTGATGCTTCCGC 642
      IMP12 P1: GGAATAGAGTGGCTTAATTCTC P2: GTGATGCGTCYCCAAYTTCACT 361
      VIM12 P1: CAGATTGCCGATGGTGTTTGG P2: AGGTGGGCCATTCAGCCAGA 523
      GIM16 P1: TCGACACACCTTGGTCTGAA P2: AACTTCCAACTTTGCCATGC 477
      SPM16 P1: AAAATCTGGGTACGCAAACG P2: ACATTATCCGCTGGAACAGG 271
      SIM16 P1: TACAAGGGATTCGGCATCG P2: TAATGGCCTGTTCCCATGTG 570
      NDM-112 P1: CAGCACACTTCCTATCTC P2: CCGCAACCATCCCCTCTT 292
      OXA-51-like16 P1: TAATGCTTTGATCGGCCTTG P2: TGGATTGCACTTCATCTTGG 353
      OXA-23-like16 P1: GATCGGATTGGAGAACC GA P2: ATTTCTGACCGCATTTCCAT 501
      OXA-40-like16 P1: GGTTAGTTGGCCCCCTTA AA P2: AGTTGAGCGAAAAGGGGATT 246
      OXA-58-like16 P1: AAGTATTGGGGCTTGTGCTG P2: CCCCTCTGCGCTCTACATAC 599
      OXA-4817 P1: GCGTGGTTAAGGATGAACAC P2: CATCAAGTTCAACCCAACCG 438
      OXA-18117 P1: ATGCGTGTATTAGCCTTATCG P2: AACTACAAGCGCATCGAGCA 888

      The PCR products from the above reactions were purified and sequenced using the ABI PRISM TM377 with the dideoxy-mediated chain-termination method. Sequences obtained were compared with the preexisting sequences via NCBI BLAST to determine the type of CPMase. The nucleotide sequence containing the blaIMP-4, blaIMP-8, blaNDM-1, and blaKPC-2 open reading frame has been assigned the EMBO/GenBank accession number FJ384365.1, EU368856.1, and KP036457.1 and KR108243.1.

    • SPSS 12.0 was used to perform regression analysis. Trends of resistance rates to each antimicrobial agent for microorganisms were performed using Chi-square statistics. A P < 0.05 was considered statistically significant.

    • During 2010-2014, 1, 730 non-duplicated strains of K. pneumoniae were isolated from different inpatients in our hospital. Among those strains, 179 (10.3%) were identified as non-susceptible (Zone Diameter ≤ 22 mm) to imipenem or meropenem via disk-diffusion method. The percentages of non-susceptible isolates were lower than 10% between 2010 and 2012, namely 7.8% (28/358) in 2010, 8.9% (37/415) in 2011, 7.4% (28/379) in 2012. However, it increased to 11.2% (40/356) in 2013 and further increased to 20.7% (46/222) in 2014.

      The clinical features of CPM-non-susceptible K. pneumoniae isolates were shown in Table 2. The isolates were main obtained from Internal Medicine (39.7%, 71/179) and Haematology (29.6%, 53/179). Most of the patients were under 7 years old (76.0%, 136/179). The majority of the strains were isolated from tracheal aspirations (50.8%, 91/179) and blood (31.3%, 56/179). Notably, the isolates originated from blood increased from 14.2% to 41.3% during the study period.

