Association between Mitochondrial DNA Methylation and Hypertension Risk: A Cross-sectional Study in Chinese Northern Population

ZHAO Lei JIA Ya Ning LIU Qi Si Jing LIU Zi Quan LIN Hui Shu SHUI Xin Ying GUO Li Qiong HOU Shi Ke

ZHAO Lei, JIA Ya Ning, LIU Qi Si Jing, LIU Zi Quan, LIN Hui Shu, SHUI Xin Ying, GUO Li Qiong, HOU Shi Ke. Association between Mitochondrial DNA Methylation and Hypertension Risk: A Cross-sectional Study in Chinese Northern Population[J]. Biomedical and Environmental Sciences, 2023, 36(10): 972-978. doi: 10.3967/bes2023.122
Citation: ZHAO Lei, JIA Ya Ning, LIU Qi Si Jing, LIU Zi Quan, LIN Hui Shu, SHUI Xin Ying, GUO Li Qiong, HOU Shi Ke. Association between Mitochondrial DNA Methylation and Hypertension Risk: A Cross-sectional Study in Chinese Northern Population[J]. Biomedical and Environmental Sciences, 2023, 36(10): 972-978. doi: 10.3967/bes2023.122

doi: 10.3967/bes2023.122

Association between Mitochondrial DNA Methylation and Hypertension Risk: A Cross-sectional Study in Chinese Northern Population

Funds: This research was supported by The Scientific Research Translational Foundation of Wenzhou Safety [Emergency] Institute of Tianjin University [TJUWYY2022019, TJUWYY2023001]; Fundamental Research Funds for the Central Universities, Nankai University [NO. 63221058]; Natural Science Foundation of Tianjin Science and Technology Program [21JCYBJC00830]; Tianjin Research Innovation Project for Postgraduate Students [2021YJSB193].
More Information
    Author Bio:

    ZHAO Lei, male, born in 1994, PhD, majoring in environmental pollution and human health

    JIA Ya Ning, female, born in 1997, Master, majoring in environmental health

    Corresponding author: GUO Li Qiong, PhD, Tel: 86-22-27893596, E-mail: yingqidao@163.comHOU Shi Ke, PhD, Tel: 86-22-27893596, E-mail: houshike@tju.edu.cn
  • L. Zhao: Investigation, and writing of the original draft. Y. Jia: Investigation, writing, review, and editing. Q. Liu: Supervision, and conceptualization. Z. Liu: Investigation, writing, review, and editing. H. Lin: Wrote, reviewed, and edited the manuscript. X. Shui: Investigation. L. Guo: Conceptualization, investigation, supervision, and funding. S. Hou: Conceptualization, investigation, and supervision.
  • &These authors contributed equally to this work.
  • L. Zhao: Investigation, and writing of the original draft. Y. Jia: Investigation, writing, review, and editing. Q. Liu: Supervision, and conceptualization. Z. Liu: Investigation, writing, review, and editing. H. Lin: Wrote, reviewed, and edited the manuscript. X. Shui: Investigation. L. Guo: Conceptualization, investigation, supervision, and funding. S. Hou: Conceptualization, investigation, and supervision.
    &These authors contributed equally to this work.
    注释:
    1) CRediT Authorship Contribution Statement:
  • S1.  Odds ratios of risk factors for hypertension.

    S1.   The pyrosequencing primer sequence

    Gene Primer Sequence
    MT-COX1 Forward primer
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TATTAATTGGTTTTTTAGGGTTTAT
    CAACAAATCATTTCATATTACTTCC
    TATTTATAGTAGGAAT
    MT-COX2 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TTTATGAGTTGTTTTTATATTAGGTTTAAA
    ACTCCACAAATTTCAAAACATTAAC
    TAAAAATAGATGTAAT
    MT-COX3 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TATATTATTTGTTTAAAAAGGTTTT
    AATAAAAAACTCAAAAAAATCCTAC
    TATATTATTTGTTTAAAAAGGTTTT
    MT-ATP6 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TTATAAATTTAGTTATGGTTATTTTTTTAT
    AAACTAAAACATTTTTAATCTTAAAAC
    TTATAAATTTAGTTATGGTTATTTTTTTAT
    MT-ATP8 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    AAATTATAATAAATTTTGAGAATTAAAATG
    AATAAACCTAAAATTATAAAAACAATAAAT
    AAATTATAATAAATTTTGAGAATTAAAATG
    下载: 导出CSV

    Table  1.   Characteristics of included subjects

    VariablesAll participants
    (N = 620)
    Hypertension group
    (N = 337)
    Control group
    (N = 283)
    z/χ2P value
    Age (years)58.97 (12.18)61.74 (11.41)57.52 (12.36)−6.30< 0.01
    Male, n (%)567 (91.5)312 (92.6)255 (90.1)1.210.27
    BMI25.19 (3.70)25.65 (4.09)24.51 (3.42)−4.33< 0.01
    Smoking, n (%)271 (43.7)158 (46.9)113 (39.9)3.730.16
    Drinking, n (%)239 (38.5)137 (40.7)102 (36.0)1.380.24
    Exercise, n (%)97 (15.6)63 (18.7)34 (12.0)5.200.02
    Education, n (%)90 (14.5)45 (13.4)45 (15.9)0.810.37
    SBP (mmHg)142.78 (23.83)152.00 (19.67)128.83 (14.92)−20.75< 0.01
    DBP (mmHg)83.62 (13.33)88.00 (15.33)79.33 (9.92)−12.91< 0.01
    FBG (mmol/L)6.23 (1.33)5.79 (1.41)5.47 (1.10)−4.56< 0.01
    TG (mmol/L)1.67 (0.98)1.34 (1.10)1.16 (0.92)−3.49< 0.01
    TC (mmol/L)5.18 (1.23)5.19 (1.30)5.05 (1.27)−2.01< 0.05
    HDL-C (mmol/L)1.45 (0.49)1.40 (0.51)1.34 (0.48)−0.810.12
    LDL-C (mmol/L)3.03 (0.83)3.08 (0.87)2.96 (0.79)−1.770.08
    Family history, n (%)14 (2.3)11 (3.3)3 (1.1)3.340.07
      Note. Continuous variables that did not conform to the normal distribution were described as medians and interquartile ranges, and differences between the two groups were compared using the Mann-Whitney U test. Categorical variables are presented as frequencies and percentages, and the differences between the two groups were compared using the chi-square test. MT-COX1 represents the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2. MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 represents the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2; SBP, systolic blood pressure;DBP, diastolic blood pressure; FBG, fasting blood glucose; TG, triglyceride; TC, total cholesterol; HDL-C, high-density lipoproteincholesterol; HDL-C, low-density lipoproteincholesterol.
    下载: 导出CSV

    Table  2.   Comparison of MtDNA methylation level between hypertension group and control group

    Loci All participates
    Median (IQR)
    Hypertension group
    Median (IQR)
    Control group
    Median (IQR)
    Z value P value
    MT-COX1Pos.1 10.64 (4.92) 9.47 (4.18) 9.98 (6.39) −2.17 0.03
    MT-COX1Pos.2 7.75 (3.21) 7.80 (2.88) 7.68 (3.68) −0.99 0.32
    MT-COX1 9.40 (3.97) 8.72 (3.26) 8.96 (4.89) −1.01 0.31
    MT-COX2 5.56 (2.63) 5.60 (2.61) 5.50 (2.64) −0.55 0.58
    MT-COX3Pos.1 4.64 (1.76) 4.83 (1.56) 4.31 (1.87) −3.72 < 0.01
    MT-COX3Pos.2 3.79 (1.32) 3.80 (1.17) 3.78 (1.51) −0.21 0.83
    MT-COX3 4.23 (1.32) 4.31 (1.18) 4.09 (1.56) −2.10 0.04
    MT-ATP6Pos.1 17.65 (5.35) 17.65 (5.06) 17.73 (5.87) −1.32 0.19
    MT-ATP6Pos.2 10.84 (3.94) 10.65 (3.97) 11.25 (3.91) −0.97 0.33
    MT-ATP6Pos.3 13.33 (5.91) 13.11 (5.73) 13.58 (5.89) −0.98 0.33
    MT-ATP6 13.95 (4.43) 13.73 (4.11) 14.10 (4.99) −2.17 0.23
    MT-ATP8Pos.1 6.82 (4.11) 6.44 (4.10) 7.18 (3.92) −2.72 < 0.01
    MT-ATP8Pos.2 6.48 (3.60) 6.05 (3.61) 6.93 (3.42) −2.82 < 0.01
    MT-ATP8 6.68 (3.76) 6.26 (3.81) 6.96 (3.68) −2.81 < 0.01
      Note. MT-COX1 represents the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2. MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 represents the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.
    下载: 导出CSV

    Table  3.   Association between MtDNA methylation level stratification and hypertension

