Development of a High-throughput Sequencing Platform for Detection of Viral Encephalitis Pathogens Based on Amplicon Sequencing

ZHANG Ya Li SU Wen Zhe WANG Rui Chen LI Yan ZHANG Jun Feng LIU Sheng Hui HU Dan He XU Chong Xiao YIN Jia Yu YIN Qi Kai HE Ying LI Fan FU Shi Hong NIE Kai LIANG Guo Dong TAO Yong XU Song Tao MA Chao Feng WANG Huan Yu

ZHANG Ya Li, SU Wen Zhe, WANG Rui Chen, LI Yan, ZHANG Jun Feng, LIU Sheng Hui, HU Dan He, XU Chong Xiao, YIN Jia Yu, YIN Qi Kai, HE Ying, LI Fan, FU Shi Hong, NIE Kai, LIANG Guo Dong, TAO Yong, XU Song Tao, MA Chao Feng, WANG Huan Yu. Development of a High-throughput Sequencing Platform for Detection of Viral Encephalitis Pathogens Based on Amplicon Sequencing[J]. Biomedical and Environmental Sciences, 2024, 37(3): 294-302. doi: 10.3967/bes2024.032
Citation: ZHANG Ya Li, SU Wen Zhe, WANG Rui Chen, LI Yan, ZHANG Jun Feng, LIU Sheng Hui, HU Dan He, XU Chong Xiao, YIN Jia Yu, YIN Qi Kai, HE Ying, LI Fan, FU Shi Hong, NIE Kai, LIANG Guo Dong, TAO Yong, XU Song Tao, MA Chao Feng, WANG Huan Yu. Development of a High-throughput Sequencing Platform for Detection of Viral Encephalitis Pathogens Based on Amplicon Sequencing[J]. Biomedical and Environmental Sciences, 2024, 37(3): 294-302. doi: 10.3967/bes2024.032

doi: 10.3967/bes2024.032

Development of a High-throughput Sequencing Platform for Detection of Viral Encephalitis Pathogens Based on Amplicon Sequencing

Funds: This study was supported by the National Key Research and Development Program (grant number: 2022YFC2305304).
More Information
    Author Bio:

    ZHANG Ya Li, female, born in 1997, MPH, majoring in disease prevention and surveillance, and molecular epidemiology

    SU Wen Zhe, male, born in 1987, MPH, Associate Professor of Public Health, majoring in molecular epidemiology and laboratory diagosis of arboviruses

    Corresponding author: XU Song Tao, E-mail: xust@ivdc.chinacdc.cnMA Chao Feng, E-mail: mark7447@xiancdc.cnWANG Huan Yu, E-mail: wanghy@ivdc.chinacdc.cn
  • XU Song Tao, MA Chao Feng and WANG Huan Yu conceived and designed the experiments. ZHANG Ya Li, SU Wen Zhe, and WANG Rui Chen performed the experiments and analyzed the data. LI Yan, ZHANG Jun Feng, LIU Sheng Hui, HU Dan He, and XU Chong Xiao designed the experimental protocols. YIN Jia Yu, YIN Qi Kai, HE Ying, LI Fan, FU Shi Hong, NIE Kai, LIANG Guo Dong, and TAO Yong contributed reagents, materials, and analytical tools. ZHANG Ya Li wrote the paper. XU Song Tao, MA Chao Feng and WANG Huan Yu interpreted the results and critically read the manuscript.
  • The authors have no conflicts of interest to declare.
  • &These authors contributed equally to this work.
    • 关键词:
    •  / 
    •  / 
    •  / 
    •  
    XU Song Tao, MA Chao Feng and WANG Huan Yu conceived and designed the experiments. ZHANG Ya Li, SU Wen Zhe, and WANG Rui Chen performed the experiments and analyzed the data. LI Yan, ZHANG Jun Feng, LIU Sheng Hui, HU Dan He, and XU Chong Xiao designed the experimental protocols. YIN Jia Yu, YIN Qi Kai, HE Ying, LI Fan, FU Shi Hong, NIE Kai, LIANG Guo Dong, and TAO Yong contributed reagents, materials, and analytical tools. ZHANG Ya Li wrote the paper. XU Song Tao, MA Chao Feng and WANG Huan Yu interpreted the results and critically read the manuscript.
    The authors have no conflicts of interest to declare.
    &These authors contributed equally to this work.
    注释:
    1) AUTHOR CONTRIBUTIONS: 2) CONFLICTS OF INTEREST:
  • Figure  1.  Amplicon sequencing workflow.

    Figure  2.  Coverage and sequencing depth map of pathogen target sequences. Coverage and sequencing depth of pathogen target sequences result: A shows the results of the pre-experiments, showing the coverage and sequencing depth of HSV-1, HSV-2, HCMV, EBV, VZV, JEV, WNV, EV71, CA6, CA10, CA16 and Mumps target sequences; B shows the sequencing results of samples at 10-fold dilution, showing the coverage and sequencing depth of VZV, JEV, WNV, EV71, CA6, CA10, CA16 and Mumps target sequences; C shows the sequencing results of the sample at 100-fold dilution, showing the coverage and sequencing depth of HCMV, EBV, VZV, JEV, WNV, EV71, CA6, CA10, CA16 and Mumps target sequences; D shows the sequencing results of samples at 1000-fold dilution, showing the coverage and sequencing depth of HSV-1, HSV-2, HCMV, EBV, VZV, JEV, WNV, EV71,CA6, CA10, CA16 and Mumps target sequences.