      Table 2.  Clinical Features of the Carbapenemase-producing K. pneumoniae Strains

      Clinical Feature 2010(n = 28)n (%) 2011(n = 37)n (%) 2012(n = 28)n (%) 2013(n = 40)n (%) 2014(n = 46)n (%) Total(n= 179)n (%)
      Clinical units Internal medicine 11 (39.3) 24 (64.9) 8 (28.6) 14 (35.0) 14 (30.4) 71 (39.7)
      Haematology 6 (21.4) 9 (24.3) 8 (28.6) 15 (37.5) 15 (32.6) 53 (29.6)
      Intensive care unit 6 (21.4) 2 (5.4) 10 (35.6) 7 (17.5) 10 (21.8) 35 (19.6)
      Surgery 5 (17.9) 2 (5.4) 1 (3.6) 4 (10.0) 7 (15.2) 19 (10.6)
      Dermatology 0 0 1 (3.6) 0 0 1 (0.5)
      Gender Male 15 (53.6) 23 (62.6) 17 (60.7) 27 (67.5) 28 (60.9) 110 (61.5)
      Female 13 (46.4) 14 (37.4) 11 (39.3) 13 (32.5) 18 (39.1) 69 (38.5)
      Years < 1 m 2 (7.1) 5 (13.5) 6 (21.4) 3 (7.5) 2 (4.3) 18 (10.0)
      1 m-1 y 12 (42.9) 16 (43.3) 8 (28.6) 17 (42.5) 18 (39.1) 71 (39.7)
      1-6 y 9 (32.2) 8 (21.6) 5 (17.9) 8 (20.0) 17 (37.0) 47 (26.3)
      7-12 y 2 (7.1) 4 (10.8) 9 (32.1) 8 (20.0) 8 (17.4) 31 (17.3)
      > 12 y 3 (10.7) 4 (10.8) 0 4 (10.0) 1 (2.2) 12 (6.7)
      Specimen site Tracheal aspirations 16 (57.2) 24 (64.9) 14 (50.0) 17 (42.5) 20 (43.5) 91 (50.8)
      Blood 4 (14.2) 7 (18.9) 10 (35.6) 16 (40.0) 19 (41.3) 56 (31.3)
      Midstream urine 4 (14.2) 4 (10.8) 1 (3.6) 2 (5.0) 3 (6.5) 14 (7.8)
      Pus secretions 1 (3.6) 1 (2.7) 1 (3.6) 4 (10.0) 1 (2.2) 8 (4.5)
      Nasopharyngeal secretions 1 (3.6) 1 (2.7) 0 1 (2.5) 3 (6.5) 6 (3.4)
      Catheter 2 (7.2) 0 1 (3.6) 0 0 3 (1.7)
      Ascites 0 0 1 (3.6) 0 0 1 (0.5)
    • Phenotypic analysis based on modified Hodge test and double-disk synergy test showed that none of CPM-non-susceptible isolates of K. pneumoniae had negative results in both tests, indicating all of the 179 isolates were CPMase producers. Among them, 152 (84.9%) strains were positive in the modified Hodge test and 174 (97.2%) positive in the double-disk synergy test.

      The results of the disk-diffusion experiments showed that 156 (87.1%) of K. pneumoniae isolates were meropenem resistant, 122 (68.1%) exhibited imipenem resistance, and 120 (67.0%) were resistant to both imipenem and meropenem.

      The results of broth microdilution experiments conducted for all of the 179 isolates were shown in Table 3. The isolates demonstrated very high resistance rates against ampicillin (100%), cefazolin (100%), cefotaxime (100%), amoxicillin-clavulanic (100%), and ceftazidime (99.4%). There were only two drugs with susceptibility rates higher than 50%, namely amikacin (88.2%) and ciprofloxacin (65.9%). An increase of resistance was seen for imipenem and meropenem from 14.3% to 89.1% and from 67.9% to 100%, respectively. No isolate of K. pneumoniae was found resistant to colistin.

      Table 3.  Antimicrobial Resistance Profiles of K. pneumoniae Strains during the Study Period

      Antibiotics Total (n = 179) 2010 (n = 28) 2011 (n = 37) 2012 (n = 28) 2013 (n = 40) 2014 (n = 46)
      %R %I %R %I %R %I %R %I %R %I %R %I
      AM 100 0 100 0 100 0 100 0 100 0 100 0
      CZ 100 0 100 0 100 0 100 0 100 0 100 0
      CTX 100 0 100 0 100 0 100 0 100 0 100 0
      CAZ 99.4 0.6 100 0 97.3 2.7 100 0 100 0 100 0
      FEP 89.4 7.8 75.0 10.7 91.9 8.1 92.9 3.6 87.5 12.5 95.7 4.3
      ATM 86.6 0 96.4 0 64.9 0 82.1 0 87.5 0 84.8 0
      AMC 100 0 100 0 100 0 100 0 100 0 100 0
      TZP 67.0 13.4 75.0 25.0 48.6 21.6 67.9 10.7 67.5 7.5 76.1 6.5
      IMP 68.2 26.8 14.3 71.4 62.2 29.7 87.5 7.1 75.0 25.0 89.1 10.9
      MEN 87.2 8.4 67.9 17.9 70.3 21.6 100 0 92.5 5.0 100 0
      STX 76.0 0.6 75.0 0 75.7 0 85.7 3.6 82.5 0 65.2 0
      GEN 68.7 1.1 50.0 0 70.3 2.7 75.0 3.6 65.0 0 67.4 0
      ANK 10.1 1.7 7.1 3.6 18.9 5.4 10.7 0 25.0 0 10.9 0
      CIP 20.7 13.4 28.6 0 25.0 5.6 25.0 28.6 15.0 25.0 15.2 8.7
      CL 0 0 0 0 0 0 0 0 0 0 0 0
        Note.AM, Ampicillin; CZ, Cefazolin; CTX, Cefotaxime; CAZ, Ceftazidime; FEP, Cefepime; ATM, Aztreonam; AMC, Amoxicillin-clavulanic; TZP, Piperacillin-Tazobactam; IMP, Imipenem; MEN, Meropenem; STX, Trimethoprim-sulfamethorazole; GEN, Gentamicin; ANK, Amikacin; CIP, Ciprofloxacin; CL, Colistin; R, resistant, I, intermediate.
    • The PCR results showed that 166 (92.7%) strains harbored the CPMase-producing genes detected in this study. The blaIMP and blaNDM-1genes were present in 95 (57.2%) and 65 (39.2%) strains, respectively, and the other 6 (3.6%) strains had blaKPCgene.