    Loci Unadjusted model Adjusted model
    β value OR (95% CI) P value β value OR (95% CI) P value
    MT-COX1Pos.1
    Low level 1.00 1.00
    Middle level −0.16 0.85 (0.58–1.26) 0.42 −0.12 0.89 (0.58–1.35) 0.57
    High level −0.43 0.65 (0.44–0.96) 0.03 −0.40 0.67 (0.44–1.02) 0.06
    MT-COX1Pos.2
    Low level 1.00 1.00
    Middle level 0.46 1.58 (1.07–2.33) 0.02 0.30 1.35 (0.89–2.07) 0.16
    High level 0.19 1.20 (0.82–1.77) 0.35 −0.25 0.78 (0.51–1.21) 0.27
    MT-COX1
    Low level 1.00 1.00
    Middle level 0.31 1.37 (0.92–2.02) 0.12 0.21 1.24 (0.81–1.89) 0.33
    High level −0.28 0.75 (0.51–1.11) 0.15 −0.45 0.64 (0.42–0.98) 0.04
    MT-COX2
    Low level 1.00 1.00
    Middle level 0.09 1.09 (0.74–1.60) 0.66 −0.05 0.96 (0.63–1.45) 0.83
    High level 0.17 1.18 (0.80–1.75) 0.40 −0.05 0.95 (0.62–1.46) 0.82
    MT-COX3Pos.1 1
    Low level 1.00 1.00
    Middle level 0.45 1.56 (1.06–2.30) 0.02 0.08 1.08 (0.69–1.68) 0.74
    High level 0.76 2.14 (1.44–3.18) < 0.001 0.03 1.03 (0.63–1.69) 0.90
    MT-COX3Pos.2
    Low level 1.00 1.00
    Middle level 0.43 1.54 (1.04–2.27) 0.03 0.26 1.30 (0.84–2.01) 0.24
    High level 0.10 1.10 (0.75–1.62) 0.62 −0.06 0.94 (0.61–1.44) 0.78
    MT-COX3
    Low level 1.00 1.00
    Middle level 0.52 1.69 (1.14–2.49) < 0.001 0.33 1.38 (0.90–2.13) 0.14
    High level 0.47 1.60 (1.08–2.36) 0.02 0.01 1.01 (0.64–1.59) 0.98
    MT-ATP6Pos.1
    Low level 1.00 1.00
    Middle level 0.14 1.14 (0.78–1.69) 0.49 0.29 1.33 (0.87–2.04) 0.19
    High level −0.14 0.87 (0.59–1.29) 0.17 0.15 1.17 (0.76–1.78) 0.48
    MT-ATP6Pos.2
    Low level 1.00 1.00
    Middle level −0.10 0.91 (0.61–1.33) 0.61 −0.25 0.78 (0.51–1.20) 0.26
    High level −0.20 0.82 (0.56–1.21) 0.32 −0.35 0.71 (0.46–1.09) 0.11
    MT-ATP6Pos.3
    Low level 1.00 1.00
    Middle level 0.08 1.08 (0.73–1.59) 0.70 0.16 1.17 (0.77–1.79) 0.47
    High level −0.20 0.82 (0.59–1.21) 0.32 −0.10 0.90 (0.59–1.37) 0.63
    MT-ATP6
    Low level 1.00 1.00
    Middle level −0.03 0.97 (0.66–1.43) 0.87 0.03 1.03 (0.67–1.57) 0.89
    High level −0.21 0.83 (0.55–1.20) 0.30 −0.13 0.88 (0.58–1.34) 0.56
    MT-ATP8Pos.1
    Low level 1.00 1.00
    Middle level −0.54 0.58 (0.39–0.86) < 0.01 −0.33 0.71 (0.47–1.10) 0.13
    High level −0.58 0.56 (0.38–0.83) < 0.01 −0.22 0.80 (0.52–1.25) 0.32
    MT-ATP8Pos.2
    Low level 1.00 1.00
    Middle level −0.51 0.60 (0.41–0.89) 0.01 −0.22 0.81 (0.52–1.24) 0.33
    High level −0.48 0.62 (0.42–0.92) 0.02 −0.13 0.88 (0.57–1.37) 0.58
    MT-ATP8
    Low level 1.00 1.00
    Middle level −0.44 0.65 (0.44–0.96) 0.03 −0.21 0.82 (0.53–1.26) 0.36
    High level −0.52 0.60 (0.40–0.89) 0.01 −0.16 0.86 (0.55–1.34) 0.49
      Note. Adjusted model: adjusted for age, sex, BMI, smoking, drinking, exercise, hypertensive treatment, FBG, TC, and TG.
    下载: 导出CSV

    S2.   Comparison of methylation levels between male and female hypertensive patients

    LociMale group (N = 25)Female group (N = 312)Z valueP value
    MT-COX1Pos.19.38 (4.25)10.24 (4.12)−0.850.39
    MT-COX1Pos.28.43 (3.52)7.75 (2.84)−0.620.53
    MT-COX19.09 (3.70)8.72 (3.31)−0.280.78
    MT-COX25.46 (2.60)5.61 (2.60)−0.050.96
    MT-COX3Pos.14.43 (1.42)4.85 (1.54)−1.090.27
    MT-COX3Pos.23.66 (1.38)3.81 (1.18)−0.750.45
    MT-COX34.10 (1.32)4.34 (1.16)−1.140.25
    MT-ATP6Pos.118.12 (3.44)17.53 (5.33)−0.440.66
    MT-ATP6Pos.210.34 (4.39)10.68 (3.97)−1.220.22
    MT-ATP6Pos.313.85 (6.71)13.04 (5.56)−0.380.70
    MT-ATP614.26 (4.77)13.58 (4.09)−0.070.94
    MT-ATP8Pos.17.32 (5.24)6.35 (4.07)−1.460.14
    MT-ATP8Pos.27.10 (4.77)6.04 (3.59)−1.180.24
    MT-ATP86.77 (5.03)6.20 (3.76)−1.310.19
      Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.
    下载: 导出CSV

    S3.   Comparison of methylation levels between BMI ≥ 24 and < 24 hypertensive patients

    LociBMI < 24 (N = 101)BMI ≥ 24 (N = 236)Z valueP value
    MT-COX1Pos.19.48 (4.06)9.46 (4.22)−0.410.68
    MT-COX1Pos.28.22 (2.90)7.73 (2.78)−1.060.29
    MT-COX18.99 (3.39)8.56 (3.23)−0.800.43
    MT-COX25.53 (2.61)5.68 (2.63)−1.540.12
    MT-COX3Pos.14.74 (1.60)4.91 (1.52)−1.000.32
    MT-COX3Pos.23.81 (1.04)3.80 (1.19)−0.060.95
    MT-COX34.22 (1.11)4.35 (1.22)−0.340.74
    MT-ATP6Pos.117.41 (4.90)17.65 (5.32)−0.270.78
    MT-ATP6Pos.210.58 (3.99)10.68 (3.97)−0.180.86
    MT-ATP6Pos.313.08 (6.05)13.12 (5.56)−0.140.89
    MT-ATP613.73 (3.93)13.70 (4.19)−0.100.92
    MT-ATP8Pos.16.26 (4.27)6.46 (4.05)−0.020.98
    MT-ATP8Pos.26.07 (3.40)6.03 (3.59)−0.300.77
    MT-ATP86.15 (3.89)6.26 (3.92)−0.130.90
      Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.
    下载: 导出CSV

    S4.   Comparison of methylation levels between age ≥ 60 and < 60 hypertensive patients

    LociAge < 60 (N = 139)Age ≥ 60 (N = 198)Z valueP value
    MT-COX1Pos.19.18 (4.57)9.64 (3.98)−0.780.43
    MT-COX1Pos.27.27 (2.68)8.22 (3.18)−3.58< 0.001
    MT-COX18.41 (3.22)8.93 (3.42)−2.060.04
    MT-COX25.38 (2.63)5.71 (2.45)−1.910.056
    MT-COX3Pos.14.01 (1.55)5.23 (1.15)−8.93< 0.001
    MT-COX3Pos.23.68 (1.42)3.86 (1.08)−1.660.10
    MT-COX33.91 (1.35)4.61 (0.99)−6.48< 0.001
    MT-ATP6Pos.118.40 (4.74)17.09 (4.82)−2.920.004
    MT-ATP6Pos.29.57 (4.04)10.92 (3.64)−3.270.001
    MT-ATP6Pos.312.95 (5.17)13.20 (6.16)−0.490.62
    MT-ATP613.80 (4.06)13.46 (4.11)−0.640.52
    MT-ATP8Pos.17.86 (3.78)5.35 (3.24)−7.17< 0.001
    MT-ATP8Pos.27.41 (3.66)5.19 (2.97)−6.66< 0.001
    MT-ATP87.70 (3.23)5.40 (3.17)−7.14< 0.001
      Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.
    下载: 导出CSV

    S5.   Comparison of methylation levels between smoking and non-smoking hypertensive patients