    Table  1.   Summary of primers for various pathogens

    Primer
    name
    Primer sequence (5'–3') Amplicon size (bp) Target gene Ref
    HSV-1-F
    HSV-1-R
    GGTCAGCTCGTGATTCTGCA
    CGCATCAAGACCACCTCCTC
    106 UL27
    HSV-2-F
    HSV-2-R
    CTAGTTGTCGCGGTGGGACT
    TAGTACACAGTGATCGGGAT
    212 US5 [14]
    EBV-F
    EBV-R
    CTCTAACTCCAACGAGGGCAG
    GAGGGCCTCCATCATTTCC

    320

    LMP1


    HCMV-F
    HCMV-R
    AATGATATCCGTACTGGGTCCCATT
    TGATGATGGGGATGTTCAGCAT

    350

    UL83


    VZV-F
    VZV-R
    GGGTTTTGTATGAGCGTTGG
    CCCCCGAGGTTCGTAATATC
    447 ORF22
    [15]
    JEV-F
    JEV-R
    CGTTCTTCAAGTTTACAGCATTAGC
    CCYRTGTTYCTGCCAAGCATCCAMCC
    674 E [16]
    WNV-F
    WNV-R
    ACCAACTACTGTGGAGTC
    TTCCATCTTCACTCTACACT
    445 E [17]
    EVs-F
    EVs-R
    TTCTGTTTCCCCGGACTGAG
    TAAAAGGAAACACGGACACCCA
    400 VP3
    Mumps-F
    Mumps-R
    AATATCAAGTAGTGTCGATGA
    AGGTGCAAAGGTGGCATTGTC
    316
    SH
    [18]
      Note. − is a self-designed primer; HSV-1, herpes simplex virus-1; HSV-2, herpes simplex virus-2; EBV, epstein-barr virus; HCMV, human cytomegalovirus; VZV, varicella zoster virus; JEV, Japanese encephalitis virus; WNV, west nile virus; EVs, Enteroviruses.
    下载: 导出CSV