      Subsequent sequencing of the 166 PCR-positive strains further identified the genotypes of the respective CPMase genes. Among the 95 strains harboring the blaIMP gene, 92 (96.8%) and 3 (3.2%) strains were IMP-4 and IMP-8 producers, respectively. The sequencing results also confirmed that the 65 strains with PCR positive results of blaNDM-1 gene were NDM-1 producers. In addition, all sequenced KPC producers (6 strains) had blaKPC-2 gene.

      During our study period from 2010 to 2014, the most predominant CPMase-producing isolates were IMP-4 producers (51.4%, 92/179). NDM-1 producer also occupied a very large percentage (36.3%, 65/179). Only 3.4% (6/179) and 1.7% (3/179) were IMP-8 and KPC-2 producers, respectively. The annual distributions revealed an increase of NDM-1 producers and decrease of IMP-4 producers from 2010 to 2014 (Table 4).

      Table 4.  Distribution of Different Genotypes from 2010 to 2014

      Genotype 2010 (n = 28)n(%) 2011 (n = 37)n(%) 2012 (n = 28)n(%) 2013 (n = 40)n(%) 2014 (n = 46)n (%) Total (n = 179)n(%)
      IMP-4 type 21 (75.0) 29 (78.4) 14 (50.0) 15 (37.5) 13 (28.3) 92 (51.4)
      IMP-8 type 3 (10.8) 0 0 0 0 3 (1.7)
      NDM-1 type 2 (7.1) 4 (10.8) 11 (39.3) 19 (47.5) 29 (63.0) 65 (36.3)
      KPC-2 -type 0 1 (2.7) 0 2 (5.0) 3 (6.5) 6 (3.4)
      Undetermined 2 (7.1) 3 (8.1) 3 (10.7) 4 (10.0) 1 (2.2) 13 (7.2)

      The results of broth microdilution experiments indicated that different CPMase producers had different profiles of antimicrobial resistance (Table 5). Compare to IMP-4 producers, the isolates from KPC-2 producers had higher resistant rates frequencies in terms of resistance to imipenem (P = 0.017), amikacin (P = 0.010) and ciprofloxacin (P= 0.013). There were also significant differences in the frequencies of drug resistance between the isolates from NDM-1 producers and IMP-4 producers for piperacillin-tazobactam (P = 0.000), imipenem (P = 0.000) and meropenem (P = 0.000). The isolates from KPC-2 producers and NDM-1 producers had significantly higher rates of drug resistance to antibiotics than those from the IMP-4 producers (P < 0.05).

      Table 5.  Antimicrobial Resistance Profiles of Different Genotypes of K. pneumoniae Strains