    LociNon-smoking (N = 177)Smoking (N = 158)Z valueP value
    MT-COX1Pos.110.20 ± 4.2610.22 (4.34)−0.240.81
    MT-COX1Pos.27.85 (3.09)7.75 (2.82)−0.210.83
    MT-COX18.72 (3.20)8.74 (3.46)−0.040.97
    MT-COX25.45 (2.47)5.76 (2.79)−0.270.79
    MT-COX3Pos.14.77 (1.57)4.94 (1.49)−1.270.21
    MT-COX3Pos.23.66 (1.12)3.92 (1.01)−2.66< 0.01
    MT-COX34.19 (1.17)4.43 (1.05)−2.380.02
    MT-ATP6Pos.116.55 (5.66)17.80 (4.15)−3.03< 0.01
    MT-ATP6Pos.210.43 (3.67)10.88 (4.01)−1.220.22
    MT-ATP6Pos.312.79 (5.72)13.37 (5.76)−1.450.15
    MT-ATP612.97 (4.56)14.18 (3.65)−2.010.04
    MT-ATP8Pos.16.35 (4.58)6.49 (4.10)−0.560.58
    MT-ATP8Pos.25.94 (3.86)6.09 (3.46)−0.200.85
    MT-ATP86.15 (4.37)6.32 (3.57)−0.420.68
      Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.
    下载: 导出CSV

    S6.   Comparison of methylation levels between drinking and non-drinking hypertensive patients

    Loci Non-drinking (N = 198) Drinking (N =137) Z value P value
    MT-COX1Pos.1 9.42 (4.31) 9.58 (4.39) −0.75 0.46
    MT-COX1Pos.2 7.76 (2.83) 7.85 (3.04) −0.71 0.48
    MT-COX1 8.72 (3.12) 9.37 (3.94) −0.63 0.53
    MT-COX2 5.47 (2.52) 5.68 (2.70) −0.04 0.97
    MT-COX3Pos.1 4.78 (1.52) 4.98 (1.48) −1.23 0.22
    MT-COX3Pos.2 3.68 (1.11) 3.92 (1.03) −2.32 0.02
    MT-COX3 4.19 (1.18) 4.44 (1.01) −2.20 0.03
    MT-ATP6Pos.1 16.78 (5.32) 18.13 (4.31) −2.42 0.02
    MT-ATP6Pos.2 10.52 (3.59) 10.78 (4.23) −1.28 0.20
    MT-ATP6Pos.3 12.78 (5.62) 13.66 (5.86) −1.29 0.20
    MT-ATP6 13.20 (4.28) 14.37 (3.99) −1.86 0.06
    MT-ATP8Pos.1 6.16 (4.39) 6.59 (3.91) −0.20 0.85
    MT-ATP8Pos.2 5.86 (3.59) 6.51 (3.69) −1.00 0.32
    MT-ATP8 6.01 (4.10) 6.50 (3.47) −0.60 0.55
      Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.
    下载: 导出CSV

    S7.   Comparison of methylation levels between with anti-hypertensive treatment and without anti-hypertensive treatment patients

    Loci Hypertension group Z value P value
    Anti-hypertensive treatment (56) Without anti-hypertensive treatment (281)
    MT-COX1Pos.1 8.77 (3.47) 9.62 (4.12) −1.62 0.11
    MT-COX1Pos.2 8.13 (2.47) 7.76 (3.06) −0.27 0.79
    MT-COX1 8.53 (2.61) 8.83 (3.42) −0.93 0.35
    MT-COX2 5.75 (2.68) 5.50 (2.62) −1.14 0.26
    MT-COX3Pos.1 5.06 (1.51) 4.82 (1.57) −1.48 0.14
    MT-COX3Pos.2 3.68 (1.45) 3.83 (1.07) −0.21 0.83
    MT-COX3 4.39 (1.09) 4.30 (1.20) −0.72 0.47
    MT-ATP6Pos.1 15.80 (4.75) 17.97 (4.90) −2.70 0.01
    MT-ATP6Pos.2 9.99 (3.80) 10.68 (3.96) −1.14 0.25
    MT-ATP6Pos.3 12.79 (6.16) 13.12 (5.71) −1.41 0.16
    MT-ATP6 12.93 (4.33) 14.01 (4.08) −1.89 0.06
    MT-ATP8Pos.1 6.81 (3.97) 6.35 (4.13) −0.23 0.82
    MT-ATP8Pos.2 5.87 (3.40) 6.07 (3.65) −0.01 0.99
    MT-ATP8 6.28 (3.66) 6.24 (3.89) −0.13 0.90
      Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.
    下载: 导出CSV