    Table  2.   Summary of sequencing results for all pathogens

    VirusPre-experiments10-fold100-fold1,000-foldRef
    Ct-valueReadsCt-valueReadsCt-valueReadsCt-valueReads
    HSV127.98,67833.921,932NC_001806
    HSV228.26,30833.614,562NC_001798
    HCMV30.136,75230.854634.00NC_006273
    EBV29.621,30729.146,48233.123,902NC_007605
    VZV24.6774,36327.0961,16629.4986,69834.02,069,900NC_001348
    JEV25.8642,00127.4907,26330.4102,00133.518,209JE_U47032
    WNV25.31,073,38827.2790,72931.0430,33234.7884,879NC_009942
    EV7124.12,225,72626.92,951,55331.62,178,52433.73,449,881AY_4653561
    CA626.92,013,31228.12,973,42232.72,195,62435.53,538,523KX_064282
    CA1021.12,401,00629.12,976,27331.22,213,09333.53,597,826KP_289398
    CA1624.42,563,54528.82,959,41631.42,189,64234.63,513,948JQ_354992
    Mumps23.1903,85825.2928,42930.5479,97833.2119,500NC_002200
      Note. — Indicates no data. HSV-1, herpes simplex virus-1; HSV-2, herpes simplex virus-2; EBV,epstein-barr virus; HCMV, human cytomegalovirus; VZV, varicella zoster virus; JEV, Japanese encephalitis virus;WNV, west nile virus; EVs, Enteroviruses
    下载: 导出CSV
  • [1] Hinson VK, Tyor WR. Update on viral encephalitis. Curr Opin Neurol, 2001; 14, 369−74. doi:  10.1097/00019052-200106000-00017
    [2] Huang SS, Zhou WM, Wang MJ, et al. The disease burden of viral encephalitis in China between 1990 and 2019. New Med, 2022; 32, 241−9. (In Chinese
    [3] Moon SM, Kim T, Lee EM, et al. Comparison of clinical manifestations, outcomes and cerebrospinal fluid findings between herpes simplex type 1 and type 2 central nervous system infections in adults. J Med Virol, 2014; 86, 1766−71. doi:  10.1002/jmv.23999
    [4] Li XL, Gao XY, Fu SH, et al. An outbreak of Japanese encephalitis in adults in Northern China, 2013: a population-based study. Vector-Borne Zoonotic Dis, 2019; 19, 26−34. doi:  10.1089/vbz.2017.2251
    [5] Wu D, Chen XJ, Liu WJ, et al. Emergence of Japanese encephalitis among adults 40 years of age or older in Northern China: epidemiological and clinical characteristics. Transbound Emerg Dis, 2021; 68, 3415−23. doi:  10.1111/tbed.13945
    [6] Zhang YP, Lei WW, Wang YL, et al. Surveillance of west Nile virus infection in Kashgar Region, Xinjiang, China, 2013-2016. Sci Rep, 2021; 11, 14010. doi:  10.1038/s41598-021-93309-2
    [7] Rhoades RE, Tabor-Godwin JM, Tsueng G, et al. Enterovirus infections of the central nervous system. Virology, 2011; 411, 288−305. doi:  10.1016/j.virol.2010.12.014
    [8] Zhang CR, Xie FJ, Jiang JX. Research advances on hand foot and mouth disease complicated with central nervous system damage. Chin J New Clin Med, 2011; 4, 674−7. (In Chinese
    [9] Wang X, Tian YL, Jiang HB, et al. Analysis on pathogeny and clinical of encephalitis and meningitis syndrome in children. Chin J Appl Clin Pediatr, 2019; 34, 926−9. (In Chinese
    [10] Guan HY, Wang CR, Liu LZ, et al. Epidemiological survey and rapid etiological identification of an clustered viral encephalitis in Jinan, 2014. Chin J Appl Clin Pediatr, 2015; 30, 769−71. (In Chinese
    [11] Perlejewski K, Bukowska-Ośko I, Rydzanicz M, et al. Next-generation sequencing in the diagnosis of viral encephalitis: sensitivity and clinical limitations. Sci Rep, 2020; 10, 16173. doi:  10.1038/s41598-020-73156-3
    [12] Kafetzopoulou LE, Efthymiadis K, Lewandowski K, et al. Assessment of metagenomic Nanopore and Illumina sequencing for recovering whole genome sequences of chikungunya and dengue viruses directly from clinical samples. Euro Surveill, 2018; 23, 1800228.
    [13] Deng XD, Achari A, Federman S, et al. Metagenomic sequencing with spiked primer enrichment for viral diagnostics and genomic surveillance. Nat Microbiol, 2020; 5, 443−54. doi:  10.1038/s41564-019-0637-9
    [14] Durzyńska J, Pacholska-Bogalska J, Kaczmarek M, et al. Multiplex PCR for identification of herpes virus infections in adolescents. J Med Virol, 2011; 83, 267−71. doi:  10.1002/jmv.21972
    [15] Xu ST, Chen MK, Zheng HY, et al. Nationwide distribution of varicella-zoster virus clades in China. BMC Infect Dis, 2016; 16, 542. doi:  10.1186/s12879-016-1863-x
    [16] Wang HY, Takasaki T, Fu SH, et al. Molecular epidemiological analysis of Japanese encephalitis virus in China. J Gen Virol, 2007; 88, 885−94. doi:  10.1099/vir.0.82185-0
    [17] Zhang JS, Zhang PH, Zuo SQ, et al. Establishment and preliminary use of the RT-PCR technique for the detection of west Nile virus. Chin J Zoonoses, 2004; 20, 737−40. (In Chinese
    [18] Cui AL, Zhu Z, Wang CY, et al. Genetic characteristics of mumps virus in China from 2006 to 2008. Chin J Vaccines Immu, 2009; 15, 8−13. (In Chinese
    [19] Stahl JP, Azouvi P, Bruneel F, et al. Guidelines on the management of infectious encephalitis in adults. Med Mal Infect, 2017; 47, 179−94. doi:  10.1016/j.medmal.2017.01.005
    [20] Zanella MC, Lenggenhager L, Schrenzel J, et al. High-throughput sequencing for the aetiologic identification of viral encephalitis, meningoencephalitis, and meningitis. A narrative review and clinical appraisal. Clin Microbiol Infect, 2019; 25, 422−30. doi:  10.1016/j.cmi.2018.12.022
    [21] Carbo EC, Buddingh EP, Karelioti E, et al. Improved diagnosis of viral encephalitis in adult and pediatric hematological patients using viral metagenomics. J Clin Virol, 2020; 130, 104566. doi:  10.1016/j.jcv.2020.104566
    [22] Schibler M, Brito F, Zanella MC, et al. Viral sequences detection by high-throughput sequencing in cerebrospinal fluid of individuals with and without central nervous system disease. Genes (Basel), 2019; 10, 625. doi:  10.3390/genes10080625
    [23] Leon KE, Schubert RD, Casas-Alba D, et al. Genomic and serologic characterization of enterovirus A71 brainstem encephalitis. Neurol Neuroimmunol Neuroinflamm, 2020; 7, e703. doi:  10.1212/NXI.0000000000000703
    [24] Wang L, Chen F, You DP, et al. Development and validation of a multiplex-PCR based assay for the detection of 18 pathogens in the cerebrospinal fluid of hospitalized children with viral encephalitis. J Virol Methods, 2020; 277, 113804. doi:  10.1016/j.jviromet.2019.113804
    [25] Paden CR, Tao Y, Queen K, et al. Rapid, sensitive, full-genome sequencing of severe acute respiratory syndrome coronavirus 2. Emerg Infect Dis, 2020; 26, 2401−5. doi:  10.3201/eid2610.201800
    [26] Zhang LL, Zhang C, Peng JP. Application of nanopore sequencing technology in the clinical diagnosis of infectious diseases. Biomed Environ Sci, 2022; 35, 381−92.