      Antimicrobial Agent IMP-4 type (92) IMP-8 type (3) NDM-1 type (65) KPC type (6) Undetermined (13)
      %R %I %R %I %R %I %R %I %R %I
      AM 100 0 100 0 100 0 100 0 100 0
      CZ 100 0 100 0 100 0 100 0 100 0
      CTX 100 0 100 0 100 0 100 0 100 0
      CAZ 98.9 1.1 100 0 100 0 100 0 100 0
      FEP 82.6 13.0 66.7 33.3 100 0 100 0 84.6 7.7
      ATM 84.8 0 100 0 89.2 0 100 0 69.2 0
      AMC 100 0 100 0 100 0 100 0 100 0
      TZP 46.7 18.5 100 0 89.2 7.7 83.3 16.7 76.9 7.7
      IMP 50.0 42.4 0 66.7 96.9 3.1 100 0 53.9 38.4
      MEN 78.3 16.3 66.7 0 100 0 100 0 84.6 0
      STX 69.6 0 33.3 0 84.6 1.5 66.7 0 84.6 0
      GEN 64.1 1.1 66.7 0 72.3 1.5 83.3 0 76.9 0
      ANK 12.0 2.2 0 0 4.6 1.5 50 0 7.7 0
      CIP 21.7 9.8 33.3 0 10.8 21.5 66.7 0 30.8 7.7
      CL 0 0 0 0 0 0 0 0 0 0
        Note.AM, Ampicillin; CZ, Cefazolin; CTX, Cefotaxime; CAZ, Ceftazidime; FEP, Cefepime; ATM, Aztreonam; AMC, Amoxicillin-clavulanic; TZP, Piperacillin-Tazobactam; IMP, Imipenem; MEN, Meropenem; STX, Trimethoprim-sulfamethorazole; GEN, Gentamicin; ANK, Amikacin; CIP, Ciprofloxacin; CL, Colistin. R, resistant, I, intermediate.
    • As useful antimicrobial agents, the β-lactam antibiotics play an important role in treating infection in the pediatric population, in which, CPMs have the broadest spectrum and greatest stability against hydrolysis by β-lactamases[4]. CPMs have been regarded as a dependable drug for treating K. pneumoniae infections. However, with its increasing clinical usage, CPM-resistant K. pneumoniae are becoming more and more pervasive throughout the world[18], but few phenotypic and genotypic investigations on CPM-resistance K. pneumoniae has been reported in China[11-13]. This is the first study describing the 5-year prevalence of CPM-non-susceptible K. pneumoniae and their genetic characteristics responsible for CPMase production in a pediatric hospital in China.

      Our study showed that the percentages of CPM-non-susceptible K. pneumoniae increased from 7.8% in 2010 to 20.7% in 2014 in our hospital. In addition, an increase in resistance was observed for imipenem and meropenem in our study, which is similar to the CHINET (antimicrobial resistance surveillance network in China) data[19]. Furthermore, we compared our data and the data from the children's hospitals in CHINET[20]. The increasing trend of drug resistant rates of imipenem and meropenem are similar, but the resistant rates against imipenem and meropenem varied in different hospitals and the rates in our hospital are higher than the others[20-22]. The possible interpretation for this difference is that patients in different hospitals have different clinical needs, which leads to different prescribing habits of doctors in different hospitals. Because most patients in our hospital have been treated in other hospital before and have limited antibiotic choices, imipenem and meropenem might be utilized more frequently in our hospital, resulting in higher resistant rates of these drugs.

      The most common mechanism for CPM resistance is the production of CPMases. In recent years, there have been many reports of CPMase-producing K. pneumoniae worldwide and the main types of CPMases reported in Asia and Europeare are IMP, VIM, and NDM[9, 23-24]. Two genotypes, namely IMP-4 and IMP-8, are prevalent in China[25-26]. In our hospital, IMP-4 type K. pneumoniae was the predominant genotype from 2010 to 2012, but NDM-1 genotype became the predominant one in 2013 and 2014. NDM-1 type strains have been recently described and are calling more and more attentions because of its resistance to most antibiotics[27-29].

      In the present study, the CPM-non-susceptible K. pneumoniae isolates showed a high rate of drug resistance to β-lactam antibiotics except aztreonam and piperacillin-tazobactam. It is worthwhile to note that 179 nosocomial K. pneumoniae isolates from selected pediatric departments have high rates of intermediate and resistance to CPM. The frequencies of resistance to imipenem and meropenem were 68.2% and 87.2%, and the rates of the intermediate to them were 26.8% and 8.4%, respectively. Therefore, it is suggested that imipenem and meropenem should be assessed at one time in order to find more CPM-non-susceptible K. pneumoniae. The CPM-non-susceptible K. pneumoniae isolates in our study showed the lowest resistance to amikacin (10.1%), followed by ciprofloxacin (20.7%), which may be due to these two drugs were rarely used in children because of their major side-effects.

      In summary, the present study is generally to report on the characteristics of CPM-non-susceptible K. pneumoniae isolates from a pediatric hospital in China. The production of MBL, including two genotypes IMP and NDM, is one of the important mechanisms of CPM-non-susceptible of K. pneumoniae isolates in our pediatric setting. It is necessary to strengthen the surveillance of drug resistance and to gain an understanding of the characteristics and mechanisms of CPM-non-susceptible K. pneumoniae infections among the local pediatric population, which may help us better understand the prevalence of CPMase-producing K. pneumoniae and contribute to effective controls of the drug-resistant strains in pediatric clinics.

    • We are grateful to all members of Beijing Children's Hospital for their cooperation and technical help.

    • Protocol was approved by Ethics Committee of Beijing Children's Hospital, Capital Medical University. Informed consent was waived because we used existed strains and did not pose risk to patients.

参考文献 (29)

目录

    /

    返回文章
    返回