    S8.   Association between mtDNA methylation level and the risk of hypertension

    Loci Unadjusted model Adjusted model
    β value OR (95% CI) P value β value OR (95% CI) P value
    MT-COX1Pos.1 −0.06 0.95 (0.91–0.98) < 0.001 −0.05 0.95 (0.92–0.99) 0.01
    MT-COX1Pos.2 0.01 0.99 (0.94–1.03) 0.58 −0.04 0.96 (0.91–1.01) 0.12
    MT-COX1 −0.05 0.95 (0.91–1.00) 0.03 −0.06 0.95 (0.90–0.99) 0.03
    MT-COX2 −0.03 0.98 (0.93–1.03) 0.33 −0.04 0.96 (0.90–1.02) 0.17
    MT-COX3Pos.1 0.13 1.14 (1.02–1.29) 0.03 −0.06 0.94 (0.82–1.08) 0.38
    MT-COX3Pos.2 −0.06 0.95 (0.84–1.07) 0.37 −0.12 0.89 (0.77–1.03) 0.12
    MT-COX3 0.06 1.06 (0.93–1.20) 0.39 −0.11 0.90 (0.76–1.05) 0.19
    MT-ATP6Pos.1 −0.03 0.97 (0.94–1.01) 0.13 −0.01 0.99 (0.96–1.03) 0.72
    MT-ATP6Pos.2 −0.03 0.97 (0.92–1.02) 0.25 −0.05 0.95 (0.90–1.01) 0.12
    MT-ATP6Pos.3 −0.02 0.99 (0.96–1.01) 0.29 −0.01 0.99 (0.96–1.02) 0.62
    MT-ATP6 −0.03 0.97 (0.93–1.01) 0.16 −0.02 0.98 (0.94–1.03) 0.44
    MT-ATP8Pos.1 −0.06 0.94 (0.89–0.99) 0.01 −0.02 0.98 (0.93–1.03) 0.42
    MT-ATP8Pos.2 −0.07 0.93 (0.89–0.98) < 0.001 −0.04 0.96 (0.92–1.02) 0.16
    MT-ATP8 −0.08 0.93 (0.88–0.98) < 0.001 −0.04 0.97 (0.91–1.02) 0.22
      Note. Adjusted model: adjusted for age, gender, BMI, smoking, drinking, exercise, hypertensive treatment, FBG, TC, and TG.
    下载: 导出CSV
  • [1] NCD Risk Factor Collaboration (NCD-RisC). Worldwide trends in hypertension prevalence and progress in treatment and control from 1990 to 2019: a pooled analysis of 1201 population-representative studies with 104 million participants. Lancet, 2021; 398, 957−80. doi:  10.1016/S0140-6736(21)01330-1
    [2] Smolarek I, Wyszko E, Barciszewska AM, et al. Global DNA methylation changes in blood of patients with essential hypertension. Med Sci Monit, 2010; 16, Cr149−55.
    [3] Wise IA, Charchar FJ. Epigenetic modifications in essential hypertension. Int J Mol Sci, 2016; 17, 451. doi:  10.3390/ijms17040451
    [4] Dabravolski SA, Khotina VA, Sukhorukov VN, et al. The role of mitochondrial DNA mutations in cardiovascular diseases. Int J Mol Sci, 2022; 23, 952. doi:  10.3390/ijms23020952
    [5] Stoccoro A, Coppede F. Mitochondrial DNA methylation and human diseases. Int J Mol Sci, 2021; 229, 4594. doi:  10.3390/ijms22094594
    [6] El Haouari M, Rosado JA. Platelet function in hypertension. Blood Cells Mol Dis, 2009; 42, 38−43. doi:  10.1016/j.bcmd.2008.07.003
    [7] Corsi S, Iodice S, Vigna L, et al. Platelet mitochondrial DNA methylation predicts future cardiovascular outcome in adults with overweight and obesity. Clin Epigenet, 2020; 12, 29. doi:  10.1186/s13148-020-00825-5
    [8] Han LY, Liu YF, Duan SW, et al. DNA methylation and hypertension: emerging evidence and challenges. Brief Funct Genomics, 2016; 15, 460−9.
    [9] Shaughnessy DT, McAllister K, Worth L, et al. Mitochondria, energetics, epigenetics, and cellular responses to stress. Environ Health Perspect, 2014; 122, 1271−8. doi:  10.1289/ehp.1408418
    [10] Forte M, Stanzione R, Cotugno M, et al. Vascular ageing in hypertension: Focus on mitochondria. Mech Ageing Dev, 2020; 189, 111267. doi:  10.1016/j.mad.2020.111267
  • [1] Yunhan Zou, Ning Li, Yu Wang, Jiaonan Wang, Chen Chen, Jianlong Fang, Xiaoming Shi.  Association of Ambient PM2.5 Components with Lung Function in Adults Aged 40–89 Years: A Cross-Sectional Study in China . Biomedical and Environmental Sciences, 2026, 39(5): 1-7. doi: 10.3967/bes2026.039
    [2] Yuehan Liu, Jing Du, Lan Zhang, Jiale Ren, Yuzhu Zhao, Yushen Jin, Yumin Niu, Bing Shao.  Individual and Joint Association of Phenol and Paraben Exposure with Asthma Outcomes among US Adults: A Nationally Representative Cross-sectional Study . Biomedical and Environmental Sciences, 2026, 39(3): 297-309. doi: 10.3967/bes2025.163
    [3] Yinghao Yuchi, Wei Liao, Jia Qiu, Ruiying Li, Ning Kang, Xiaotian Liu, Wenqian Huo, Zhenxing Mao, Jian Hou, Lei Zhang, Chongjian Wang.  Kitchen Ventilation Attenuate the Association of Solid Fuel Use with Sarcopenia: A Cross-Sectional and Prospective Study . Biomedical and Environmental Sciences, 2025, 38(4): 511-515. doi: 10.3967/bes2025.031
    [4] Haixia Ma, Huaqiu Chen, Peichang Wang.  Association between Non-high-density Lipoprotein Cholesterol to High-density Lipoprotein Cholesterol Ratio (NHHR) and Stroke among Adults in the USA: A Cross-Sectional NHANES Study . Biomedical and Environmental Sciences, 2025, 38(1): 37-46. doi: 10.3967/bes2025.001
    [5] Lin Hu, Mingcong Chen, Qiuwei Tian, Zisai Wang, Mingyi Zhao, Qingnan He.  Association between Neutrophil-to-lymphocyte Ratio and Renal Function: A Cross-sectional Study with Threshold Effects . Biomedical and Environmental Sciences, 2025, 38(11): 1458-1462. doi: 10.3967/bes2025.140
    [6] LIANG Yu Jian, RONG Jia Hui, WANG Xue Xiu, CAI Jian Sheng, QIN Li Dong, LIU Qiu Mei, TANG Xu, MO Xiao Ting, WEI Yan Fei, LIN Yin Xia, HUANG Shen Xiang, LUO Ting Yu, GOU Ruo Yu, CAO Jie Jing, HUANG Chu Wu, LU Yu Fu, QIN Jian, ZHANG Zhi Yong.  Correlation between Combined Urinary Metal Exposure and Grip Strength under Three Statistical Models: A Cross-sectional Study in Rural Guangxi . Biomedical and Environmental Sciences, 2024, 37(1): 3-18. doi: 10.3967/bes2024.002
    [7] Leyao Jian, Bo Yang, Rulin Ma, Shuxia Guo, Jia He, Yu Li, Yusong Ding, Dongsheng Rui, Yidan Mao, Xin He, Xueying Sun, Shengyu Liao, Heng Guo.  Association between Residential Greenness and Cardiometabolic Risk Factors among Adults in Rural Xinjiang Uygur Autonomous Region, China: A Cross-Sectional Study . Biomedical and Environmental Sciences, 2024, 37(10): 1184-1194. doi: 10.3967/bes2024.085
    [8] QIAN Ting Ting, SUN Rong, LIU Lan Chun, CHE Wen Jing, ZHAO Meng, ZHANG Ling, LI Wei Dong, JIA Qing Zhen, WANG Jian Hui, LI Jin Shu, CHEN Zhi Hui, ZHANG Bi Yun, LIU Peng.  Relationship between Dining Place, Iodine Source, and Iodine Nutrition in School-Age Children: A Cross-Sectional Study in China . Biomedical and Environmental Sciences, 2023, 36(1): 10-23. doi: 10.3967/bes2023.002
    [9] ZHANG Mei, PENG Ke, ZHANG Xiao, LIU Yi Shu, LIU Xiao Ying, HAN Gui Yuan, SHI Yu, HUANG Zheng Jing, LI Chun, ZHAO Zhen Ping, WANG Li Min, LI Yi Chong.  Geographic Variations in the Prevalence, Awareness, Treatment, and Control of Dyslipidemia among Chinese Adults in 2018–2019: A Cross-sectional Study . Biomedical and Environmental Sciences, 2023, 36(4): 313-323. doi: 10.3967/bes2023.037
    [10] Danesh Soltani, Ramin Heshmat, Ali Vasheghani-Farahani, Noushin Fahimfar, Farzad Masoudkabir, Haleh Ashraf, Abdolvahab Baradaran, Iraj Nabipour, Bagher Larijani, Afshin Ostovar, Gita Shafiee.  The Association between Waterpipe Smoking and Metabolic Syndrome: A Cross-Sectional Study of the Bushehr Elderly Health Program . Biomedical and Environmental Sciences, 2021, 34(11): 910-915. doi: 10.3967/bes2021.125
    [11] CHEN Xue Yu, YANG Yao, TANG Zhao Yang, LYU Jian, SHI Feng Xue, CHEN Yan Ru, WANG Xiao Hui, TAN Tan, XING Wei Jia, HOU Hai Feng, JI Long, LI Xiao Dong, LI Dong.  Association between Hypertension with Hyperhomocysteinemia and Cognitive Impairment in the Kailuan Community of China: A Cross-sectional Study . Biomedical and Environmental Sciences, 2021, 34(7): 557-561. doi: 10.3967/bes2021.076
    [12] LIANG Bin, TANG Wei Wei, ZHANG Wen Qiang, HUANG Chuan, LIU Ya, XU Fan, LIU Xin, YUAN Ning, LIU Jian Xiong, YI Yan Jing, XU Rong Hua, HU Dan, HUANG Xiao Bo, CAO Xin.  Prevalence and Associated Factors of Diabetes Mellitus in a Very Elderly Chinese Population: A Cross-sectional Study . Biomedical and Environmental Sciences, 2020, 33(5): 315-322. doi: 10.3967/bes2020.043
    [13] HUANG Li Na, WANG Hui Jun, WANG Zhi Hong, DING Gang Qiang.  Association between Chinese Famine Exposure and the Risk of Overweight/Obesity and Abdominal Obesity in Laterlife: A Cross-sectional Study . Biomedical and Environmental Sciences, 2020, 33(2): 133-137. doi: 10.3967/bes2020.017
    [14] ZHOU Ping An, ZHANG Chen Huan, CHEN Yan Ru, LI Dong, SONG Dai Yu, LIU Hua Min, ZHOU Ming Yue, SONG Guo Shun, CHEN Sheng Yun.  Association between Metabolic Syndrome and Carotid Atherosclerosis: A Cross-sectional Study in Northern China . Biomedical and Environmental Sciences, 2019, 32(12): 914-921. doi: 10.3967/bes2019.114
    [15] YE Yi Cong, LIU Hua Min, ZHOU Yong, ZENG Yong.  Association between Serum Alkaline Phosphatase and Carotid Atherosclerosis in a Chinese Population: A Community-based Cross-sectional Study . Biomedical and Environmental Sciences, 2019, 32(6): 446-453. doi: 10.3967/bes2019.059
    [16] YAN Jing, ZHENG Yu Zhi, CAO Lu Jia, LIU Yu Yan, LI Wen, HUANG Guo Wei.  Periconceptional Folic Acid Supplementation in Chinese Women:A Cross-sectional Study . Biomedical and Environmental Sciences, 2017, 30(10): 737-748. doi: 10.3967/bes2017.099
    [17] SONG Qiao Feng, LIU Xiao Xue, HU Wan Ning, HAN Xiao Chen, ZHOU Wen Hua, LU Ai Dong, WANG Xi Zhu, WU Shou Ling.  Night Sleep Duration and Risk of Cognitive Impairment in a Chinese Population:A Cross-sectional Study . Biomedical and Environmental Sciences, 2017, 30(10): 749-757. doi: 10.3967/bes2017.100
    [18] WU Zhong Biao, JIANG Tian, LIN Guo Bing, WANG You Xin, ZHOU Yong, CHEN Zhen Qian, XU Yong Ming, YE Hai Bo, CHEN Bo Jun, BAO Xiao Zhao, ZHANG Cun Ming.  Tea Consumption is Associated with Increased Risk of Kidney Stones in Northern Chinese: A Cross-sectional Study . Biomedical and Environmental Sciences, 2017, 30(12): 922-926. doi: 10.3967/bes2017.124
    [19] LUO Tai Yang, LIU Xiao Hui, DAI Tian Yi, LIU Xin Min, ZHANG Qian, DONG Jian Zeng.  Ideal Cardiovascular Health Metrics and Coronary Artery Calcification in Northern Chinese Population:A Cross-sectional Study . Biomedical and Environmental Sciences, 2016, 29(7): 475-483. doi: 10.3967/bes2016.063
    [20] WEI-YAN ZHAO, JIAN-FENG HUANG, LAI-YUAN WANG, HONG-FAN LI, PENG-HUA ZHANG, QI ZHAO, SHU-FENG CHEN, DONG-FENG GU.  Association of the Apolipoprotein B Gene Polymorphisms With Essential Hypertension in Northern Chinese Han Population . Biomedical and Environmental Sciences, 2007, 20(3): 260-264.
  • 23098+Supplementary Materials.pdf
  • 加载中
图(1) / 表ll (11)
计量
  • 文章访问数:  1164
  • HTML全文浏览量:  466
  • PDF下载量:  69
  • 被引次数: 0
出版历程
  • 收稿日期:  2023-04-05
  • 录用日期:  2023-07-11
  • 刊出日期:  2023-10-20