  • [1] Lulu Zhang, Junping Peng.  High-throughput Sequencing for Tuberculosis Diagnosis and Antimicrobial Resistance Detection: Progress, Challenges, and Future Perspectives . Biomedical and Environmental Sciences, 2026, 39(2): 223-233. doi: 10.3967/bes2025.164
    [2] Songtao Xu, Zhuyun Qian, Yong Tao.  Chinese Expert Consensus on the Application of Metagenomic Sequencing Technology in Ocular Infectious Diseases: A Delphi Method . Biomedical and Environmental Sciences, 2025, 38(12): 1550-1557. doi: 10.3967/bes2025.156
    [3] Chongyang She, Wenying Fan, Yunyun Li, Yong Tao, Zufei Li.  Predicting Diabetic Retinopathy Using a Machine Learning Approach Informed by Whole-Exome Sequencing Studies . Biomedical and Environmental Sciences, 2025, 38(1): 67-78. doi: 10.3967/bes2025.002
    [4] Lingyun Ji, Xinxin Chen, Bo Chen, Ning Jin, Ji Yang.  Diagnostic Value of Cerebrospinal Fluid Sequencing for Neurosyphilis with Cognitive Impairment . Biomedical and Environmental Sciences, 2024, 37(11): 1334-1337. doi: 10.3967/bes2024.167
    [5] FAN Yu Feng, LIU Dong Xin, CHEN Yi Wang, OU Xi Chao, MAO Qi Zhi, YANG Ting Ting, WANG Xi Jiang, HE Wen Cong, ZHAO Bing, LIU Zhen Jiang, ABULIMITI Maiweilanjiang, AIHEMUTI Maimaitiaili, GAO Qian, ZHAO Yan Lin.  Inferring Mycobacterium Tuberculosis Drug Resistance and Transmission using Whole-genome Sequencing in a High TB-burden Setting in China . Biomedical and Environmental Sciences, 2024, 37(2): 157-169. doi: 10.3967/bes2023.116
    [6] XI Hui, LIU Qin, XIE Dong Hua, ZHOU Xu, TANG Wang Lan, TANG De Guo, ZENG Chun Yan, WANG Qiong, NIE Xing Hui, PENG Jin Ping, GAO Xiao Ya, WU Hong Liang, ZHANG Hao Qing, QIU Li, FENG Zong Hui, WANG Shu Yuan, ZHOU Shu Xiang, HE Jun, ZHOU Shi Hao, ZHOU Fa Qun, ZHENG Jun Qing, WANG Shun Yao, CHEN Shi Ping, ZHENG Zhi Fen, MA Xiao Yuan, FANG Jun Qun, LIANG Chang Biao, WANG Hua.  Epidemiological Survey of Hemoglobinopathies Based on Next-Generation Sequencing Platform in Hunan Province, China . Biomedical and Environmental Sciences, 2023, 36(2): 127-134. doi: 10.3967/bes2023.016
    [7] SHI Da Wei, WANG Dong Mei, NING Li Hua, LI Jing, DONG Yan, ZHANG Zhi Kun, DOU Hai Wei, WAN Rui Jie, JIA Chun Mei, XIN De LI.  Using 16S rDNA Sequencing Technology to Preliminarily Analyze Intestinal Flora in Children with Mycoplasma pneumoniae Pneumonia . Biomedical and Environmental Sciences, 2022, 35(6): 528-537. doi: 10.3967/bes2022.070
    [8] ZHU Rui Qing, SONG Le Quan, JIANG Lin, LIU Yu, ZHAO Li, WANG Hao Yu, ZHANG Jing, XU Xin Ping, DONG Ji, YAO Bin Wei, ZHAO Xue Long, WANG Hui, SHI Xu Liang, PENG Rui Yun.  Transcriptome Sequencing of mRNA and lncRNA in Hippocampal Tissues of Rats under Microwave Exposure . Biomedical and Environmental Sciences, 2022, 35(11): 1079-1084. doi: 10.3967/bes2022.137
    [9] ZHANG Lu Lu, ZHANG Chi, PENG Jun Ping.  Application of Nanopore Sequencing Technology in the Clinical Diagnosis of Infectious Diseases . Biomedical and Environmental Sciences, 2022, 35(5): 381-392. doi: 10.3967/bes2022.054
    [10] SHU Qing Ming, CHEN Xin Guo, ZHANG Hong Ying, HUANG Li Hong, ZHANG Yong Liang, ZHANG Qing.  Whole-Exome Sequencing Identifies Origin of Recurrent Hepatocellular Carcinoma after Liver Transplantation: A Case Report . Biomedical and Environmental Sciences, 2020, 33(7): 538-542. doi: 10.3967/bes2020.070
    [11] CHEN Wei, WENG Yu Wei, HE Wen Xiang, ZHU Ying, YU Ting Ting, XIE Jian Feng, ZHENG Kui Cheng, YAN Yan Sheng, ZHANG Yong Jun, ZHANG Wen Chang.  RT-nPCR Assays for Amplification and Sequencing of VP1 Genes in Human Enterovirus A–D from Clinical Specimens . Biomedical and Environmental Sciences, 2020, 33(11): 829-838. doi: 10.3967/bes2020.113
    [12] LI Xiang Dong, FU Shi Hong, CHEN Ling Yan, LI Fan, DENG Jun Hua, LU Xuan Cheng, WANG Huan Yu, TIAN Ke Gong.  Detection of Pseudorabies Virus Antibodies in Human Encephalitis Cases . Biomedical and Environmental Sciences, 2020, 33(6): 444-447. doi: 10.3967/bes2020.059
    [13] WANG Qian Ying, LI Fan, SHEN Xin Xin, FU Shi Hong, HE Ying, LEI Wen Wen, LIANG Guo Dong, WANG Huan Yun, MA Xue Jun.  A Reverse-transcription Recombinase-aided Amplification Assay for the Rapid Detection of the Far-Eastern Subtype of Tick-borne Encephalitis Virus . Biomedical and Environmental Sciences, 2019, 32(5): 357-362. doi: 10.3967/bes2019.047
    [14] CHE Jie, LU Jin Xing, LI Wen Ge, ZHANG Yun Fei, ZHAO Xiao Fei, YUAN Min, BAI Xue Mei, CHEN Xia, LI Juan.  A New High-throughput Real-time PCR Assay for the Screening of Multiple Antimicrobial Resistance Genes in Broiler Fecal Samples from China . Biomedical and Environmental Sciences, 2019, 32(12): 881-892. doi: 10.3967/bes2019.111
    [15] WANG Ji, KE Yue Hua, ZHANG Yong, HUANG Ke Qiang, WANG Lei, SHEN Xin Xin, DONG Xiao Ping, XU Wen Bo, MA Xue Jun.  Rapid and Accurate Sequencing of Enterovirus Genomes Using MinION Nanopore Sequencer . Biomedical and Environmental Sciences, 2017, 30(10): 718-726. doi: 10.3967/bes2017.097
    [16] WANG Chun Hua, NIE Kai, ZHANG Yi, WANG Ji, ZHOU Shuai Feng, LI Xin Na, ZHOU Hang Yu, QI Shun Xiang, MA Xue Jun.  An Improved Barcoded Oligonucleotide Primers-based Next-generation Sequencing Approach for Direct Identification of Viral Pathogens in Clinical Specimens . Biomedical and Environmental Sciences, 2017, 30(1): 22-34. doi: 10.3967/bes2017.003
    [17] ZOU Xiao Hui, CHEN Wen Bing, ZHAO Xiang, ZHU Wen Fei, YANG Lei, WANG Da Yan, SHU Yue Long.  Evaluation ofA Single-reaction Method for Whole Genome Sequencing of Influenza A Virus using Next Generation Sequencing . Biomedical and Environmental Sciences, 2016, 29(1): 41-46. doi: 10.3967/bes2016.004
    [18] CAI Yu Pin, YANG Yi, ZHU Bao Li, LI Yuan, XIA Xiao Yu, ZHANG Rui Fen, XIANG Yang.  Comparison of Human Papillomavirus Detection and Genotyping with Four Different Prime Sets by PCR-Sequencing . Biomedical and Environmental Sciences, 2013, 26(1): 40-47. doi: 10.3967/0895-3988.2013.01.005
    [19] ZHI-HUI ZHENG, GUO-PING LV, SHU-YI SI, YUE-SHENG DONG, BAO-HUA ZHAO, HUA ZHANG, JIAN-GONG HE.  A Cell-based High-throughput Screening Assay for Farnesoid X Recepter Agonist . Biomedical and Environmental Sciences, 2007, 20(6): 465-469.
    [20] DE-FENG TIAN, BIN HONG, SHUYI SI.  Development of a New High-throughput Screening Model for Human High Density Lipoprotein Receptor (CLA-1) Agonists . Biomedical and Environmental Sciences, 2005, 18(4): 265-272.
  • 加载中
图(2) / 表ll (2)
计量
  • 文章访问数:  688
  • HTML全文浏览量:  293
  • PDF下载量:  34
  • 被引次数: 0
出版历程
  • 收稿日期:  2023-06-12
  • 录用日期:  2023-10-17
  • 网络出版日期:  2024-04-07
  • 刊出日期:  2024-03-20