Association between Mitochondrial DNA Methylation and Hypertension Risk: A Cross-sectional Study in Chinese Northern Population

doi: 10.3967/bes2023.122
    基金项目:  This research was supported by The Scientific Research Translational Foundation of Wenzhou Safety [Emergency] Institute of Tianjin University [TJUWYY2022019, TJUWYY2023001]; Fundamental Research Funds for the Central Universities, Nankai University [NO. 63221058]; Natural Science Foundation of Tianjin Science and Technology Program [21JCYBJC00830]; Tianjin Research Innovation Project for Postgraduate Students [2021YJSB193].
    作者简介:

    ZHAO Lei, male, born in 1994, PhD, majoring in environmental pollution and human health

    JIA Ya Ning, female, born in 1997, Master, majoring in environmental health

    通讯作者: GUO Li Qiong, PhD, Tel: 86-22-27893596, E-mail: yingqidao@163.comHOU Shi Ke, PhD, Tel: 86-22-27893596, E-mail: houshike@tju.edu.cn
注释:
1) CRediT Authorship Contribution Statement:

English Abstract

ZHAO Lei, JIA Ya Ning, LIU Qi Si Jing, LIU Zi Quan, LIN Hui Shu, SHUI Xin Ying, GUO Li Qiong, HOU Shi Ke. Association between Mitochondrial DNA Methylation and Hypertension Risk: A Cross-sectional Study in Chinese Northern Population[J]. Biomedical and Environmental Sciences, 2023, 36(10): 972-978. doi: 10.3967/bes2023.122
Citation: ZHAO Lei, JIA Ya Ning, LIU Qi Si Jing, LIU Zi Quan, LIN Hui Shu, SHUI Xin Ying, GUO Li Qiong, HOU Shi Ke. Association between Mitochondrial DNA Methylation and Hypertension Risk: A Cross-sectional Study in Chinese Northern Population[J]. Biomedical and Environmental Sciences, 2023, 36(10): 972-978. doi: 10.3967/bes2023.122
  • Hypertension is one of the most common chronic diseases worldwide and can considerably increase the incidence of complications such as stroke, coronary artery disease (CAD), heart failure, chronic kidney disease, aortic aneurysm, atrial fibrillation, and peripheral arterial disease. Data from one of the largest studies on worldwide hypertension trends show that the number of adults aged 30–79 years with hypertension has increased from 650 million to 1.28 billion over the past 30 years[1], which has resulted in huge economic and medical burdens for the public. Hypertension results from interactions between environmental and genetic factors. Methylation level of 5mC in patients with hypertension decreased significantly compared to that in healthy individuals[2], and some researchers further found that the level of 5mC methylation decreased with an increase in hypertension severity[3]. The role of epigenetics in the pathogenesis of diseases including cancer, cardiovascular diseases (CVD), and neurodegenerative diseases has attracted increasing attention. Epigenetic changes are considered valuable biomarkers for the diagnosis and prognosis of cancer and neurological and autoimmune diseases. Epigenetic mechanisms are thought to provide opportunities for disease intervention aimed at preventing or improving the symptoms of diseases by targeting lifestyle and using epigenetic-based treatments.

    Mitochondria are the primary sources of cellular energy in the human body and play a crucial role in maintaining normal bodily functions. Epigenetic regulation of mitochondrial DNA (mtDNA), such as mtDNA methylation, is associated with CVD-related risk factors and complications[4]. Nevertheless, most studies have focused on evaluating mtDNA methylation levels within tissues, vessel specimens, and leukocytes, all of which are mixed cell types[5]. Consequently, the effects of mtDNA methylation on individual cellular functions could not be investigated. In the present study, we focused on a certain cell type, platelets, which play an important role in the pathogenesis of atherosclerosis and the incidence of hypertension[6]. As the only genetic material in platelets, mtDNA may be important for maintaining thrombosis and hemostasis. Since hypertension has a pathogenesis similar to that of CVD, the investigation conducted by Corsi et al.[7] highlighting the correlation between mtDNA methylation and CVD risk provided a potential hypothesis for our study, which is that the alteration of platelet mtDNA methylation levels may have an effect on the incidence of hypertension. This study aimed to explore the association between platelet mtDNA methylation levels and hypertension in the general population.

    In this study, participants who attended a physical examination at Kailuan Hospital between January 1st, 2014 and December 31st, 2016, were selected from the Kailuan study (Project number: ChiCTR-TNC-11001489), which is a large population cohort study on risk factors and interventions for cardiology, cerebrovascular, and related diseases in Tangshan City, China. The inclusion criteria for the hypertension group were systolic blood pressure (SBP) ≥ 140 mmHg/diastolic blood pressure (DBP) ≥ 90 mmHg or receiving antihypertensive treatment. The inclusion criteria for the control group were SBP of < 140 mmHg and DBP of < 90 mmHg. Individuals with diabetes, myocardial infarction, severe liver and kidney diseases, other chronic diseases, autoimmune diseases, or malignant tumors were excluded from the study. Basic information, disease history, and lifestyle (including smoking, drinking, and physical exercise) were collected by professional medical staff using standardized questionnaires. Fasting blood glucose (FBG), triglyceride (TG), and total cholesterol (TC) levels were provided by the hospitals. Blood pressure was measured using a mercury sphygmomanometer in the sitting position after 5 min of rest. The participants were required to prevent smoking, drinking coffee, and strenuous exercise within 30 min before the measurement. Blood pressure was measured thrice, and the average value was used for further analysis. Cigarette smoking was defined as continuous smoking for more than one year and smoking at least one cigarette every day. Exercise was defined as more than three times a week, and each time not less than 20 min, drinking was defined as drinking at least 100 mL of liquor with more than 50% alcohol content in the past year. A total of 620 participants who met the inclusion criteria were included in the analysis. The study was approved by the Ethics Committee of Kailuan General Hospital, and all participants provided written informed consent.

    Blood samples were centrifuged at 3,000 rpm for 10 min to obtain plasma, which was then centrifuged at 1,400 ×g for 15 min to obtain platelets. Platelets were treated with DNase I, proteinase K, and restriction endonuclease BamHI. A DNA Methylation Kit (Zymo Research, Orange, CA, USA) was used for bisulfite conversion and mtDNA extraction. The amplified mtDNA was used for pyrosequencing (PyroMark Q96, QIAGEN). The sequenced genes included those encoding complex IV [Cytochrome C oxidase I (MT-COX1), Cytochrome C oxidase II (MT-COX2), Cytochrome C oxidase III (MT-COX3)], and complex V [ATP synthase 6 (MT-ATP6) and ATP synthase 8 (MT-ATP8)]. Complex IV is a component of the respiratory electron transport chain. MT-COX1, MT-COX2 and MT-COX3 comprise the functional core of complex IV; thus, genetic mutations in COX genes may cause severe metabolic diseases by disrupting the electron transport chain. In addition, MT-ATP6 and MT-ATP8, as the only two genes in the mitochondria encoding ATPases, may directly affect ATP synthesis and energy metabolism. Details of the primers used are listed in Supplementary Table S1 (available in www.besjournal.com). Stringent quality control measures were applied during the mtDNA methylation analysis. All equipment used for mtDNA methylation was thoroughly sterilized, non-pyrogenic, and DNAse/RNAse-free. To monitor potential contamination and ensure the validity of the polymerase chain reaction (PCR), blank samples were included as negative controls in each 96-well plate. Additionally, two samples with known global DNA methylation levels (0% and 100%) as positive controls for pyrosequencing. Moreover, to enhance accuracy, each sample underwent two repeated pyrosequencing runs, and the average value was calculated for subsequent analyses.

    Table S1.  The pyrosequencing primer sequence

    Gene Primer Sequence
    MT-COX1 Forward primer
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TATTAATTGGTTTTTTAGGGTTTAT
    CAACAAATCATTTCATATTACTTCC
    TATTTATAGTAGGAAT
    MT-COX2 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TTTATGAGTTGTTTTTATATTAGGTTTAAA
    ACTCCACAAATTTCAAAACATTAAC
    TAAAAATAGATGTAAT
    MT-COX3 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TATATTATTTGTTTAAAAAGGTTTT
    AATAAAAAACTCAAAAAAATCCTAC
    TATATTATTTGTTTAAAAAGGTTTT
    MT-ATP6 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    TTATAAATTTAGTTATGGTTATTTTTTTAT
    AAACTAAAACATTTTTAATCTTAAAAC
    TTATAAATTTAGTTATGGTTATTTTTTTAT
    MT-ATP8 Forward primer (5’ to 3’)
    Reverse biotin primer (5’ to 3’)
    Sequencing primer (5’ to 3’)
    AAATTATAATAAATTTTGAGAATTAAAATG
    AATAAACCTAAAATTATAAAAACAATAAAT
    AAATTATAATAAATTTTGAGAATTAAAATG

    In this study, Kolmogorov-Smirnova test was used to test the normality of continuous variables. The continuous variables of skewed distribution were represented by median (M) and interquartile range (IQR). The difference between hypertension group and control group was compared by Mann-Whitney U rank sum test. The categorical data were described as the number of cases (N) and percentage (%), and the comparison between the two groups was performed by χ2 test. Logistic regression was used to analyze the association between each locus and hypertension. mtDNA methylation levels were divided into three groups according to the tertile (low-, middle-, and high-level groups). The low-level group was used as the reference group to explore the risk of hypertension in the middle-level group and the high-level group. All statistical tests were two-sided, and P < 0.05 was considered statistically significant. SAS 9.1 software (SAS Institute, Cary, NC) and SPSS 23.0 (IBM SPSS Statistics for Windows, NY, USA) were used for statistical analysis.