Development of a High-throughput Sequencing Platform for Detection of Viral Encephalitis Pathogens Based on Amplicon Sequencing

doi: 10.3967/bes2024.032
    基金项目:  This study was supported by the National Key Research and Development Program (grant number: 2022YFC2305304).
    作者简介:

    ZHANG Ya Li, female, born in 1997, MPH, majoring in disease prevention and surveillance, and molecular epidemiology

    SU Wen Zhe, male, born in 1987, MPH, Associate Professor of Public Health, majoring in molecular epidemiology and laboratory diagosis of arboviruses

    通讯作者: XU Song Tao, E-mail: xust@ivdc.chinacdc.cnMA Chao Feng, E-mail: mark7447@xiancdc.cnWANG Huan Yu, E-mail: wanghy@ivdc.chinacdc.cn
注释:
1) AUTHOR CONTRIBUTIONS: 2) CONFLICTS OF INTEREST:

English Abstract

ZHANG Ya Li, SU Wen Zhe, WANG Rui Chen, LI Yan, ZHANG Jun Feng, LIU Sheng Hui, HU Dan He, XU Chong Xiao, YIN Jia Yu, YIN Qi Kai, HE Ying, LI Fan, FU Shi Hong, NIE Kai, LIANG Guo Dong, TAO Yong, XU Song Tao, MA Chao Feng, WANG Huan Yu. Development of a High-throughput Sequencing Platform for Detection of Viral Encephalitis Pathogens Based on Amplicon Sequencing[J]. Biomedical and Environmental Sciences, 2024, 37(3): 294-302. doi: 10.3967/bes2024.032
Citation: ZHANG Ya Li, SU Wen Zhe, WANG Rui Chen, LI Yan, ZHANG Jun Feng, LIU Sheng Hui, HU Dan He, XU Chong Xiao, YIN Jia Yu, YIN Qi Kai, HE Ying, LI Fan, FU Shi Hong, NIE Kai, LIANG Guo Dong, TAO Yong, XU Song Tao, MA Chao Feng, WANG Huan Yu. Development of a High-throughput Sequencing Platform for Detection of Viral Encephalitis Pathogens Based on Amplicon Sequencing[J]. Biomedical and Environmental Sciences, 2024, 37(3): 294-302. doi: 10.3967/bes2024.032
    • Viral encephalitis is one of the most common central nervous system (CNS) infections, and its clinical symptoms include fever, headache, convulsions, and impaired consciousness. Cured patients may develop lasting neurological sequelae, resulting in a huge disease burden on the individuals, their families, and society. Various types of viruses, including herpes, flaviviruses, and enteroviruses, can cause viral encephalitis. According to epidemiological surveys, viral encephalitis occurs in all age groups, with a prevalence of 3.5–7.4/100,000 and a high rate of disability and death[1]. In China, viral encephalitis had an incidence rate of 15.27/100,000, prevalence rate of 74.34/100,000, and death rate of 0.24/100,000 in 2019[2], making it one of the most important infectious diseases threatening national health.

      Viral encephalitis is frequently caused by herpes simplex virus-1 (HSV-1), herpes simplex virus-2 (HSV-2), varicella zoster virus (VZV), Epstein-Barr virus (EBV), and human cytomegalovirus (HCMV). Among these, HSV-2 is more likely to cause meningitis[3], and HCMV-induced encephalitis mostly affects immunocompromised patients. Although other herpesviruses can cause encephalitis, only a few cases have been reported.

      The main insect-borne pathogens that cause viral encephalitis are the Japanese encephalitis virus (JEV) and the West Nile virus (WNV), both of which belong to the family Flaviviridae and the genus Flavivirus. Japanese encephalitis (JE) is the most common type of viral encephalitis and has the highest disease burden worldwide. In recent years, the incidence of adult JE has been high in the northern region of China, and the population in this area has become the main population affected by JE. In 2013, 407 cases of JE were reported in Shandong Province, of which 73% were over 15 years of age[4]. In 2017, an outbreak of JE occurred in Pingliang City, Gansu Province, with 78 adult cases and 7 deaths[5]. WNV is currently the most widespread flavivirus in the world, and in 2018, cases of WNV infection comprised 94% (2,647) of the arboviral disease cases recorded in the United States. Surveillance revealed a WNV epidemic in Kashgar, Xinjiang, China, from 2013 to 2016[6]. Encephalitis/meningitis caused by other arboviruses has been rarely reported in China.

      Enteroviruses (EVs) are a major cause of viral encephalitis/meningitis in the pediatric population in China[7]. After 2008, many outbreaks of hand-foot-mouth disease occurred in our country, and central nervous system damage is the main clinical manifestation of severe hand-foot-mouth disease, in which enterovirus A71 (EV-A71) is the main pathogen[8]; Coxsackievirus (CV) types 6, 10, and 16 (group A) and types 3, 4, and 5 (group B) also cause viral encephalitis[9,10] as do other respiratory viruses, including mumps, measles, and rubella viruses.

      Laboratory diagnosis of viral encephalitis pathogens is challenging, and the cause is successfully identified in only approximately 50% of patients with viral encephalitis due to the wide variety of causative pathogens, differences in their viral characteristics, and diversity of pathogenic mechanisms[11]. In recent years, high-throughput sequencing (HTS) technology, also known as next-generation sequencing (NGS), has been increasingly used for infectious disease surveillance[11]. Two different NGS strategies are used for the molecular diagnosis of infectious diseases: Metagenome NGS (including macrotranscriptome sequencing) and targeted amplification sequencing (the sequencing strategy used in this study). Theoretically, macrogenome sequencing is useful for capturing the whole-genome sequences of unknown pathogens with great sequencing depth and massive data output. However, it generates a large amount of host or background genomic data and is expensive[12,13]. By contrast, targeted amplification sequencing is more efficient, accurate, and less costly. Multiplex detection methods for the pathogens that cause viral encephalitis have not been well studied. In this study, we established a platform for the detection of viral encephalitis pathogens using amplicon sequencing.

    • In this study, we screened various viral encephalitis pathogens based on their domestic and international incidences and epidemiological trends. Ultimately, 12 species were selected: HSV-1, HSV-2, VZV, EBV, and HCMV in the family Herpesviridae; JEV and WNV in the family Flaviviridae; EV71, CA6, CA10, and CA16 in the genus Enterovirus; and mumps virus in the family Paramyxoviridae.

    • The complete workflow of this study is shown in detail in Figure 1, including (i) primer design, (ii) DNA/RNA extraction, (iii) real-time reverse transcription-polymerase chain reaction(RT-PCR) for concentration estimation, (iv) cDNA synthesis, (v) multiplex PCR amplification, (vi) library preparation, (vii) sequencing, (viii) data analysis.

      Figure 1.  Amplicon sequencing workflow.

    • Primers for the selected pathogens were designed and validated against their target genes (Table 1), and the specificity of the primers was verified using the National Center for Biotechnology Information (NCBI) BLAST. Primers were synthesized by Shanghai Bioengineering Technology Service.

      Table 1.  Summary of primers for various pathogens

      Primer
      name
      Primer sequence (5'–3') Amplicon size (bp) Target gene Ref
      HSV-1-F
      HSV-1-R
      GGTCAGCTCGTGATTCTGCA
      CGCATCAAGACCACCTCCTC
      106 UL27
      HSV-2-F
      HSV-2-R
      CTAGTTGTCGCGGTGGGACT
      TAGTACACAGTGATCGGGAT
      212 US5 [14]
      EBV-F
      EBV-R
      CTCTAACTCCAACGAGGGCAG
      GAGGGCCTCCATCATTTCC

      320

      LMP1


      HCMV-F
      HCMV-R
      AATGATATCCGTACTGGGTCCCATT
      TGATGATGGGGATGTTCAGCAT

      350

      UL83


      VZV-F
      VZV-R
      GGGTTTTGTATGAGCGTTGG
      CCCCCGAGGTTCGTAATATC
      447 ORF22
      [15]
      JEV-F
      JEV-R
      CGTTCTTCAAGTTTACAGCATTAGC
      CCYRTGTTYCTGCCAAGCATCCAMCC
      674 E [16]
      WNV-F
      WNV-R
      ACCAACTACTGTGGAGTC
      TTCCATCTTCACTCTACACT
      445 E [17]
      EVs-F
      EVs-R
      TTCTGTTTCCCCGGACTGAG
      TAAAAGGAAACACGGACACCCA
      400 VP3
      Mumps-F
      Mumps-R
      AATATCAAGTAGTGTCGATGA
      AGGTGCAAAGGTGGCATTGTC
      316
      SH
      [18]
        Note. − is a self-designed primer; HSV-1, herpes simplex virus-1; HSV-2, herpes simplex virus-2; EBV, epstein-barr virus; HCMV, human cytomegalovirus; VZV, varicella zoster virus; JEV, Japanese encephalitis virus; WNV, west nile virus; EVs, Enteroviruses.

      In the initial primer pool, we included a total of 16 pairs of primers, but after optimization, the primer pool of this platform finally conducted verification and later experiments against nine pairs of primers for 12 viruses, including HSV1, HSV2, EBV, HCMV, VZV, JEV, WNV, EV71, CA6, CA10, CA16, and mumps virus, with five pairs referring to relevant literature and four pairs designed in this study. We performed specificity verification on NCBI and PCR verification using the virus strain’s nucleic acid for the primers in the references. The primary reference sequences of the pathogens were downloaded from the NCBI database for the primers designed in this study, and multiple reference sequences for the same virus were compared online by muscle (https://www.ebi.ac.uk/Tools/msa/muscle/). Primers were designed using Geneious Prime software. According to the principles of primer design, primers with excessive mismatches or low specificity should be modified, eliminated, or redesigned manually.

    • The nucleic acids of HSV-1, HSV-2, HCMV, and EBV were derived from the aqueous humor of clinical patients with anterior uveitis; nucleic acids for EV71, CA6, CA10, CA16, and mumps virus were obtained from pharyngeal swabs of patients who were clinically positive for these viruses; and for VZV, nucleic acids were extracted from vaccines. The other two viruses (JEV and WNV) were obtained from strains maintained in Institute of Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention. RNA was extracted from RNA virus strains using the Qiagen Viral RNA mini kit (Qiagen, #52906), and DNA was extracted from DNA virus strains using the QIAamp DNA Mini Kit (Qiagen, #51304), according to the manufacturer’s instructions.

    • Prior to cDNA synthesis, RT-PCR was performed to estimate the concentration of the target template. Real-time RT-PCR was performed using a commercial kits. The reaction system was configured, and the reaction procedure was determined according to the manufacturer’s instructions.

      DNA was extracted directly from viruses. For RNA viruses, RNA was extracted, reverse-transcribed into cDNA, and the DNA was amplified. PCR was used to confirm the specificity of primers for DNA viruses, and RT-PCR was used to confirm the specificity of primers for RNA viruses. The amplification products were analyzed using gel electrophoresis to assess amplification specificity, and the fragment sizes of the target bands were compared with the electrophoresis map of the PCR products detected via gel electrophoresis to determine whether they were consistent with the predicted primer-amplified fragment sizes. The PCR products were sent to Shanghai Bioengineering Engineering Service for sequencing. The sequencing results were verified using NCBI BLAST to ensure accuracy.

    • Nucleic acid samples with Ct values < 20 were subjected to 10–100-fold gradient dilutions prior to cDNA synthesis. SuperScript IV VILO Master Mix (Invitrogen, #11756500) was used for cDNA synthesis, according to the manufacturer’s instructions.

    • The primers in Table 1 were diluted to 10 μmol/L and mixed into one tube in equal volumes, and Q5 Hot Start High-Fidelity DNA Polymerase (NEB, #M0493L) was selected for multiplex PCR amplification. The cDNA template has a volume of 5 μL, and amplification was performed in a 50 μL reaction with primer concentration set to 0.02 μmol/L per primer. The reaction procedure for multiplex PCR was as follows: hot start at 98 °C for 30 s, followed by 30 cycles of 98 °C for 10 s, 52 °C for 20 s, 72 °C for 40 s,and 72 °C extension for 3 min.

    • Amplification products were purified using AMPure XP magnetic beads (Beckman Coulter, # A63881) at a sample-to-bead ratio of 1:1. Purified DNA samples were quantified using a Qubit 4.0 fluorometer (Invitrogen; #Q33238) with Qubit double-stranded DNA (dsDNA) high-sensitivity (HS) assay kits (Invitrogen; #Q32851). Depending on the quantification results, all DNA samples were diluted to 0.2 to 0.3 μg/μL prior to library preparation. After diluting each sample to 0.2 μg/μL, equal volumes were mixed into one tube (e.g., 5 μL for each sample), and Qubit quantification was then used to confirm that the mixed sample concentration was indeed 0.2 μg/μL.