    Table 1 summarizes the characteristics of the 620 participants. There were 337 and 283 patients in the hypertension and control groups, respectively. The age of participates was 58.97 years old, with 584 males (91.5%). Compared with the control group, the age, BMI, exercise, TC, TG, FBG, SBP, and DBP levels in the hypertension group were higher than those in the control group (P < 0.05). As shown in Supplementary Figure S1 (available in www.besjournal.com), the univariate logistic regression analysis indicated that age, BMI, exercise, FBG, TG, and TC were significantly associated with the risk of hypertension. Recently, several epidemiological studies have revealed that genomic DNA methylation plays an important role in the development of hypertension. A review article provided multiple perspectives on the potential pathways between gene-specific DNA methylation and hypertension, including the renin-angiotensin-aldosterone system (RAAS), sympathetic nervous system (SNS), and renal sodium retention system (RSRS)[8]. However, the relationship between mtDNA methylation and the risk of hypertension has rarely been studied.

    Table 1.  Characteristics of included subjects

    VariablesAll participants
    (N = 620)
    Hypertension group
    (N = 337)
    Control group
    (N = 283)
    z/χ2P value
    Age (years)58.97 (12.18)61.74 (11.41)57.52 (12.36)−6.30< 0.01
    Male, n (%)567 (91.5)312 (92.6)255 (90.1)1.210.27
    BMI25.19 (3.70)25.65 (4.09)24.51 (3.42)−4.33< 0.01
    Smoking, n (%)271 (43.7)158 (46.9)113 (39.9)3.730.16
    Drinking, n (%)239 (38.5)137 (40.7)102 (36.0)1.380.24
    Exercise, n (%)97 (15.6)63 (18.7)34 (12.0)5.200.02
    Education, n (%)90 (14.5)45 (13.4)45 (15.9)0.810.37
    SBP (mmHg)142.78 (23.83)152.00 (19.67)128.83 (14.92)−20.75< 0.01
    DBP (mmHg)83.62 (13.33)88.00 (15.33)79.33 (9.92)−12.91< 0.01
    FBG (mmol/L)6.23 (1.33)5.79 (1.41)5.47 (1.10)−4.56< 0.01
    TG (mmol/L)1.67 (0.98)1.34 (1.10)1.16 (0.92)−3.49< 0.01
    TC (mmol/L)5.18 (1.23)5.19 (1.30)5.05 (1.27)−2.01< 0.05
    HDL-C (mmol/L)1.45 (0.49)1.40 (0.51)1.34 (0.48)−0.810.12
    LDL-C (mmol/L)3.03 (0.83)3.08 (0.87)2.96 (0.79)−1.770.08
    Family history, n (%)14 (2.3)11 (3.3)3 (1.1)3.340.07
      Note. Continuous variables that did not conform to the normal distribution were described as medians and interquartile ranges, and differences between the two groups were compared using the Mann-Whitney U test. Categorical variables are presented as frequencies and percentages, and the differences between the two groups were compared using the chi-square test. MT-COX1 represents the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2. MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 represents the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2; SBP, systolic blood pressure;DBP, diastolic blood pressure; FBG, fasting blood glucose; TG, triglyceride; TC, total cholesterol; HDL-C, high-density lipoproteincholesterol; HDL-C, low-density lipoproteincholesterol.

    In this study, the results showed that the methylation levels of MT-COX1Pos.1, MT-ATP8Pos.1, MT-ATP8Pos.2, and MT-ATP8 in the hypertensive group were lower than those in the control group, which were 9.48% vs. 9.98%, 6.44% vs. 7.18%, 6.05% vs. 6.93%, and 6.26% vs. 6.96%, respectively, and the differences were statistically significant (P < 0.05). The methylation levels of MT-COX3Pos.1 and MT-COX3 were higher than those in the control group with statistical differences, which were 4.83% vs. 4.31% and 4.31% vs. 4.09%, respectively (P < 0.05) (Table 2). These findings reveal that the epigenetic regulation of mitochondrial genes may be of great significance in the occurrence of hypertension. To explore whether common risk factors for hypertension can influence the methylation levels in hypertensive patients, we conducted a subgroup analysis. Hypertensive patients were then divided into two groups according to sex (male, female), age (< 60, ≥ 60), BMI (< 24, ≥ 24), smoking (yes, no), drinking (yes, no), antihypertensive treatment (with, without), and the difference in mtDNA methylation levels between the two groups. No significant differences of mtDNA methylation levels could be observed in male and female hypertensive patients, or BMI < 24 and BMI ≥ 24 hypertensive patients (P > 0.05), as shown in Supplementary Tables S2S3 (available in www.besjournal.com). The results showed that age, smoking, drinking, and antihypertensive treatment affected the methylation levels in patients with hypertension (P < 0.05) (Supplementary Tables S4S7, available in www.besjournal.com).

    Table 2.  Comparison of MtDNA methylation level between hypertension group and control group

    Loci All participates
    Median (IQR)
    Hypertension group
    Median (IQR)
    Control group
    Median (IQR)
    Z value P value
    MT-COX1Pos.1 10.64 (4.92) 9.47 (4.18) 9.98 (6.39) −2.17 0.03
    MT-COX1Pos.2 7.75 (3.21) 7.80 (2.88) 7.68 (3.68) −0.99 0.32
    MT-COX1 9.40 (3.97) 8.72 (3.26) 8.96 (4.89) −1.01 0.31
    MT-COX2 5.56 (2.63) 5.60 (2.61) 5.50 (2.64) −0.55 0.58
    MT-COX3Pos.1 4.64 (1.76) 4.83 (1.56) 4.31 (1.87) −3.72 < 0.01
    MT-COX3Pos.2 3.79 (1.32) 3.80 (1.17) 3.78 (1.51) −0.21 0.83
    MT-COX3 4.23 (1.32) 4.31 (1.18) 4.09 (1.56) −2.10 0.04
    MT-ATP6Pos.1 17.65 (5.35) 17.65 (5.06) 17.73 (5.87) −1.32 0.19
    MT-ATP6Pos.2 10.84 (3.94) 10.65 (3.97) 11.25 (3.91) −0.97 0.33
    MT-ATP6Pos.3 13.33 (5.91) 13.11 (5.73) 13.58 (5.89) −0.98 0.33
    MT-ATP6 13.95 (4.43) 13.73 (4.11) 14.10 (4.99) −2.17 0.23
    MT-ATP8Pos.1 6.82 (4.11) 6.44 (4.10) 7.18 (3.92) −2.72 < 0.01
    MT-ATP8Pos.2 6.48 (3.60) 6.05 (3.61) 6.93 (3.42) −2.82 < 0.01
    MT-ATP8 6.68 (3.76) 6.26 (3.81) 6.96 (3.68) −2.81 < 0.01
      Note. MT-COX1 represents the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2. MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 represents the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.

    Logistic regression analysis was used to investigate the association between each locus and hypertension (Supplementary Table S8, available in www.besjournal.com). In the crude model, the methylation levels of MT-COX1Pos.1, MT-COX1, MT-COX3Pos.1, MT-ATP8Pos.1, MT-ATP8Pos.2, and MT-ATP8 were significantly associated with hypertension (P < 0.05). After adjusting for age, sex, BMI, smoking, drinking, exercise, antihypertensive treatment, and FBG, TG, and TC levels, there was a significant association between MT-COX1Pos.1, MT-COX1 and the risk of hypertension (P < 0.05). For each unit increase in MT-COX1Pos.1 methylation level, the risk of hypertension decreased by 5% (OR = 0.95, 95% CI: 0.92–0.99, P = 0.01). 5% decrease in hypertension risk was associated with MT-COX1 methylation levels every 1% increase (OR = 0.95, 95% CI: 0.90–0.99, P = 0.03). To further investigate the effect of different levels of mtDNA methylation on the risk of hypertension, methylation levels were divided into three groups according to tertiles. After adjusting for age, sex, BMI, smoking, drinking, exercise, antihypertensive treatment, FBG, TG, and TC, compared to the low-level group, the high-level group of MT-COX1 reduced by 36% of hypertension risks (P = 0.04) (Table 3). Our findings are similar to those of a previous study conducted by Corsi et al., who revealed that the methylation level of MT-COX1 was significantly associated with CVD risk in overweight and obese populations, and that the methylation of MT-COX1 may represent a novel intrinsic predictor of CVD risk in a certain population[7]. A review suggested that mitochondrial epigenetics is a new mechanism for understanding the pathophysiology of mitochondrial dysfunction, and that mtDNA methylation mainly affects mitochondrial function by replication, transcription, and translation, eventually leading to the occurrence of mitochondrial dysfunction-related diseases[9]. It has been reported that mitochondrial dysfunction is one of the molecular mechanisms underlying functional and morphological changes in aged vessels, which could lead to hypertension[10]. Thus, our results demonstrated that a higher mtDNA methylation level was associated with a lower risk of hypertension, which may help accumulate evidence on the genomic mechanisms for potential prevention and possible therapeutic targets for hypertension in the future.