    • DNA libraries were constructed using the Nextera XT DNA Library Preparation Kit (#FC-131-1024; Illumina) according to manufacturer’s instructions. After enzymatic fragmentation, library amplification was performed on the fragmented samples using combined dual indices (Nextera DNA Indexes, Illumina, #FC-121-1011). Library quantification was performed using a Qubit 4.0 fluorometer (Invitrogen, #cQ33238) and Qubit dsDNA HS Assay Kit (Invitrogen, # Q32851). Absolute quantification of libraries was performed using the Library Quantification Kit For Illumina. Libraries were scaled and diluted to 1.8 pmol/L and paired-ended 150-cycle high-throughput sequencing was performed on an Illumina Miniseq sequencing platform using the MiniSeq Mid Output Kit (300-cycles) (Illumina, #FS-420-1004).

    • For NGS downstream data, the CLC Genomics Workbench (Qiagen, #832021) was used for data quality control (QC), read trimming, mapping refining, and consensus extraction. NC_001806(Hsv-1), NC_001798(Hsv-2), NC_001348(VZV), NC_009942(WNV), NC_007605(EBV), NC_006273(HCMV), JE_U47032(JEV), NC_009942(WNV), KX_064282(CA6), KP_289398(CA10), JQ_354992(CA16), AY_4653561(EV71), and NC_002200(Mumps virus) were used as the reference sequences.

    • The primers presented in Table 1 were used for the PCR of each pathogen to determine whether they amplified the target fragment. All PCR products were sequenced (Sanger sequencing) to obtain the sequences of the target fragments, and BLAST showed that all sequences matched the reference sequences.

    • Multiple PCR amplifications for different pathogens were performed after mixing the optimized primers (Table 1), and the cDNA library of the pathogens targeted in this study was then sequenced. Target sequences of the pathogens were extracted from the sequencing data at coverage depths greater than 20×. The amplicon lengths were consistent with the predicted sizes of the amplified fragments. Preliminary verification was performed using NCBI BLAST, and all sequences matched their corresponding reference sequences. The experimental data are shown in Figure 2. Panel A shows the results of the pre-experiments (primers were not optimized, and sample concentrations were not adjusted), along with the coverage and sequencing depth for targeted sequence amplification of HSV-1, HSV-2, HCMV, EBV, VZV, JEV, WNV, EV71, CA6, CA10, CA16, and mumps virus. Notably, the primer pool contained two pairs of EBV-specific primers, but amplification using one pair of primers generated few sequences, indicating that the amplification efficiency of this primer pair was poor.

      Figure 2.  Coverage and sequencing depth map of pathogen target sequences. Coverage and sequencing depth of pathogen target sequences result: A shows the results of the pre-experiments, showing the coverage and sequencing depth of HSV-1, HSV-2, HCMV, EBV, VZV, JEV, WNV, EV71, CA6, CA10, CA16 and Mumps target sequences; B shows the sequencing results of samples at 10-fold dilution, showing the coverage and sequencing depth of VZV, JEV, WNV, EV71, CA6, CA10, CA16 and Mumps target sequences; C shows the sequencing results of the sample at 100-fold dilution, showing the coverage and sequencing depth of HCMV, EBV, VZV, JEV, WNV, EV71, CA6, CA10, CA16 and Mumps target sequences; D shows the sequencing results of samples at 1000-fold dilution, showing the coverage and sequencing depth of HSV-1, HSV-2, HCMV, EBV, VZV, JEV, WNV, EV71,CA6, CA10, CA16 and Mumps target sequences.

      Not all nucleic acid templates were derived from clinical samples; the JEV and WNV templates were extracted from virulent strains, and the VZV template nucleic acid was extracted from the vaccine. We generated serial dilutions of these nucleic acid samples (10-, 100-, and 1000-fold), and panel B shows the sequencing results for the 10-fold diluted samples (Ct values: 25.2–29.1), with the coverage and sequencing depths of the VZV, JEV, WNV, EV71, CA6, CA10, CA16, and mumps virus target sequences. Owing to the concentration limitations of some clinical samples, there were only one concentration of HSV-1 and HSV-2 and two concentrations of HCMV and EBV. Therefore, only eight pathogens are shown in panel B. Panel C of Figure 2 shows the sequencing results of the 100-fold diluted samples (Ct values: 29.1–32.7), with the coverage and sequencing depth of the target sequences for 10 pathogens (HCMV, EBV, VZV, JEV, WNV, EV71, CA6, CA10, CA16, and mumps virus). Panel D of Figure 2 shows the sequencing results for the 1000-fold diluted samples (Ct values: 33.1–35.5), with the coverage and sequencing depth of the target sequences for 12 pathogens (HSV-1, HSV-2, HCMV, EBV, VZV, JEV, WNV, EV71, CA6, CA10, CA16, and mumps virus). Amplicons were obtained from all the pathogen samples after gradient dilution. Notably, the number of reads for HCMV was the lowest, mainly due to the amplification efficiency of the primers.

      We compiled the experimental data, which included the CT values for each pathogen, number of reads, and reference sequence of the spliced target sequence (Table 2). In the pre-experiments, we found that the sequencing depth was not balanced among pathogens; CA10 had the highest total reads (2,563,545 reads), whereas HSV-2 had the fewest reads (6,308 reads), which may be related to the number of viral copies in the template or the amplification efficiency of the primers. The HSV-1, HSV-2, HCMV, and EBV samples were derived from the aqueous humor of patients with anterior uveitis; the EV71, CA6, CA10, CA16, and mumps virus samples were obtained from pharyngeal swabs of patients who were clinically positive for these viruses, and the remaining samples were nucleic acids recovered from viral strains, which may explain why the sequencing depth was not balanced among the pathogens. BLAST was used to compare the amplification sequences with the Sanger sequencing results, and the findings showed remarkable uniformity for all pathogens.