    Table 3.  Association between MtDNA methylation level stratification and hypertension

    Loci Unadjusted model Adjusted model
    β value OR (95% CI) P value β value OR (95% CI) P value
    MT-COX1Pos.1
    Low level 1.00 1.00
    Middle level −0.16 0.85 (0.58–1.26) 0.42 −0.12 0.89 (0.58–1.35) 0.57
    High level −0.43 0.65 (0.44–0.96) 0.03 −0.40 0.67 (0.44–1.02) 0.06
    MT-COX1Pos.2
    Low level 1.00 1.00
    Middle level 0.46 1.58 (1.07–2.33) 0.02 0.30 1.35 (0.89–2.07) 0.16
    High level 0.19 1.20 (0.82–1.77) 0.35 −0.25 0.78 (0.51–1.21) 0.27
    MT-COX1
    Low level 1.00 1.00
    Middle level 0.31 1.37 (0.92–2.02) 0.12 0.21 1.24 (0.81–1.89) 0.33
    High level −0.28 0.75 (0.51–1.11) 0.15 −0.45 0.64 (0.42–0.98) 0.04
    MT-COX2
    Low level 1.00 1.00
    Middle level 0.09 1.09 (0.74–1.60) 0.66 −0.05 0.96 (0.63–1.45) 0.83
    High level 0.17 1.18 (0.80–1.75) 0.40 −0.05 0.95 (0.62–1.46) 0.82
    MT-COX3Pos.1 1
    Low level 1.00 1.00
    Middle level 0.45 1.56 (1.06–2.30) 0.02 0.08 1.08 (0.69–1.68) 0.74
    High level 0.76 2.14 (1.44–3.18) < 0.001 0.03 1.03 (0.63–1.69) 0.90
    MT-COX3Pos.2
    Low level 1.00 1.00
    Middle level 0.43 1.54 (1.04–2.27) 0.03 0.26 1.30 (0.84–2.01) 0.24
    High level 0.10 1.10 (0.75–1.62) 0.62 −0.06 0.94 (0.61–1.44) 0.78
    MT-COX3
    Low level 1.00 1.00
    Middle level 0.52 1.69 (1.14–2.49) < 0.001 0.33 1.38 (0.90–2.13) 0.14
    High level 0.47 1.60 (1.08–2.36) 0.02 0.01 1.01 (0.64–1.59) 0.98
    MT-ATP6Pos.1
    Low level 1.00 1.00
    Middle level 0.14 1.14 (0.78–1.69) 0.49 0.29 1.33 (0.87–2.04) 0.19
    High level −0.14 0.87 (0.59–1.29) 0.17 0.15 1.17 (0.76–1.78) 0.48
    MT-ATP6Pos.2
    Low level 1.00 1.00
    Middle level −0.10 0.91 (0.61–1.33) 0.61 −0.25 0.78 (0.51–1.20) 0.26
    High level −0.20 0.82 (0.56–1.21) 0.32 −0.35 0.71 (0.46–1.09) 0.11
    MT-ATP6Pos.3
    Low level 1.00 1.00
    Middle level 0.08 1.08 (0.73–1.59) 0.70 0.16 1.17 (0.77–1.79) 0.47
    High level −0.20 0.82 (0.59–1.21) 0.32 −0.10 0.90 (0.59–1.37) 0.63
    MT-ATP6
    Low level 1.00 1.00
    Middle level −0.03 0.97 (0.66–1.43) 0.87 0.03 1.03 (0.67–1.57) 0.89
    High level −0.21 0.83 (0.55–1.20) 0.30 −0.13 0.88 (0.58–1.34) 0.56
    MT-ATP8Pos.1
    Low level 1.00 1.00
    Middle level −0.54 0.58 (0.39–0.86) < 0.01 −0.33 0.71 (0.47–1.10) 0.13
    High level −0.58 0.56 (0.38–0.83) < 0.01 −0.22 0.80 (0.52–1.25) 0.32
    MT-ATP8Pos.2
    Low level 1.00 1.00
    Middle level −0.51 0.60 (0.41–0.89) 0.01 −0.22 0.81 (0.52–1.24) 0.33
    High level −0.48 0.62 (0.42–0.92) 0.02 −0.13 0.88 (0.57–1.37) 0.58
    MT-ATP8
    Low level 1.00 1.00
    Middle level −0.44 0.65 (0.44–0.96) 0.03 −0.21 0.82 (0.53–1.26) 0.36
    High level −0.52 0.60 (0.40–0.89) 0.01 −0.16 0.86 (0.55–1.34) 0.49
      Note. Adjusted model: adjusted for age, sex, BMI, smoking, drinking, exercise, hypertensive treatment, FBG, TC, and TG.

    However, there are still some limitations in this study: first, this study showed a cross-sectional association between mtDNA methylation and the prevalence of hypertension, but which could not draw any conclusions on the long-term effects of mtDNA methylation on the development of hypertension. In addition, blood pressure was measured using a sphygmomanometer during the physical examination as one of the criteria for defining hypertension, which may cause confusion owing to white-coat hypertension. Finally, the study population was relatively small and was limited to individuals from northern China. Therefore, the results of our study should be replicated and verified in other populations.

    • The authors declare no conflict of interest.

    • Figure S1.  Odds ratios of risk factors for hypertension.

      Table S2.  Comparison of methylation levels between male and female hypertensive patients

      LociMale group (N = 25)Female group (N = 312)Z valueP value
      MT-COX1Pos.19.38 (4.25)10.24 (4.12)−0.850.39
      MT-COX1Pos.28.43 (3.52)7.75 (2.84)−0.620.53
      MT-COX19.09 (3.70)8.72 (3.31)−0.280.78
      MT-COX25.46 (2.60)5.61 (2.60)−0.050.96
      MT-COX3Pos.14.43 (1.42)4.85 (1.54)−1.090.27
      MT-COX3Pos.23.66 (1.38)3.81 (1.18)−0.750.45
      MT-COX34.10 (1.32)4.34 (1.16)−1.140.25
      MT-ATP6Pos.118.12 (3.44)17.53 (5.33)−0.440.66
      MT-ATP6Pos.210.34 (4.39)10.68 (3.97)−1.220.22
      MT-ATP6Pos.313.85 (6.71)13.04 (5.56)−0.380.70
      MT-ATP614.26 (4.77)13.58 (4.09)−0.070.94
      MT-ATP8Pos.17.32 (5.24)6.35 (4.07)−1.460.14
      MT-ATP8Pos.27.10 (4.77)6.04 (3.59)−1.180.24
      MT-ATP86.77 (5.03)6.20 (3.76)−1.310.19
        Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.

      Table S3.  Comparison of methylation levels between BMI ≥ 24 and < 24 hypertensive patients

      LociBMI < 24 (N = 101)BMI ≥ 24 (N = 236)Z valueP value
      MT-COX1Pos.19.48 (4.06)9.46 (4.22)−0.410.68
      MT-COX1Pos.28.22 (2.90)7.73 (2.78)−1.060.29
      MT-COX18.99 (3.39)8.56 (3.23)−0.800.43
      MT-COX25.53 (2.61)5.68 (2.63)−1.540.12
      MT-COX3Pos.14.74 (1.60)4.91 (1.52)−1.000.32
      MT-COX3Pos.23.81 (1.04)3.80 (1.19)−0.060.95
      MT-COX34.22 (1.11)4.35 (1.22)−0.340.74
      MT-ATP6Pos.117.41 (4.90)17.65 (5.32)−0.270.78
      MT-ATP6Pos.210.58 (3.99)10.68 (3.97)−0.180.86
      MT-ATP6Pos.313.08 (6.05)13.12 (5.56)−0.140.89
      MT-ATP613.73 (3.93)13.70 (4.19)−0.100.92
      MT-ATP8Pos.16.26 (4.27)6.46 (4.05)−0.020.98
      MT-ATP8Pos.26.07 (3.40)6.03 (3.59)−0.300.77
      MT-ATP86.15 (3.89)6.26 (3.92)−0.130.90
        Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.