      Table 2.  Summary of sequencing results for all pathogens

      VirusPre-experiments10-fold100-fold1,000-foldRef
      Ct-valueReadsCt-valueReadsCt-valueReadsCt-valueReads
      HSV127.98,67833.921,932NC_001806
      HSV228.26,30833.614,562NC_001798
      HCMV30.136,75230.854634.00NC_006273
      EBV29.621,30729.146,48233.123,902NC_007605
      VZV24.6774,36327.0961,16629.4986,69834.02,069,900NC_001348
      JEV25.8642,00127.4907,26330.4102,00133.518,209JE_U47032
      WNV25.31,073,38827.2790,72931.0430,33234.7884,879NC_009942
      EV7124.12,225,72626.92,951,55331.62,178,52433.73,449,881AY_4653561
      CA626.92,013,31228.12,973,42232.72,195,62435.53,538,523KX_064282
      CA1021.12,401,00629.12,976,27331.22,213,09333.53,597,826KP_289398
      CA1624.42,563,54528.82,959,41631.42,189,64234.63,513,948JQ_354992
      Mumps23.1903,85825.2928,42930.5479,97833.2119,500NC_002200
        Note. — Indicates no data. HSV-1, herpes simplex virus-1; HSV-2, herpes simplex virus-2; EBV,epstein-barr virus; HCMV, human cytomegalovirus; VZV, varicella zoster virus; JEV, Japanese encephalitis virus;WNV, west nile virus; EVs, Enteroviruses
    • The results showed that the target sequences of various pathogens were obtained at a coverage depth level greater than 20× and the sequence lengths were consistent with the sizes of the predicted amplicons. The sequences were verified using the NCBI BLAST, and all results were consistent with the results of Sanger sequencing. Thus, amplicon-based high-throughput sequencing technology is feasible for the pathogenic detection of viral encephalitis as a supplementary detection method and is also a useful tool for high throughput screening of clinical samples.

      With the continuous development of sequencing technologies, HTS has brought new perspectives to the study of CNS infections and has recently been incorporated into guidelines for the management of encephalitis[19]. HTS can be used to identify viral pathogens in patients with encephalitis, meningoencephalitis, or meningitis of unknown origin, and the results can be used to provide effective treatment for immunocompromised patients[20]. Metagenomic next-generation sequencing (mNGS), a type of HTS, is important for the laboratory diagnosis of CNS infections, particularly for the identification of emerging pathogens[21-23]. However, the application of NGS for viral encephalitis has been hampered by the limitations of low viral load in the cerebrospinal fluid (CSF), high number of mNGS background sequences, and high cost. Many studies have actively addressed these shortcomings. For example, researchers have investigated a metagenomic sequencing protocol that includes viral enrichment to reduce the problem of low viral load in the CSF[21]. In some studies, DNA amplification kits were used to overcome insufficient viral nucleic acid levels. However, only few studies have applied deep sequencing for multipathogen detection in viral encephalitis. Multipathogen sequencing is key for both the rapid identification of the causative agent in infections and source investigation during disease outbreaks, which requires tools that are efficient, versatile, convenient, and with minimal complexity.

      In this study, we established a technological platform for the detection of viral encephalitis pathogen detection based on amplicon sequencing by combining the benefits of deep sequencing and multipathogen detection. Although multiple PCR detection methods for 18 pathogens in the CSF of children with viral encephalitis have been established and validated for multiple pathogen detection[24], the impact of low viral load in the CSF and the time-consuming and laborious nature of screening large volumes of samples cannot be avoided. The sequencing cost per sample on Illumina and Nanopore platforms increases with the number of samples, although the turnaround time decreases[25]. The platform established in this study can be used to detect a larger number of samples than can be detected using mNGS, thereby reducing sequencing costs. We believe that the application of NGS for the diagnosis of viral nervous system infections should not be limited to mNGS. Compared with mNGS, the advantages of the method developed in this study are its simplicity, standardization, high sensitivity, and cost-effectiveness. This strategy can also be used for the detection of viral encephalitis using second-generation sequencing. We designed or selected one primer pair for each of the 12 pathogens and validated them using nucleic acid standards. The obtained sequences were compared with those in the NCBI Genome Database to validate the nine primer pairs. For the primers designed in this study, the principles of primer design were strictly followed to avoid mismatches, primer dimers, and hairpin structures. Replacing one or more bases at key positions in a hairpin structure can significantly reduce the hairpin Tm, thus ensuring the efficiency of the primer. All primers were checked to ensure that their annealing temperature (55–70 °C), GC content (40%–60%), and hairpin Tm (< 50 °C) were within the appropriate ranges.

      When preparing a library for high-throughput sequencing, in multiplex PCR, more than two pairs of primers are added to the same PCR system, and each pair of primers attaches to the corresponding complementary template, if present, allowing the amplification of multiple target DNA fragments in the same reaction system. Multiplex PCR is an efficient, cost-effective, and scalable method for the detection of multiple pathogens by amplifying multiple target fragments. The design of a multiplex PCR assay is much more complex than that of an ordinary PCR assay and is not simply a matter of mixing multiple pairs of specific primers into a single reaction system. The composition of the reaction system and reaction conditions must be repeatedly adjusted based on experimental results to accommodate the simultaneous amplification of multiple fragments. The target region, along with the size of the amplified fragment, template-primer binding kinetics, and optimal cycling conditions, must be carefully considered for amplification. When designing primers for multiplex PCR, one should pay particular attention to the non-complementarity between primers, especially at the 3' end, to prevent the formation of primer dimers, in addition to adhering to the general rules of PCR primer design. There should also be no greater complementarity between any two primers and any other amplification fragments or templates and no greater homology between amplification fragments. Possible primer interactions can be addressed by dividing the interacting primers into two tubes for amplification or replacement.

      The detection technology developed in this study is applicable to laboratory-developed tests (LDTs) and has very good development prospects for clinical diagnosis and mass screening of patients with viral encephalitis. LDTs are created by individual laboratories or health systems with requisite experience in designing, validating, and overseeing high-complexity assays. Shanghai, China, has identified a number of public medical institutions as pilot units for high-quality test development and has encouraged hospitals to conduct their own in vitro diagnostic reagent development pilots. The method developed in this study could detect sensitive and specific pathogens in multiple samples, detect co-infected samples, and distinguish the 12 pathogens included in this study with specificity by establishing a technical platform based on amplicon sequencing for the detection of viral encephalitis pathogens. The early and accurate detection of pathogens enables rapid and effective disease control, prevention, and specific clinical treatment. The establishment of this platform provides a viable solution to the current lack of genetic testing technology for early on-site diagnosis, prevention, and control of viral encephalitis. This study framework is also appropriate for the nanopore long-read sequencing technique, which offers a powerful tool for the diagnosis, investigation, and monitoring of infectious diseases[26]. It is also anticipated that other researchers will incorporate other pathogens that cause encephalitis/meningitis syndrome, such as bacteria and parasites, into this platform and perform methodological exploration and establishment of other amplicon sequencing platforms.

参考文献 (26)

目录

    /

    返回文章
    返回