      Table S4.  Comparison of methylation levels between age ≥ 60 and < 60 hypertensive patients

      LociAge < 60 (N = 139)Age ≥ 60 (N = 198)Z valueP value
      MT-COX1Pos.19.18 (4.57)9.64 (3.98)−0.780.43
      MT-COX1Pos.27.27 (2.68)8.22 (3.18)−3.58< 0.001
      MT-COX18.41 (3.22)8.93 (3.42)−2.060.04
      MT-COX25.38 (2.63)5.71 (2.45)−1.910.056
      MT-COX3Pos.14.01 (1.55)5.23 (1.15)−8.93< 0.001
      MT-COX3Pos.23.68 (1.42)3.86 (1.08)−1.660.10
      MT-COX33.91 (1.35)4.61 (0.99)−6.48< 0.001
      MT-ATP6Pos.118.40 (4.74)17.09 (4.82)−2.920.004
      MT-ATP6Pos.29.57 (4.04)10.92 (3.64)−3.270.001
      MT-ATP6Pos.312.95 (5.17)13.20 (6.16)−0.490.62
      MT-ATP613.80 (4.06)13.46 (4.11)−0.640.52
      MT-ATP8Pos.17.86 (3.78)5.35 (3.24)−7.17< 0.001
      MT-ATP8Pos.27.41 (3.66)5.19 (2.97)−6.66< 0.001
      MT-ATP87.70 (3.23)5.40 (3.17)−7.14< 0.001
        Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.

      Table S5.  Comparison of methylation levels between smoking and non-smoking hypertensive patients

      LociNon-smoking (N = 177)Smoking (N = 158)Z valueP value
      MT-COX1Pos.110.20 ± 4.2610.22 (4.34)−0.240.81
      MT-COX1Pos.27.85 (3.09)7.75 (2.82)−0.210.83
      MT-COX18.72 (3.20)8.74 (3.46)−0.040.97
      MT-COX25.45 (2.47)5.76 (2.79)−0.270.79
      MT-COX3Pos.14.77 (1.57)4.94 (1.49)−1.270.21
      MT-COX3Pos.23.66 (1.12)3.92 (1.01)−2.66< 0.01
      MT-COX34.19 (1.17)4.43 (1.05)−2.380.02
      MT-ATP6Pos.116.55 (5.66)17.80 (4.15)−3.03< 0.01
      MT-ATP6Pos.210.43 (3.67)10.88 (4.01)−1.220.22
      MT-ATP6Pos.312.79 (5.72)13.37 (5.76)−1.450.15
      MT-ATP612.97 (4.56)14.18 (3.65)−2.010.04
      MT-ATP8Pos.16.35 (4.58)6.49 (4.10)−0.560.58
      MT-ATP8Pos.25.94 (3.86)6.09 (3.46)−0.200.85
      MT-ATP86.15 (4.37)6.32 (3.57)−0.420.68
        Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.

      Table S6.  Comparison of methylation levels between drinking and non-drinking hypertensive patients

      Loci Non-drinking (N = 198) Drinking (N =137) Z value P value
      MT-COX1Pos.1 9.42 (4.31) 9.58 (4.39) −0.75 0.46
      MT-COX1Pos.2 7.76 (2.83) 7.85 (3.04) −0.71 0.48
      MT-COX1 8.72 (3.12) 9.37 (3.94) −0.63 0.53
      MT-COX2 5.47 (2.52) 5.68 (2.70) −0.04 0.97
      MT-COX3Pos.1 4.78 (1.52) 4.98 (1.48) −1.23 0.22
      MT-COX3Pos.2 3.68 (1.11) 3.92 (1.03) −2.32 0.02
      MT-COX3 4.19 (1.18) 4.44 (1.01) −2.20 0.03
      MT-ATP6Pos.1 16.78 (5.32) 18.13 (4.31) −2.42 0.02
      MT-ATP6Pos.2 10.52 (3.59) 10.78 (4.23) −1.28 0.20
      MT-ATP6Pos.3 12.78 (5.62) 13.66 (5.86) −1.29 0.20
      MT-ATP6 13.20 (4.28) 14.37 (3.99) −1.86 0.06
      MT-ATP8Pos.1 6.16 (4.39) 6.59 (3.91) −0.20 0.85
      MT-ATP8Pos.2 5.86 (3.59) 6.51 (3.69) −1.00 0.32
      MT-ATP8 6.01 (4.10) 6.50 (3.47) −0.60 0.55
        Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.

      Table S7.  Comparison of methylation levels between with anti-hypertensive treatment and without anti-hypertensive treatment patients

      Loci Hypertension group Z value P value
      Anti-hypertensive treatment (56) Without anti-hypertensive treatment (281)
      MT-COX1Pos.1 8.77 (3.47) 9.62 (4.12) −1.62 0.11
      MT-COX1Pos.2 8.13 (2.47) 7.76 (3.06) −0.27 0.79
      MT-COX1 8.53 (2.61) 8.83 (3.42) −0.93 0.35
      MT-COX2 5.75 (2.68) 5.50 (2.62) −1.14 0.26
      MT-COX3Pos.1 5.06 (1.51) 4.82 (1.57) −1.48 0.14
      MT-COX3Pos.2 3.68 (1.45) 3.83 (1.07) −0.21 0.83
      MT-COX3 4.39 (1.09) 4.30 (1.20) −0.72 0.47
      MT-ATP6Pos.1 15.80 (4.75) 17.97 (4.90) −2.70 0.01
      MT-ATP6Pos.2 9.99 (3.80) 10.68 (3.96) −1.14 0.25
      MT-ATP6Pos.3 12.79 (6.16) 13.12 (5.71) −1.41 0.16
      MT-ATP6 12.93 (4.33) 14.01 (4.08) −1.89 0.06
      MT-ATP8Pos.1 6.81 (3.97) 6.35 (4.13) −0.23 0.82
      MT-ATP8Pos.2 5.87 (3.40) 6.07 (3.65) −0.01 0.99
      MT-ATP8 6.28 (3.66) 6.24 (3.89) −0.13 0.90
        Note. Continuous variables that do not conform to the normal distribution are descripted by median and interquartile range, and the differences both two groups are compared by Mann-Whitney U test. The categorical variables were presented using frequency and percentage, and the differences both two groups were compared by chi-square test. MT-COX1 is the average methylation level of MT-COX1Pos.1 and MT-COX1Pos.2; MT-COX3 is the mean methylation level of MT-COX3Pos.1 and MT-COX3Pos.2; MT-ATP6 is the average methylation level of MT-ATP6 Pos.1, MT-ATP6 Pos.2 and MT-ATP6 Pos.3; MT-ATP8 is the mean methylation level of MT-ATP8 Pos.1 and MT-ATP8 Pos.2.

      Table S8.  Association between mtDNA methylation level and the risk of hypertension

      Loci Unadjusted model Adjusted model
      β value OR (95% CI) P value β value OR (95% CI) P value
      MT-COX1Pos.1 −0.06 0.95 (0.91–0.98) < 0.001 −0.05 0.95 (0.92–0.99) 0.01
      MT-COX1Pos.2 0.01 0.99 (0.94–1.03) 0.58 −0.04 0.96 (0.91–1.01) 0.12
      MT-COX1 −0.05 0.95 (0.91–1.00) 0.03 −0.06 0.95 (0.90–0.99) 0.03
      MT-COX2 −0.03 0.98 (0.93–1.03) 0.33 −0.04 0.96 (0.90–1.02) 0.17
      MT-COX3Pos.1 0.13 1.14 (1.02–1.29) 0.03 −0.06 0.94 (0.82–1.08) 0.38
      MT-COX3Pos.2 −0.06 0.95 (0.84–1.07) 0.37 −0.12 0.89 (0.77–1.03) 0.12
      MT-COX3 0.06 1.06 (0.93–1.20) 0.39 −0.11 0.90 (0.76–1.05) 0.19
      MT-ATP6Pos.1 −0.03 0.97 (0.94–1.01) 0.13 −0.01 0.99 (0.96–1.03) 0.72
      MT-ATP6Pos.2 −0.03 0.97 (0.92–1.02) 0.25 −0.05 0.95 (0.90–1.01) 0.12
      MT-ATP6Pos.3 −0.02 0.99 (0.96–1.01) 0.29 −0.01 0.99 (0.96–1.02) 0.62
      MT-ATP6 −0.03 0.97 (0.93–1.01) 0.16 −0.02 0.98 (0.94–1.03) 0.44
      MT-ATP8Pos.1 −0.06 0.94 (0.89–0.99) 0.01 −0.02 0.98 (0.93–1.03) 0.42
      MT-ATP8Pos.2 −0.07 0.93 (0.89–0.98) < 0.001 −0.04 0.96 (0.92–1.02) 0.16
      MT-ATP8 −0.08 0.93 (0.88–0.98) < 0.001 −0.04 0.97 (0.91–1.02) 0.22
        Note. Adjusted model: adjusted for age, gender, BMI, smoking, drinking, exercise, hypertensive treatment, FBG, TC, and TG.
参考文献 (10)
补充材料:
23098+Supplementary Materials.pdf

目录

    /

    返回文章
    返回